10.1 The Common Gateway Interface
|
|
|
- Jonah Jones
- 10 years ago
- Views:
Transcription
1 10.1 The Common Gateway Interface - Markup languages cannot be used to specify computations, interactions with users, or to provide access to databases - CGI is a common way to provide for these needs, by allowing browsers to request the execution of server-resident software - CGI is just an interface between browsers and servers - An HTTP request to run a CGI program specifies a program, rather than a document - Servers can recognize such requests in two ways: 1. By the location of the requested file (special subdirectories for such files) 2. A server can be configured to recognize executable files by their file name extensions - A CGI program can produce a complete HTTP response, or just the URL of an existing document Chapter by Addison Wesley Longman, Inc. 1
2 10.2 CGI Linkage - CGI programs often are stored in a directory named cgi-bin - Some CGI programs are in machine code, but Perl programs are usually kept in source form, so perl must be run on them - A source file can be made to be executable by adding a line at their beginning that specifies that a language processing program be run on them first For Perl programs, if the perl system is stored in /usr/local/bin/perl, as is often is in UNIX systems, this is #!/usr/local/bin/perl -w - An HTML document specifies a CGI program with the hypertext reference attribute, href, of an anchor tag, <a>, as in <a href = " Click here to run the CGI program, reply.pl </a> Chapter by Addison Wesley Longman, Inc. 2
3 10.2 CGI Linkage (continued) <!-- reply.html - calls a trivial cgi program --> <html> <head> <title> HTML to call the CGI-Perl program reply.pl </title> </head> <body> This is our first CGI-Perl example <a href = " Click here to run the CGI program, reply.pl </a> </body> </html> - The connection from a CGI program back to the requesting browser is through standard output, usually through the server - The HTTP header needs only the content type, followed by a blank line, as is created with: print "Content-type: text/html \n\n"; Chapter by Addison Wesley Longman, Inc. 3
4 10.2 CGI Linkage (continued) #!/usr/local/bin/perl # reply.pl a CGI program that returns a # greeting to the user print "Content-type: text/html \n\n", "<html> <head> \n", "<title> reply.pl example </title>", " </head> \n", "<body> \n", "<h1> Greetings from your Web server!", " </h1> \n </body> </html> \n"; Chapter by Addison Wesley Longman, Inc. 4
5 10.3 Query String Format - A query string includes names and values of widgets - Widget values are always coded as strings - The form of a name/value pair in a query string is: name=value - If the form has more than one widget, their values are separated with ampersands milk=2&payment=visa - Each special character is coded as a percent sign and a two-character hexadecimal number (the ASCII code for the character) - Some browsers code spaces a plus signs, rather than as %20 Chapter by Addison Wesley Longman, Inc. 5
6 10.4 The CGI.pm Module - A Perl module serves as a library - The Perl use declaration is used to make a module available to a program - To make only part of a module available, specify the part name after a colon (For our purposes, only the standard part of the CGI module is needed) use CGI ":standard"; - Common CGI.pm Functions - Shortcut functions produce tags, using their parameters as attribute values - e.g., h2("very easy!"); produces <h2> Very easy! </h2> - In this example, the parameter to the function h2 is used as the content of the <h2> tag Chapter by Addison Wesley Longman, Inc. 6
7 10.4 The CGI.pm Module (continued) - Tags can have both content and attributes - Each attribute is passed as a name/value pair, just as in a hash literal - Attribute names are passed with a preceding dash textarea(-name => "Description", -rows => "2", -cols => "35" ); Produces: <textarea name ="Description" rows=2 cols=35> </textarea> Chapter by Addison Wesley Longman, Inc. 7
8 10.4 The CGI.pm Module (continued) - If both content and attributes are passed to a function, the attributes are specified in a hash literal as the first parameter a({-href => "fruit.html"}, "Press here for fruit descriptions"); Output: <a href="fruit.html"> Press here for fruit descriptions</a> - Tags and their attributes are distributed over the parameters of the function ol(li({-type => "square"}, ["milk", "bread", "cheese"])); Output: <ol> <li type="square"milk</li> <li type="square"bread</li> <li type="square"cheese</li> </ol> - CGI.pm also includes non-shortcut functions, which produce output for return to the user - A call to header() produces: Content-type: text/html;charset=iso blank line -- Chapter by Addison Wesley Longman, Inc. 8
9 10.4 The CGI.pm Module (continued) - The start_html function is used to create the head of the return document, as well as the <body> tag - The parameter to start_html is used as the title of the document start_html("bill s Bags"); DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "DTD/xhtml11-transitional.dtd"> <html xmlns= " lang="en-us"> <head><title>bill s Bags</title> </head><body> - The param function is given a widget s name; it returns the widget s value - If the query string has name=abraham in it, param("name") will return "Abraham" - The end_html function generates </body></html> SHOW popcorn.html, its display, and popcorn.pl Chapter by Addison Wesley Longman, Inc. 9
10 10.5 A Survey Example - We will use a form to collect survey data from users - The program needs to accumulate survey results, which must be stored between form submissions - Store the current results in a file on the server - Because of concurrent use of the file, it must be protected from corruption by blocking other accesses while it is being updated - Under UNIX, this can be done with the Perl function, flock, using the parameter value 2 to specify a lock operation and 8 to specify an unlock operation --> SHOW conelec.html and its display - Two CGI programs are used for this application, one to collect survey submissions and record the new data, and one to produce the current totals - The file format is eight lines, each having seven values, the first four for female responses and the last four for male responses Chapter by Addison Wesley Longman, Inc. 10
11 10.5 A Survey Example (continued) - The program to collect and record form data must: 1. Decode the data in the query string 2. Determine which row of the file must be modified 3. Open, lock, read, unlock, and close the survey data file 4. Split the affected data string into numbers and store them in an array 5. Modify the affected array element and join the array back into a string 6. Open, lock, write, unlock, and close the survey data file --> SHOW conelec1.pl Chapter by Addison Wesley Longman, Inc. 11
12 10.5 A Survey Example (continued) - Tables are easier to specify with CGI.pm - The table is created with the table function - The border attribute is specified as a parameter - The table s caption is created with a call to caption, as the second parameter to table - Each row of the table is created with a call to Tr - A heading row is created with a call to th - Data cells are created with calls to td - The calls to Tr, th, and td require references as parameters - Suppose we have three arrays of sales numbers, one for each of three salespersons; each array has one value for each day of the work week - We want to build a table of this information, using CGI.pm Chapter by Addison Wesley Longman, Inc. 12
13 10.5 A Survey Example (continued) table({-border => "border"}, caption("sales Figures"), Tr( [th(["salesperson", "Mon", "Tues", "Wed", "Thu", "Fri"]), th("mary").td(\@marysales), th("freddie").td(\@freddiesales), th("spot").td(\@spotsales), ] ) ); Chapter by Addison Wesley Longman, Inc. 13
14 10.5 A Survey Example (continued) - The program that produces current results must: 1. Open, lock, read the lines into an array of strings, unlock, and close the data file 2. Split the first four rows (responses from females) into arrays of votes for the four age groups 3. Unshift row titles into the vote rows (making them the first elements) 4. Create the column titles row with th and put its address in an array 5. Use td on each rows of votes 6. Push the addresses of the rows of votes onto the row address array 7. Create the table using Tr on the array of row addresses 8. Repeat Steps 2-7 for the last four rows of data (responses from males) Chapter by Addison Wesley Longman, Inc. 14
15 10.5 A Survey Example (continued) --> SHOW conelec2.pl --> SHOW Figure Cookies - A session is the collection of all of the requests made by a particular browser from the time the browser is started until the user exits the browser - The HTTP protocol is stateless - But, there are several reasons why it is useful for the server to relate a request to a session - Shopping carts for many different simultaneous customers - Customer profiling for advertising - Customized interfaces for specific clients - Approaches to storing client information: - Store it on the server too much to store! - Store it on the client machine - this works Chapter by Addison Wesley Longman, Inc. 15
16 10.6 Cookies (continued) - A cookie is an object sent by the server to the client - Cookies are created by some software system on the server (maybe a CGI program) - Every HTTP communication between the browser and the server includes information in its header about the message - At the time a cookie is created, it is given a lifetime - Every time the browser sends a request to the server that created the cookie, while the cookie is still alive, the cookie is included - A browser can be set to reject all cookies - CGI.pm includes support for cookies cookie(-name => a_cookie_name, -value => a_value, -expires => a_time_value); - The name can be any string - The value can be any scalar value - The time is a number followed by a unit code (d, s, m, h, M, y) Chapter by Addison Wesley Longman, Inc. 16
17 10.6 Cookies (continued) - Cookies must be placed in the HTTP header at the time the header is created header(-cookie => $my_cookie); - To fetch the cookies from an HTTP request, call cookie with no parameters - A hash of all current cookies is returned - To fetch the value of one particular cookie, send the cookie s name to the cookie function $age = cookie( age ); - Example: A cookie that tells the client the time of his or her last visit to this site - Use the Perl function, localtime, to get the parts of time ($sec, $min, $hour, $mday, $mon, $year, $wday, $yday, $isdst) = localtime; SHOW day_cookie.pl Chapter by Addison Wesley Longman, Inc. 17
18 10.7 Animation Using CGI - CGI was once a good way to create animation, but now there are several better ways - There are two ways to use CGI to create animation, neither of which requires user intervention 1. Client-pull animation - The client repeatedly requests images from the server, which it displays in sequence - Problems: Internet is not fast enough, and if the approach were widely used, it would pull down the speed of the whole Internet 2. Server-push animation - The server sends the sequence of images to the client, with delays between them - Problems: Also creates a huge load on the Internet, and it is supported only by Netscape Chapter by Addison Wesley Longman, Inc. 18
Perl/CGI. CS 299 Web Programming and Design
Perl/CGI CGI Common: Gateway: Programming in Perl Interface: interacts with many different OSs CGI: server programsprovides uses a well-defined users with a method way to to gain interact access with to
7 Why Use Perl for CGI?
7 Why Use Perl for CGI? Perl is the de facto standard for CGI programming for a number of reasons, but perhaps the most important are: Socket Support: Perl makes it easy to create programs that interface
CGI Programming. What is CGI?
CGI Programming What is CGI? Common Gateway Interface A means of running an executable program via the Web. CGI is not a Perl-specific concept. Almost any language can produce CGI programs even C++ (gasp!!)
Web Development. Owen Sacco. ICS2205/ICS2230 Web Intelligence
Web Development Owen Sacco ICS2205/ICS2230 Web Intelligence Introduction Client-Side scripting involves using programming technologies to build web pages and applications that are run on the client (i.e.
LabVIEW Internet Toolkit User Guide
LabVIEW Internet Toolkit User Guide Version 6.0 Contents The LabVIEW Internet Toolkit provides you with the ability to incorporate Internet capabilities into VIs. You can use LabVIEW to work with XML documents,
CGI Programming. Examples
CGI Programming Perl is used as an example throughout. Most of what is said here applies to any common programming language (ie C, C++, python etc.). Perls CGI library provides tools to simplify web page
<option> eggs </option> <option> cheese </option> </select> </p> </form>
FORMS IN HTML A form is the usual way information is gotten from a browser to a server HTML has tags to create a collection of objects that implement this information gathering The objects are called widgets
1. When will an IP process drop a datagram? 2. When will an IP process fragment a datagram? 3. When will a TCP process drop a segment?
Questions 1. When will an IP process drop a datagram? 2. When will an IP process fragment a datagram? 3. When will a TCP process drop a segment? 4. When will a TCP process resend a segment? CP476 Internet
Perl in a nutshell. First CGI Script and Perl. Creating a Link to a Script. print Function. Parsing Data 4/27/2009. First CGI Script and Perl
First CGI Script and Perl Perl in a nutshell Prof. Rasley shebang line tells the operating system where the Perl interpreter is located necessary on UNIX comment line ignored by the Perl interpreter End
reference: HTTP: The Definitive Guide by David Gourley and Brian Totty (O Reilly, 2002)
1 cse879-03 2010-03-29 17:23 Kyung-Goo Doh Chapter 3. Web Application Technologies reference: HTTP: The Definitive Guide by David Gourley and Brian Totty (O Reilly, 2002) 1. The HTTP Protocol. HTTP = HyperText
Chapter 27 Hypertext Transfer Protocol
Chapter 27 Hypertext Transfer Protocol Columbus, OH 43210 [email protected] http://www.cis.ohio-state.edu/~jain/ 27-1 Overview Hypertext language and protocol HTTP messages Browser architecture CGI
Introduction to Web Technologies
Introduction to Web Technologies Tara Murphy 17th February, 2011 The Internet CGI Web services HTML and CSS 2 The Internet is a network of networks ˆ The Internet is the descendant of ARPANET (Advanced
10CS73:Web Programming
10CS73:Web Programming Question Bank Fundamentals of Web: 1.What is WWW? 2. What are domain names? Explain domain name conversion with diagram 3.What are the difference between web browser and web server
Cookies Overview and HTTP Proxies
Cookies Overview and HTTP Proxies What is a Cookie? Small piece of data generated by a web server, stored on the client s hard drive. Serves as an add-on to the HTTP specification (remember, HTTP by itself
600-152 People Data and the Web Forms and CGI CGI. Facilitating interactive web applications
CGI Facilitating interactive web applications Outline In Informatics 1, worksheet 7 says You will learn more about CGI and forms if you enroll in Informatics 2. Now we make good on that promise. First
CREATING WEB PAGES USING HTML INTRODUCTION
CREATING WEB PAGES USING HTML INTRODUCTION Web Page Creation Using HTML: Introduction 1. Getting Ready What Software is Needed FourSteps to Follow 2. What Will Be On a Page Technical, Content, & Visual
Specify the location of an HTML control stored in the application repository. See Using the XPath search method, page 2.
Testing Dynamic Web Applications How To You can use XML Path Language (XPath) queries and URL format rules to test web sites or applications that contain dynamic content that changes on a regular basis.
Forms, CGI Objectives. HTML forms. Form example. Form example...
The basics of HTML forms How form content is submitted GET, POST Elements that you can have in forms Responding to forms Common Gateway Interface (CGI) Later: Servlets Generation of dynamic Web content
Designing and Implementing Forms 34
C H A P T E R 34 Designing and Implementing Forms 34 You can add forms to your site to collect information from site visitors; for example, to survey potential customers, conduct credit-card transactions,
11.1 Web Server Operation
11.1 Web Server Operation - Client-server systems - When two computers are connected, either could be the client - The client initiates the communication, which the server accepts - Generally, clients
Efficiency of Web Based SAX XML Distributed Processing
Efficiency of Web Based SAX XML Distributed Processing R. Eggen Computer and Information Sciences Department University of North Florida Jacksonville, FL, USA A. Basic Computer and Information Sciences
HTML Tables. IT 3203 Introduction to Web Development
IT 3203 Introduction to Web Development Tables and Forms September 3 HTML Tables Tables are your friend: Data in rows and columns Positioning of information (But you should use style sheets for this) Slicing
CONTENT of this CHAPTER
CONTENT of this CHAPTER v DNS v HTTP and WWW v EMAIL v SNMP 3.2.1 WWW and HTTP: Basic Concepts With a browser you can request for remote resource (e.g. an HTML file) Web server replies to queries (e.g.
JAVASCRIPT AND COOKIES
JAVASCRIPT AND COOKIES http://www.tutorialspoint.com/javascript/javascript_cookies.htm Copyright tutorialspoint.com What are Cookies? Web Browsers and Servers use HTTP protocol to communicate and HTTP
Internet Technologies. World Wide Web (WWW) Proxy Server Network Address Translator (NAT)
Internet Technologies World Wide Web (WWW) Proxy Server Network Address Translator (NAT) What is WWW? System of interlinked Hypertext documents Text, Images, Videos, and other multimedia documents navigate
XHTML Forms. Form syntax. Selection widgets. Submission method. Submission action. Radio buttons
XHTML Forms Web forms, much like the analogous paper forms, allow the user to provide input. This input is typically sent to a server for processing. Forms can be used to submit data (e.g., placing an
JISIS and Web Technologies
27 November 2012 Status: Draft Author: Jean-Claude Dauphin JISIS and Web Technologies I. Introduction This document does aspire to explain how J-ISIS is related to Web technologies and how to use J-ISIS
Computer Networks. Lecture 7: Application layer: FTP and HTTP. Marcin Bieńkowski. Institute of Computer Science University of Wrocław
Computer Networks Lecture 7: Application layer: FTP and Marcin Bieńkowski Institute of Computer Science University of Wrocław Computer networks (II UWr) Lecture 7 1 / 23 Reminder: Internet reference model
TCP/IP Networking, Part 2: Web-Based Control
TCP/IP Networking, Part 2: Web-Based Control Microchip TCP/IP Stack HTTP2 Module 2007 Microchip Technology Incorporated. All Rights Reserved. Building Embedded Web Applications Slide 1 Welcome to the next
Internet Technologies_1. Doc. Ing. František Huňka, CSc.
1 Internet Technologies_1 Doc. Ing. František Huňka, CSc. Outline of the Course 2 Internet and www history. Markup languages. Software tools. HTTP protocol. Basic architecture of the web systems. XHTML
Introduction to Web Development
Introduction to Web Development Week 2 - HTML, CSS and PHP Dr. Paul Talaga 487 Rhodes [email protected] ACM Lecture Series University of Cincinnati, OH October 16, 2012 1 / 1 HTML Syntax For Example:
Real SQL Programming 1
Real 1 We have seen only how SQL is used at the generic query interface an environment where we sit at a terminal and ask queries of a database. Reality is almost always different: conventional programs
Outline Definition of Webserver HTTP Static is no fun Software SSL. Webserver. in a nutshell. Sebastian Hollizeck. June, the 4 th 2013
Definition of in a nutshell June, the 4 th 2013 Definition of Definition of Just another definition So what is it now? Example CGI php comparison log-file Definition of a formal definition Aisaprogramthat,usingthe
Application layer Web 2.0
Information Network I Application layer Web 2.0 Youki Kadobayashi NAIST They re revolving around the web, after all Name any Internet-related buzz: Cloud computing Smartphone Social media... You ll end
Adding web interfaces to complex scientific computer models brings the following benefits:
Fortran Applications and the Web Adding web interfaces to complex scientific computer models brings the following benefits: access, for anyone in the world with an internet connection; easy-to-use interfaces
http://alice.teaparty.wonderland.com:23054/dormouse/bio.htm
Client/Server paradigm As we know, the World Wide Web is accessed thru the use of a Web Browser, more technically known as a Web Client. 1 A Web Client makes requests of a Web Server 2, which is software
Web Programming. Robert M. Dondero, Ph.D. Princeton University
Web Programming Robert M. Dondero, Ph.D. Princeton University 1 Objectives You will learn: The fundamentals of web programming... The hypertext markup language (HTML) Uniform resource locators (URLs) The
Module 6 Web Page Concept and Design: Getting a Web Page Up and Running
Module 6 Web Page Concept and Design: Getting a Web Page Up and Running Lesson 3 Creating Web Pages Using HTML UNESCO EIPICT M6. LESSON 3 1 Rationale Librarians need to learn how to plan, design and create
What is HTML? a)hyper Text Marking Language b) Hyper Text Machine Language c)hyper Text Middle Language d)hyper Text Markup Language
ONE MARKS QUESTIONS What is HTML? a)hyper Text Marking Language b) Hyper Text Machine Language c)hyper Text Middle Language d)hyper Text Markup Language 1. In email address character is essential a) _
Chapter 2 Web Application Basics
Chapter 2 Web Application Basics Web applications evolved from Web sites or Web systems. The first Web sites, created by Tim Berners-Lee while at CERN (the European Laboratory for Particle Physics), formed
Creating a Guest Book Using WebObjects Builder
Creating a Guest Book Using WebObjects Builder Creating a Guest Book Using WebObjects BuilderLaunch WebObjects Builder WebObjects Builder is an application that helps you create WebObjects applications.
World Wide Web. Before WWW
World Wide Web [email protected] Before WWW Major search tools: Gopher and Archie Archie Search FTP archives indexes Filename based queries Gopher Friendly interface Menu driven queries João Neves 2
Contents. Downloading the Data Files... 2. Centering Page Elements... 6
Creating a Web Page Using HTML Part 1: Creating the Basic Structure of the Web Site INFORMATION TECHNOLOGY SERVICES California State University, Los Angeles Version 2.0 Winter 2010 Contents Introduction...
How To Understand The History Of The Web (Web)
(World Wide) Web WWW A way to connect computers that provide information (servers) with computers that ask for it (clients like you and me) uses the Internet, but it's not the same as the Internet URL
HTML Form Widgets. Review: HTML Forms. Review: CGI Programs
HTML Form Widgets Review: HTML Forms HTML forms are used to create web pages that accept user input Forms allow the user to communicate information back to the web server Forms allow web servers to generate
Lesson Review Answers
Lesson Review Answers-1 Lesson Review Answers Lesson 1 Review 1. User-friendly Web page interfaces, such as a pleasing layout and easy navigation, are considered what type of issues? Front-end issues.
Hypertext for Hyper Techs
Hypertext for Hyper Techs An Introduction to HTTP for SecPros Bio Josh Little, GSEC ~14 years in IT. Support, Server/Storage Admin, Webmaster, Web App Dev, Networking, VoIP, Projects, Security. Currently
Web Authoring CSS. www.fetac.ie. Module Descriptor
The Further Education and Training Awards Council (FETAC) was set up as a statutory body on 11 June 2001 by the Minister for Education and Science. Under the Qualifications (Education & Training) Act,
Course: CSC 224 Internet Technology I (2 credits Compulsory)
Course: CSC 224 Internet Technology I (2 credits Compulsory) Course Duration: Two hours per week for 15weeks, ((15 hours) Theory and (45 hours) Practical), as taught in 2010/2011 session Lecturer: Abikoye,
CGI An Example. CGI Model (Pieces)
CGI An Example go to http://127.0.0.1/cgi-bin/hello.pl This causes the execution of the perl script hello.pl Note: Although our examples use Perl, CGI scripts can be written in any language Perl, C, C++,
Working With Virtual Hosts on Pramati Server
Working With Virtual Hosts on Pramati Server 13 Overview Virtual hosting allows a single machine to be addressed by different names. There are two ways for configuring Virtual Hosts. They are: Domain Name
Short notes on webpage programming languages
Short notes on webpage programming languages What is HTML? HTML is a language for describing web pages. HTML stands for Hyper Text Markup Language HTML is a markup language A markup language is a set of
We automatically generate the HTML for this as seen below. Provide the above components for the teaser.txt file.
Creative Specs Gmail Sponsored Promotions Overview The GSP creative asset will be a ZIP folder, containing four components: 1. Teaser text file 2. Teaser logo image 3. HTML file with the fully expanded
Web Server for Embedded Systems
Web Server for Embedded Systems Klaus-D. Walter After the everybody-in-the-internet-wave now obviously follows the everything-in-the- Internet-wave. The most coffee, vending and washing machines are still
The Web Web page Links 16-3
Chapter Goals Compare and contrast the Internet and the World Wide Web Describe general Web processing Write basic HTML documents Describe several specific HTML tags and their purposes 16-1 Chapter Goals
Course Information Course Number: IWT 1229 Course Name: Web Development and Design Foundation
Course Information Course Number: IWT 1229 Course Name: Web Development and Design Foundation Credit-By-Assessment (CBA) Competency List Written Assessment Competency List Introduction to the Internet
APACHE WEB SERVER. Andri Mirzal, PhD N28-439-03
APACHE WEB SERVER Andri Mirzal, PhD N28-439-03 Introduction The Apache is an open source web server software program notable for playing a key role in the initial growth of the World Wide Web Typically
Protocolo HTTP. Web and HTTP. HTTP overview. HTTP overview
Web and HTTP Protocolo HTTP Web page consists of objects Object can be HTML file, JPEG image, Java applet, audio file, Web page consists of base HTML-file which includes several referenced objects Each
Further web design: HTML forms
Further web design: HTML forms Practical workbook Aims and Learning Objectives The aim of this document is to introduce HTML forms. By the end of this course you will be able to: use existing forms on
CGI.pm Tutorial. Table of content. What is CGI? First Program
CGI.pm Tutorial This is a tutorial on CGI.pm which include scripts to let you see the effects. CGI.pm is a Perl module to facilitate the writing of CGI scripts. Click here to see the details. This tutorial
Introduction to XHTML. 2010, Robert K. Moniot 1
Chapter 4 Introduction to XHTML 2010, Robert K. Moniot 1 OBJECTIVES In this chapter, you will learn: Characteristics of XHTML vs. older HTML. How to write XHTML to create web pages: Controlling document
If your organization is not already
Before you build your Web site, you need a solid design. Eden Watt At a Glance When you develop your first e-commerce site, you will discover that there are a few new things to learn about application
FF/EDM Intro Industry Goals/ Purpose Related GISB Standards (Common Codes, IETF) Definitions d 4 d 13 Principles p 6 p 13 p 14 Standards s 16 s 25
FF/EDM Intro Industry Goals/ Purpose GISB defined two ways in which flat files could be used to send transactions and transaction responses: interactive and batch. This section covers implementation considerations
Web Development with Perl. Paul Fenwick Jacinta Richardson Kirrily Robert
Web Development with Perl Paul Fenwick Jacinta Richardson Kirrily Robert Web Development with Perl by Paul Fenwick, Jacinta Richardson, and Kirrily Robert Copyright 1999-2000 Netizen Pty Ltd Copyright
Web. Services. Web Technologies. Today. Web. Technologies. Internet WWW. Protocols TCP/IP HTTP. Apache. Next Time. Lecture #3 2008 3 Apache.
JSP, and JSP, and JSP, and 1 2 Lecture #3 2008 3 JSP, and JSP, and Markup & presentation (HTML, XHTML, CSS etc) Data storage & access (JDBC, XML etc) Network & application protocols (, etc) Programming
Fig (1) (a) Server-side scripting with PHP. (b) Client-side scripting with JavaScript.
Client-Side Dynamic Web Page Generation CGI, PHP, JSP, and ASP scripts solve the problem of handling forms and interactions with databases on the server. They can all accept incoming information from forms,
Network Technologies
Network Technologies Glenn Strong Department of Computer Science School of Computer Science and Statistics Trinity College, Dublin January 28, 2014 What Happens When Browser Contacts Server I Top view:
CSCI110: Examination information.
CSCI110: Examination information. The exam for CSCI110 will consist of short answer questions. Most of them will require a couple of sentences of explanation of a concept covered in lectures or practical
The Web: some jargon. User agent for Web is called a browser: Web page: Most Web pages consist of: Server for Web is called Web server:
The Web: some jargon Web page: consists of objects addressed by a URL Most Web pages consist of: base HTML page, and several referenced objects. URL has two components: host name and path name: User agent
Carlos Muñoz Application Security Engineer WhiteHat Security @RTWaysea
Carlos Muñoz Application Security Engineer WhiteHat Security @RTWaysea Bypass: History Explanation: What Is Going On Process: Things To Look For Demos: alert(1) Done Live (hopefully) CSP: Content Security
Dynamic Content. Dynamic Web Content: HTML Forms CGI Web Servers and HTTP
Dynamic Web Content: HTML Forms CGI Web Servers and HTTP Duncan Temple Lang Dept. of Statistics UC Davis Dynamic Content We are all used to fetching pages from a Web server. Most are prepared by a human
1 Introduction: Network Applications
1 Introduction: Network Applications Some Network Apps E-mail Web Instant messaging Remote login P2P file sharing Multi-user network games Streaming stored video clips Internet telephone Real-time video
By Glenn Fleishman. WebSpy. Form and function
Form and function The simplest and really the only method to get information from a visitor to a Web site is via an HTML form. Form tags appeared early in the HTML spec, and closely mirror or exactly duplicate
HOW TO CREATE AN HTML5 JEOPARDY- STYLE GAME IN CAPTIVATE
HOW TO CREATE AN HTML5 JEOPARDY- STYLE GAME IN CAPTIVATE This document describes the steps required to create an HTML5 Jeopardy- style game using an Adobe Captivate 7 template. The document is split into
Web Analytics Understand your web visitors without web logs or page tags and keep all your data inside your firewall.
Web Analytics Understand your web visitors without web logs or page tags and keep all your data inside your firewall. 5401 Butler Street, Suite 200 Pittsburgh, PA 15201 +1 (412) 408 3167 www.metronomelabs.com
?<BACBC;@@A=2(?@?;@=2:;:%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
NGS data format NGS data format @SRR031028.1708655 GGATGATGGATGGATAGATAGATGAAGAGATGGATGGATGGGTGGGTGGTATGCAGCATACCTGAAGTGC BBBCB=ABBB@BA=?BABBBBA??B@BAAA>ABB;@5=@@@?8@:==99:465727:;41'.9>;933!4 @SRR031028.843803
understand how image maps can enhance a design and make a site more interactive know how to create an image map easily with Dreamweaver
LESSON 3: ADDING IMAGE MAPS, ANIMATION, AND FORMS CREATING AN IMAGE MAP OBJECTIVES By the end of this part of the lesson you will: understand how image maps can enhance a design and make a site more interactive
<?xml version= 1.0?> <!DOCTYPE html PUBLIC -//W3C//DTD XHTML 1.0 Transitional//EN http://www.w3.org/tr/xhtml1/dtd/xhtml1-transitional.
dhtml
HTTP. Internet Engineering. Fall 2015. Bahador Bakhshi CE & IT Department, Amirkabir University of Technology
HTTP Internet Engineering Fall 2015 Bahador Bakhshi CE & IT Department, Amirkabir University of Technology Questions Q1) How do web server and client browser talk to each other? Q1.1) What is the common
Fachgebiet Technische Informatik, Joachim Zumbrägel
Computer Network Lab 2015 Fachgebiet Technische Informatik, Joachim Zumbrägel Overview Internet Internet Protocols Fundamentals about HTTP Communication HTTP-Server, mode of operation Static/Dynamic Webpages
Introduction to LAN/WAN. Application Layer (Part II)
Introduction to LAN/WAN Application Layer (Part II) Application Layer Topics Domain Name System (DNS) (7.1) Electronic Mail (Email) (7.2) World Wide Web (WWW) (7.3) Electronic Mail (Email) Mostly used
PHP and XML. Brian J. Stafford, Mark McIntyre and Fraser Gallop
What is PHP? PHP and XML Brian J. Stafford, Mark McIntyre and Fraser Gallop PHP is a server-side tool for creating dynamic web pages. PHP pages consist of both HTML and program logic. One of the advantages
ICT 6012: Web Programming
ICT 6012: Web Programming Covers HTML, PHP Programming and JavaScript Covers in 13 lectures a lecture plan is supplied. Please note that there are some extra classes and some cancelled classes Mid-Term
Getting Started with KompoZer
Getting Started with KompoZer Contents Web Publishing with KompoZer... 1 Objectives... 1 UNIX computer account... 1 Resources for learning more about WWW and HTML... 1 Introduction... 2 Publishing files
URLs and HTTP. ICW Lecture 10 Tom Chothia
URLs and HTTP ICW Lecture 10 Tom Chothia This Lecture The two basic building blocks of the web: URLs: Uniform Resource Locators HTTP: HyperText Transfer Protocol Uniform Resource Locators Many Internet
Web Traffic Capture. 5401 Butler Street, Suite 200 Pittsburgh, PA 15201 +1 (412) 408 3167 www.metronomelabs.com
Web Traffic Capture Capture your web traffic, filtered and transformed, ready for your applications without web logs or page tags and keep all your data inside your firewall. 5401 Butler Street, Suite
Oracle Forms Services Secure Web.Show_Document() calls to Oracle Reports Server 6i
Oracle Forms Services Secure Web.Show_Document() calls to Oracle Reports Server 6i $Q2UDFOH7HFKQLFDO:KLWHSDSHU 0DUFK Secure Web.Show_Document() calls to Oracle Reports Server 6i Introduction...3 solution
The Web History (I) The Web History (II)
Goals of Today s Lecture EE 122: The World Wide Web Ion Stoica TAs: Junda Liu, DK Moon, David Zats http://inst.eecs.berkeley.edu/~ee122/ (Materials with thanks to Vern Paxson, Jennifer Rexford, and colleagues
Tutorial 6 Creating a Web Form. HTML and CSS 6 TH EDITION
Tutorial 6 Creating a Web Form HTML and CSS 6 TH EDITION Objectives Explore how Web forms interact with Web servers Create form elements Create field sets and legends Create input boxes and form labels
CREATING WEB FORMS WEB and FORMS FRAMES AND
CREATING CREATING WEB FORMS WEB and FORMS FRAMES AND FRAMES USING Using HTML HTML Creating Web Forms and Frames 1. What is a Web Form 2. What is a CGI Script File 3. Initiating the HTML File 4. Composing
Introduction to ServerIron ADX Application Switching and Load Balancing. Module 6: Content Switching (CSW) Revision 0310
Introduction to ServerIron ADX Application Switching and Load Balancing Module 6: Content Switching (CSW) Revision 0310 Objectives Upon completion of this module the student will be able to: Define layer
Hack Yourself First. Troy Hunt @troyhunt troyhunt.com [email protected]
Hack Yourself First Troy Hunt @troyhunt troyhunt.com [email protected] We re gonna turn you into lean, mean hacking machines! Because if we don t, these kids are going to hack you Jake Davies, 19 (and
StARScope: A Web-based SAS Prototype for Clinical Data Visualization
Paper 42-28 StARScope: A Web-based SAS Prototype for Clinical Data Visualization Fang Dong, Pfizer Global Research and Development, Ann Arbor Laboratories Subra Pilli, Pfizer Global Research and Development,
Security Test s i t ng Eileen Donlon CMSC 737 Spring 2008
Security Testing Eileen Donlon CMSC 737 Spring 2008 Testing for Security Functional tests Testing that role based security functions correctly Vulnerability scanning and penetration tests Testing whether
