RNA Fragment DeepSeq Library Preparation Protocol



Similar documents
Updated: July ' End label RNA markers (18mer) and (24mer) with Kinase and 32P-gamma-ATP. Gel purify labeled markers.

RT-PCR: Two-Step Protocol

First Strand cdna Synthesis

RevertAid Premium First Strand cdna Synthesis Kit

1) Vector Preparation sg 1371 w/blp1 Ef1α puro t29 BFP (602 ng/ul)

NimbleGen DNA Methylation Microarrays and Services

The RNAi Consortium (TRC) Broad Institute

FOR REFERENCE PURPOSES

Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform

Real-time quantitative RT -PCR (Taqman)

How To Write An Ipa

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation

Application Guide... 2

SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual

TransformAid Bacterial Transformation Kit

TIANquick Mini Purification Kit

RNA Isolation for Frozen Mouse Livers and Reverse Transcription

RIBOPROTECT. RNase Inhibitor RT33-020, RT33-100

Reverse Transcription System

Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform

RT rxns. RT rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl

Illumina TruSeq DNA Adapters De-Mystified James Schiemer

How To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent

Amplicon Template Preparation and Sequencing

ISOLATE II PCR and Gel Kit. Product Manual

Global MicroRNA Amplification Kit

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011

Troubleshooting Guide for DNA Electrophoresis

qstar mirna qpcr Detection System

HiPer RT-PCR Teaching Kit

Mir-X mirna First-Strand Synthesis Kit User Manual

mircute mirna qpcr Detection Kit (SYBR Green)

ab Hi-Fi cdna Synthesis Kit

FastLine cell cdna Kit

All-in-One First-Strand cdna Synthesis Kit

Hepatitis B Virus Genemer Mix

Electrophoresis, cleaning up on spin-columns, labeling of PCR products and preparation extended products for sequencing

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200

Detailed protocol: Combined method for RNA isolation. from cartilage

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)

Troubleshooting Sequencing Data

Plant Genomic DNA Extraction using CTAB

EZ Load Molecular Rulers. Catalog Numbers bp bp bp PCR bp kb Precision Mass

Sanger Sequencing: Sample Preparation Guide

BUFFERS and MEDIAS Coomassie Blue Staining Solution Coomassie blue Destaining Solution DMEM Normal Cell Culture Media

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products

MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C

Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280.

MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA

ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas

RNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr)

GRS Plasmid Purification Kit Transfection Grade GK (2 MaxiPreps)

Paired-End Sample Preparation Guide

In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab)

SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis

An In-Gel Digestion Protocol

Procedure for RNA isolation from human muscle or fat

Sequencing Library qpcr Quantification Guide

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr

All-in-One mirna qrt-pcr Detection System Handbook

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,

The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade plasmid DNA.

CompleteⅡ 1st strand cdna Synthesis Kit

ELUTION OF DNA FROM AGAROSE GELS

Genomic DNA Extraction Kit INSTRUCTION MANUAL

Real-time monitoring of rolling circle amplification using aggregation-induced emission: applications for biological detection

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

MMLV High Performance Reverse Transcriptase

Table of Contents. I. Description II. Kit Components III. Storage IV. 1st Strand cdna Synthesis Reaction... 3

Classic Immunoprecipitation

HighPure Maxi Plasmid Kit

1/12 Dideoxy DNA Sequencing

Cluster Generation. Module 2: Overview

RevertAid First Strand cdna Synthesis Kit (#K1621 for 10 reactions) COMPONENTS OF THE KIT

2D gel electrophoresis

Preparing Samples for Sequencing Genomic DNA

QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.

Path-ID Multiplex One-Step RT-PCR Kit

USER GUIDE. Encore PART NOS and SP Rapid Library Systems

DNA SEQUENCING (using an ABI automated sequencer)

Terra PCR Direct Polymerase Mix User Manual

Arcturus PicoPure RNA Isolation Kit. User Guide

Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541

Protein Precipitation Protocols

UltraClean Soil DNA Isolation Kit

MinElute Handbook. Sample & Assay Technologies. March 2008

Chromatin Immunoprecipitation

Western Blot Protocol (updated on 05/20/14)

PrimeSTAR HS DNA Polymerase

Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna

Rakesh N. Veedu a, Birte Vester b & Jesper Wengel a a Nucleic Acid Center, Department of Physics and Chemistry, Southern Denmark, Odense M, Denmark

Aurora Forensic Sample Clean-up Protocol

TaqMan Fast Advanced Master Mix. Protocol

DNA Isolation Kit for Cells and Tissues

How To Get Rid Of Small Dna Fragments

Transcription:

RNA Fragment DeepSeq Library Preparation Protocol I) LIGATION Recommended input: RNA between 0.05-2 pmol; must have 3' OH 1. Thaw 10X T4 RNA Ligase Reaction Buffer, 50% PEG8000, 20 mm DTT, 7 um App Adaptor and keep on ice 2. Add the following to a PCR tube on ice: 7 um App Adaptor 1.0 µl RNA x µl Water to 4.8 µl 3. Heat 65 C 10 min; 4 C hold 4. Transfer tubes to ice. Add the following to each tube for a total reaction volume of 15 µl: 1X rxn note minimize pipetting error by 10X Buffer (from NEB) 1.5 µl preparing a ligation mastermix 50% PEG8000 7.5 µl 33 mm DTT 0.45 µl T4RNL2 Tr. K227Q 0.75 µl Total Volume added 10.2 ul 5. Incubate 30 C for 6 hr; 65 C 20 min heat inactivation; 4 C hold II) REVERSE TRANSCRIPTION 1. Thaw RT Primer, 10 mm dntp mix, 5X First-Strand Buffer w/o MgCl2 (see recipe below), 100 mm DTT; store on ice 2. Add to 15 µl ligation on ice, same tube: 10 um RT Primer 1.0 µl 10 mm dntp mix 2.25 µl Water 14.3 µl 3. Incubate 65 C 5 min; 4 C hold 4. Transfer to ice and add the following to each tube for a total reaction volume of 45 µl: 5X FS Buffer w/o MgCl 2 9.0 µl 100 mm DTT 2.25 µl SSIII (200U/µl) 1.2 µl 5. Incubate 55 C 30-45 min; heat inactivate 70 C 15 min; 4 C hold 6. Add 25 µl 2X Denaturing Load Buffer (see recipe below) 7. Gel purify RT product on 10% denaturing PAGE 8. Cut RT product from gel, using a new razor blade for each sample 9. Crush gel fragment: place in a 0.5 ml eppy sitting inside a 2 ml eppy, having previously poked a 22 gauge needle hole in the bottom of the 0.5 ml eppy; spin 10,000xg for 3 min at RT to crush

10. Elute in DNA Elution Buffer (see recipe below) O/N at 37 C with constant rotation (add enough volume so that the gel fragments are free to move in the tube) 11. Transfer slurry to Spin-X Column and spin at 10,000xg for 3 min, RT 12. Concentrate eluate, either by SpeedVac or butanol extraction 13. Ethanol precipitate. Note: if the RT fragments are < 100 nts, you might improve precipitation efficiency by adding MgCl 2 to a final concentration of 10 mm before adding ethanol III) CIRCULARIZATION 1. Thaw CircLigase I Reaction Buffer, 1 mm ATP, 50 mm MnCl 2; 5M Betaine stored @ 4 C 2. Spin down RT product at 12,000xg, 4 C, 30 min 3. Wash with 1 ml 75% EtOH (stored at -20 C) 4. Repeat spin for 10 min 5. Remove as much EtOH as possible; heat pellet at 37 C for 3-5 min to dry pellet 6. Resuspend DNA in 10 µl water; 7. Transfer DNA to PCR tube and prepare 20 µl Circularization Reaction: RT Product 10.0 µl CircLigaseI Rxn Buffer 2.0 µl 1 mm ATP 1.0 µl 50 mm MnCl 2 1.0 µl 5M Betaine 4.0 µl Water 1.0 µl CircLigase 1.0 µl 8. Incubate 60 C 3-4 hr; inactivate 80 C 10 min IV) PCR AMPLIFICATION 1. Thaw phosphorothioate PE1.0 and PE2.0 primers and KAPA 2X HiFi; store on ice once thawed 2. To determine the appropriate number of PCR cycles, prepare several small-scale reactions with phosphorothioate primers: KAPA 2x HiFi 7.5 µl Denaturation: 45 sec @ 98 C 10 um PE 1.0 phos 0.75 µl Cycling: 15 sec @ 98 C 10 um PE 2.0 phos 0.75 µl 30 sec @ 65 C Circularization Rxn up to 3 µl 30 sec @ 72 C Water to 15 µl Final Extension: 1 min @ 72 C 3. Analyze on normal length 8% nondenaturing PAGE to determine the optimal number of PCR cycles, ensuring that primers show no depletion (i.e. are still abundant in the rxn) 4. Repeat with a 50 µl PCR for fixed cycle number (determined in steps 2-3): KAPA 2x HiFi 25 µl 10 um PE 1.0 2.5 µl 10 um PE 2.0 2.5 µl Circularization Rxn 3.3*volume used in test Water to 50 µl

5. Purify PCR fragment on 8% nondenaturing PAGE run on double-wide apparatus to minimize heating and denaturation of double stranded library. Alternatively, replace steps 5-8 with purification on Pippin Prep/BluePippin 6. Stain gel in SYBR Gold, excise product band, crush as in II Step 8 7. Elute by nutating O/N in DNA Elution Buffer (see recipe below); the following morning, remove some buffer and keep on ice; add back an equal volume of DNA Elution Buffer for 2-4 more hours to elute as much material as possible from the gel fragments 8. Concentrate the eluate by SpeedVac or butanol extraction 9. Ethanol precipitate 10. Spin down libraries at 12,000 x g for 30 min, 4 C. Wash 2x 75% EtOH. Remove as much EtOH as possible by pipetting and immediately resuspend pellet in 20 µl ddh20 11. Quantify library by submitting 2 µl for Bioanalyzer analysis on High Sensitivity DNA Chip 12. Pool libraries (if necessary) to a final concentration of 10 nm (usually submit at least 15 µl). If necessary, SpeedVac samples on low setting, 3 min increments, to concentrate the libraries GENERAL NOTES: 1. The inclusion of 4 degenerate bases (NNNN) at the beginning of the 5' adaptor allows us to determine if a sequence was captured multiple times or over-amplified during PCR. However, this benefit of NNNN only applies if your sequence read is longer than your RNA insert length, meaning you will read through to these bases. If you want the benefit of NNNN but are using a short sequencing run, move the NNNN to the RT primer, between the PE1.0 sequence and the barcode. The first 4 bases of the sequencing reaction will be the degenerate bases, then the 5 nt barcode, then GG, then your sample. Ex. BC1: 5' - pggatcacnnnnagatcggaagagcgtcgtgtagggaaagagtgt-sp18-2. In an attempt to keep the sample free from contaminants, all pipetting should be done with filter tips (use low retention when possible, especially for handling viscous solutions like PEG8000) 3. The RT is done with a buffer lacking additional MgCl 2, since a 3-fold dilution of the ligation buffer yields MgCl 2 concentration optimal for SSIII 4. All primers should be gel purified or HPLC purified 5. IMPORTANT: CircLigase circularization efficiency can change depending on the lot (also see Epicentre's CircLigase patent #WO 2010094040 A1; Jendrisak, Decker and Dahl). 1Therefore, every tube of CircLigase should be checked for circularization efficiency before use in library preparation. To do this, perform an RT with N24 RNA and 32 P dctp, gel purify the RT product and test circularization on a gel. 6. If you're having trouble with these reactions, your primers may not be fully 5' phosphorylated. A few other labs have occasionally run into this issue. If this is a problem, 5' phosphorylate with T4 PNK prior to use, ensuring both the RT primer and the 3' adaptor (before Mth Ligase preadenylation that requires 5' P; if manually pre-adenylating) are fully 5' phosphorylated. 7. Depending on the amount of RNA input, your RT product may not be visible with SYBR Gold staining. It is advisable to use a guide oligo in a separate ligation/rt reaction to indicate where to cut on the gel.

PURCHASED REAGENTS: Published in Heyer EE, et al. NAR 2014; doi:10.1093/nar/gku1235 T4 RNA Ligase 2, truncated K227Q NEB #M0351L (PEG8000 currently comes with the enzyme) Superscript III Reverse Transcriptase Invitrogen #18080-044 CircLigase ssdna Ligase Epicentre Biotechnologies #CL4115K 5M Betaine Sigma #B0300-5VL KAPA HiFi Library Amplification Kit KAPA Biosystems #KK2611 or #KK2612 PREPARED REAGENTS: 5X First-Strand Buffer w/o MgCl 2 250 mm Tris-HCl (ph 8.3 at room temp), 375 mm KCl DNA Elution Buffer (TE) 10 mm Tris-HCl (ph 8.0 at room temp), 1 mm EDTA 2X Denaturing Load Buffer 2 ml 5X TBE, 1.2 g Ficoll Type 400, 4.2 g Urea, 2 mg bromophenol blue, 2 mg xylene cyanol, up to 10 ml ddh20; store at 4 C - heat to get into solution or nutate O/N - add dyes after adjusting the volume to 10 ml OLIGOS: Preadenylated Adaptor for SE Sequencing: 5' AppTGGAATTCTCGGGTGCCAAGGddC 3' (mircat-33 Conversion Kit from IDT) or 5' AppNNNNTGGAATTCTCGGGTGCCAAGGddC 3' (order 5' phosphorylated; preadenylate with NEB 5' DNA Adenylation Kit - E2610; gel purify) RT Primers (barcodes based upon TruSeq barcodes for Illumina sequencing) for SE Sequencing: NOTE: the barcodes used in Heyer et al. Nucleic Acids Research 2014; doi: 10.1093/nar/gku1235 are the reverse of those used below due to an initial ordering mistake. The sequences below should be used, as the first few sequenced nucleotides are more base-balanced. BC1: 5' - pggcactaagatcggaagagcgtcgtgtagggaaagagtgt-sp18- BC2: 5' - pgggtagcagatcggaagagcgtcgtgtagggaaagagtgt-sp18- BC3: 5' - pggtcgatagatcggaagagcgtcgtgtagggaaagagtgt-sp18- BC4: 5' - pggcctcgagatcggaagagcgtcgtgtagggaaagagtgt-sp18-

BC5: 5' - pggtgacaagatcggaagagcgtcgtgtagggaaagagtgt-sp18- BC6: 5' - pggtagacagatcggaagagcgtcgtgtagggaaagagtgt-sp18- BC7: 5' - pgggccctagatcggaagagcgtcgtgtagggaaagagtgt-sp18- BC8: 5' - pggatcggagatcggaagagcgtcgtgtagggaaagagtgt-sp18- BC9: 5' - pggactgaagatcggaagagcgtcgtgtagggaaagagtgt-sp18- BC10: 5' - pggtgttcagatcggaagagcgtcgtgtagggaaagagtgt-sp18- BC11: 5' - pggtaagtagatcggaagagcgtcgtgtagggaaagagtgt-sp18- BC12: 5' - pggagatgagatcggaagagcgtcgtgtagggaaagagtgt-sp18- PCR Primers (PE DNA from Illumina): PE PCR Primer 1.0: 5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T 3' PE PCR Primer 2.0: 5' CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC*T 3' * indicates location of phosphorothioate bond