15-381: Artificial Intelligence. Probabilistic Reasoning and Inference

Size: px
Start display at page:

Download "15-381: Artificial Intelligence. Probabilistic Reasoning and Inference"

Transcription

1 5-38: Artificial Intelligence robabilistic Reasoning and Inference

2 Advantages of probabilistic reasoning Appropriate for complex, uncertain, environments - Will it rain tomorrow? Applies naturally to many domains - Robot predicting the direction of road, biology, Word paper clip Allows to generalize acquired knowledge and incorporate prior belief - Medical diagnosis Easy to integrate different information sources - Robot s sensors

3 Unmanned vehicles Examples

4 Examples: Speech processing

5 Example: Biological data ATGAAGCTACTGTCTTCTATCGAACAAGCATGCG ATATTTGCCGACTTAAAAAGCTCAAG TGCTCCAAAGAAAAACCGAAGTGCGCCAAGTGT CTGAAGAACAACTGGGAGTGTCGCTAC TCTCCCAAAACCAAAAGGTCTCCGCTGACTAGG GCACATCTGACAGAAGTGGAATCAAGG CTAGAAAGACTGGAACAGCTATTTCTACTGATTT TTCCTCGAGAAGACCTTGACATGATT

6 Basic notations Random variable - referring to an element / event whose status is unknown: A it will rain tomorrow Domain usually denoted by Ω - The set of values a random variable can take: - A The stock market will go up this year : Binary - A Number of Steelers wins in 007 : Discrete - A % change in Google stock in 007 : Continuous

7 Axioms of probability Kolmogorov s axioms A variety of useful facts can be derived from just three axioms:. 0 A. true, false 0 3. A B A + B A B

8 Axioms of probability Kolmogorov s axioms A variety of useful facts can be derived from just three axioms:. 0 A. true, false 0 3. A B A + B A B Steelers win the season

9 Axioms of probability Kolmogorov s axioms A variety of useful facts can be derived from just three axioms:. 0 A. true, false 0 3. A B A + B A B

10 Axioms of probability Kolmogorov s axioms A variety of useful facts can be derived from just three axioms:. 0 A. true, false 0 3. A B A + B A B

11 Axioms of probability Kolmogorov s axioms A variety of useful facts can be derived from just three axioms:. 0 A. true, false 0 3. A B A + B A B There have been several other attempts to provide a foundation for probability theory. Kolmogorov s axioms are the most widely used.

12 Example of using the axioms Assume a probability for dice as follows: ? {heads,tails}? heads+-tails?

13 Using the axioms How can we use the axioms to prove that: A A?

14 riors Degree of belief in an event in the absence of any other information No rain Rain rain tomorrow 0. no rain tomorrow 0.8

15 Conditional probablity What is the probability of an event given knowledge of another event Example: - raining sunny - raining cloudy - raining cloudy, cold

16 Conditional probability A B : The fraction of cases where A is true if B is true A 0. A B 0.5

17 Conditional probability In some cases, given knowledge of one or more random variables we can improve upon our prior belief of another random variable For example: pslept in movie 0.5 pslept in movie liked movie /3 pdidn t sleep in movie liked movie /3 Liked movie 0 0 Slept

18 Joint distributions The probability that a set of random variables will take a specific value is their joint distribution. Notation: A B or A,B Example: liked movie, slept Liked movie 0 0 Slept

19 Joint distribution cont class size > summer /3 class size > 0, summer? Time regular, summer Evaluation of classes Class size Evaluation

20 Joint distribution cont class size > summer /3 class size > 0, summer 0 Time regular, summer Evaluation of classes Class size Evaluation

21 Joint distribution cont class size > eval /9 class size > 0, eval /9 Evaluation of classes Time regular, summer Class size Evaluation

22 Chain rule The joint distribution can be specified in terms of conditional probability: A,B A B*B Together with Bayes rule which is actually derived from it this is one of the most powerful rules in probabilistic reasoning

23 Bayes rule One of the most important rules for AI usage. Derived from the chain rule: A,B A BB B AA Thus, A B B A A B Thomas Bayes was an English clergyman who set out his theory of probability in 764.

24 Bayes rule cont Often it would be useful to derive the rule a bit further:! A A A B A A B B A A B A B This results from: B A B,A A B A B B,A B,A0

25 Using Bayes rule Cards game: lace your bet on the location of the King!

26 Using Bayes rule Cards game: Do you want to change your bet?

27 Using Bayes rule selb k C k C selb selb k C Computing the posterior probability: C k selb A B C C C selb k C k C selb k C k C selb Bayes rule

28 Using Bayes rule A B C Ck selb / /3 selb C selb C k C k C k + selb k C 0 C 0 /3 / /3 / /3

29 Important points Random variables Chain rule Bayes rule Joint distribution, independence, conditional independence

30 Joint distributions The probability that a set of random variables will take a specific value is their joint distribution. Requires a joint probability table to specify the possible assignments The table can grow very rapidly Liked movie 0 0 Slept How can we decrease the number of columns in the table?

10-601. Machine Learning. http://www.cs.cmu.edu/afs/cs/academic/class/10601-f10/index.html

10-601. Machine Learning. http://www.cs.cmu.edu/afs/cs/academic/class/10601-f10/index.html 10-601 Machine Learning http://www.cs.cmu.edu/afs/cs/academic/class/10601-f10/index.html Course data All up-to-date info is on the course web page: http://www.cs.cmu.edu/afs/cs/academic/class/10601-f10/index.html

More information

Comparing & Contrasting. - mathematically. Ways of comparing mathematical and scientific quantities...

Comparing & Contrasting. - mathematically. Ways of comparing mathematical and scientific quantities... Comparing & Contrasting - mathematically Ways of comparing mathematical and scientific quantities... Comparison by Division: using RATIOS, PERCENTAGES, ODDS, and PROPORTIONS Definition of Probability:

More information

STA 371G: Statistics and Modeling

STA 371G: Statistics and Modeling STA 371G: Statistics and Modeling Decision Making Under Uncertainty: Probability, Betting Odds and Bayes Theorem Mingyuan Zhou McCombs School of Business The University of Texas at Austin http://mingyuanzhou.github.io/sta371g

More information

Knowledge-based systems and the need for learning

Knowledge-based systems and the need for learning Knowledge-based systems and the need for learning The implementation of a knowledge-based system can be quite difficult. Furthermore, the process of reasoning with that knowledge can be quite slow. This

More information

I Have...Who Has... Multiplication Game

I Have...Who Has... Multiplication Game How to play the game: Distribute the cards randomly to your students. Some students may get more than one card. Select a student to begin by reading their card aloud. (example: 35. who has 4x4?) 35 4 x

More information

Elementary Statistics and Inference. Elementary Statistics and Inference. 16 The Law of Averages (cont.) 22S:025 or 7P:025.

Elementary Statistics and Inference. Elementary Statistics and Inference. 16 The Law of Averages (cont.) 22S:025 or 7P:025. Elementary Statistics and Inference 22S:025 or 7P:025 Lecture 20 1 Elementary Statistics and Inference 22S:025 or 7P:025 Chapter 16 (cont.) 2 D. Making a Box Model Key Questions regarding box What numbers

More information

Part III: Machine Learning. CS 188: Artificial Intelligence. Machine Learning This Set of Slides. Parameter Estimation. Estimation: Smoothing

Part III: Machine Learning. CS 188: Artificial Intelligence. Machine Learning This Set of Slides. Parameter Estimation. Estimation: Smoothing CS 188: Artificial Intelligence Lecture 20: Dynamic Bayes Nets, Naïve Bayes Pieter Abbeel UC Berkeley Slides adapted from Dan Klein. Part III: Machine Learning Up until now: how to reason in a model and

More information

Statistics in Geophysics: Introduction and Probability Theory

Statistics in Geophysics: Introduction and Probability Theory Statistics in Geophysics: Introduction and Steffen Unkel Department of Statistics Ludwig-Maximilians-University Munich, Germany Winter Term 2013/14 1/32 What is Statistics? Introduction Statistics is the

More information

Introduction to Probability

Introduction to Probability Introduction to Probability EE 179, Lecture 15, Handout #24 Probability theory gives a mathematical characterization for experiments with random outcomes. coin toss life of lightbulb binary data sequence

More information

Bayesian spam filtering

Bayesian spam filtering Bayesian spam filtering Keith Briggs [email protected] more.btexact.com/people/briggsk2 Pervasive ICT seminar 2004 Apr 29 1500 bayes-2004apr29.tex typeset 2004 May 6 10:48 in pdflatex on a linux system

More information

A Probabilistic Causal Model for Diagnosis of Liver Disorders

A Probabilistic Causal Model for Diagnosis of Liver Disorders Intelligent Information Systems VII Proceedings of the Workshop held in Malbork, Poland, June 15-19, 1998 A Probabilistic Causal Model for Diagnosis of Liver Disorders Agnieszka Oniśko 1, Marek J. Druzdzel

More information

MAT 155. Key Concept. February 03, 2011. 155S4.1 2_3 Review & Preview; Basic Concepts of Probability. Review. Chapter 4 Probability

MAT 155. Key Concept. February 03, 2011. 155S4.1 2_3 Review & Preview; Basic Concepts of Probability. Review. Chapter 4 Probability MAT 155 Dr. Claude Moore Cape Fear Community College Chapter 4 Probability 4 1 Review and Preview 4 2 Basic Concepts of Probability 4 3 Addition Rule 4 4 Multiplication Rule: Basics 4 7 Counting To find

More information

Graduate Co-op Students Information Manual. Department of Computer Science. Faculty of Science. University of Regina

Graduate Co-op Students Information Manual. Department of Computer Science. Faculty of Science. University of Regina Graduate Co-op Students Information Manual Department of Computer Science Faculty of Science University of Regina 2014 1 Table of Contents 1. Department Description..3 2. Program Requirements and Procedures

More information

A Tutorial on Probability Theory

A Tutorial on Probability Theory Paola Sebastiani Department of Mathematics and Statistics University of Massachusetts at Amherst Corresponding Author: Paola Sebastiani. Department of Mathematics and Statistics, University of Massachusetts,

More information

Probability and statistics; Rehearsal for pattern recognition

Probability and statistics; Rehearsal for pattern recognition Probability and statistics; Rehearsal for pattern recognition Václav Hlaváč Czech Technical University in Prague Faculty of Electrical Engineering, Department of Cybernetics Center for Machine Perception

More information

Betting interpretations of probability

Betting interpretations of probability Betting interpretations of probability Glenn Shafer June 21, 2010 Third Workshop on Game-Theoretic Probability and Related Topics Royal Holloway, University of London 1 Outline 1. Probability began with

More information

1 What is Machine Learning?

1 What is Machine Learning? COS 511: Theoretical Machine Learning Lecturer: Rob Schapire Lecture #1 Scribe: Rob Schapire February 4, 2008 1 What is Machine Learning? Machine learning studies computer algorithms for learning to do

More information

It is remarkable that a science, which began with the consideration of games of chance, should be elevated to the rank of the most important

It is remarkable that a science, which began with the consideration of games of chance, should be elevated to the rank of the most important PROBABILLITY 271 PROBABILITY CHAPTER 15 It is remarkable that a science, which began with the consideration of games of chance, should be elevated to the rank of the most important subject of human knowledge.

More information

A Bayesian Network Model for Diagnosis of Liver Disorders Agnieszka Onisko, M.S., 1,2 Marek J. Druzdzel, Ph.D., 1 and Hanna Wasyluk, M.D.,Ph.D.

A Bayesian Network Model for Diagnosis of Liver Disorders Agnieszka Onisko, M.S., 1,2 Marek J. Druzdzel, Ph.D., 1 and Hanna Wasyluk, M.D.,Ph.D. Research Report CBMI-99-27, Center for Biomedical Informatics, University of Pittsburgh, September 1999 A Bayesian Network Model for Diagnosis of Liver Disorders Agnieszka Onisko, M.S., 1,2 Marek J. Druzdzel,

More information

Stat 20: Intro to Probability and Statistics

Stat 20: Intro to Probability and Statistics Stat 20: Intro to Probability and Statistics Lecture 16: More Box Models Tessa L. Childers-Day UC Berkeley 22 July 2014 By the end of this lecture... You will be able to: Determine what we expect the sum

More information

The Basics of Graphical Models

The Basics of Graphical Models The Basics of Graphical Models David M. Blei Columbia University October 3, 2015 Introduction These notes follow Chapter 2 of An Introduction to Probabilistic Graphical Models by Michael Jordan. Many figures

More information

GfK 2016 Tech Trends 2016

GfK 2016 Tech Trends 2016 1 Contents 1 2 3 Evolving behavior today s connected consumers Driving you forward 10 tech trends for 2016 Growth from knowledge turning research into smart business decisions 2 Evolving behavior today

More information

COMP 590: Artificial Intelligence

COMP 590: Artificial Intelligence COMP 590: Artificial Intelligence Today Course overview What is AI? Examples of AI today Who is this course for? An introductory survey of AI techniques for students who have not previously had an exposure

More information

36 Odds, Expected Value, and Conditional Probability

36 Odds, Expected Value, and Conditional Probability 36 Odds, Expected Value, and Conditional Probability What s the difference between probabilities and odds? To answer this question, let s consider a game that involves rolling a die. If one gets the face

More information

Machine Learning and Data Mining. Fundamentals, robotics, recognition

Machine Learning and Data Mining. Fundamentals, robotics, recognition Machine Learning and Data Mining Fundamentals, robotics, recognition Machine Learning, Data Mining, Knowledge Discovery in Data Bases Their mutual relations Data Mining, Knowledge Discovery in Databases,

More information

Bayesian Tutorial (Sheet Updated 20 March)

Bayesian Tutorial (Sheet Updated 20 March) Bayesian Tutorial (Sheet Updated 20 March) Practice Questions (for discussing in Class) Week starting 21 March 2016 1. What is the probability that the total of two dice will be greater than 8, given that

More information

Solution (Done in class)

Solution (Done in class) MATH 115 CHAPTER 4 HOMEWORK Sections 4.1-4.2 N. PSOMAS 4.6 Winning at craps. The game of craps starts with a come-out roll where the shooter rolls a pair of dice. If the total is 7 or 11, the shooter wins

More information

Public Key Cryptography. c Eli Biham - March 30, 2011 258 Public Key Cryptography

Public Key Cryptography. c Eli Biham - March 30, 2011 258 Public Key Cryptography Public Key Cryptography c Eli Biham - March 30, 2011 258 Public Key Cryptography Key Exchange All the ciphers mentioned previously require keys known a-priori to all the users, before they can encrypt

More information

E3: PROBABILITY AND STATISTICS lecture notes

E3: PROBABILITY AND STATISTICS lecture notes E3: PROBABILITY AND STATISTICS lecture notes 2 Contents 1 PROBABILITY THEORY 7 1.1 Experiments and random events............................ 7 1.2 Certain event. Impossible event............................

More information

Week 2: Conditional Probability and Bayes formula

Week 2: Conditional Probability and Bayes formula Week 2: Conditional Probability and Bayes formula We ask the following question: suppose we know that a certain event B has occurred. How does this impact the probability of some other A. This question

More information

CS91.543 MidTerm Exam 4/1/2004 Name: KEY. Page Max Score 1 18 2 11 3 30 4 15 5 45 6 20 Total 139

CS91.543 MidTerm Exam 4/1/2004 Name: KEY. Page Max Score 1 18 2 11 3 30 4 15 5 45 6 20 Total 139 CS91.543 MidTerm Exam 4/1/2004 Name: KEY Page Max Score 1 18 2 11 3 30 4 15 5 45 6 20 Total 139 % INTRODUCTION, AI HISTORY AND AGENTS 1. [4 pts. ea.] Briefly describe the following important AI programs.

More information

Chapter ML:IV. IV. Statistical Learning. Probability Basics Bayes Classification Maximum a-posteriori Hypotheses

Chapter ML:IV. IV. Statistical Learning. Probability Basics Bayes Classification Maximum a-posteriori Hypotheses Chapter ML:IV IV. Statistical Learning Probability Basics Bayes Classification Maximum a-posteriori Hypotheses ML:IV-1 Statistical Learning STEIN 2005-2015 Area Overview Mathematics Statistics...... Stochastics

More information

Learning is a very general term denoting the way in which agents:

Learning is a very general term denoting the way in which agents: What is learning? Learning is a very general term denoting the way in which agents: Acquire and organize knowledge (by building, modifying and organizing internal representations of some external reality);

More information

Artificial Intelligence and Robotics @ Politecnico di Milano. Presented by Matteo Matteucci

Artificial Intelligence and Robotics @ Politecnico di Milano. Presented by Matteo Matteucci 1 Artificial Intelligence and Robotics @ Politecnico di Milano Presented by Matteo Matteucci What is Artificial Intelligence «The field of theory & development of computer systems able to perform tasks

More information

Bayesian Analysis for the Social Sciences

Bayesian Analysis for the Social Sciences Bayesian Analysis for the Social Sciences Simon Jackman Stanford University http://jackman.stanford.edu/bass November 9, 2012 Simon Jackman (Stanford) Bayesian Analysis for the Social Sciences November

More information

The result of the bayesian analysis is the probability distribution of every possible hypothesis H, given one real data set D. This prestatistical approach to our problem was the standard approach of Laplace

More information

Bayesian Networks. Read R&N Ch. 14.1-14.2. Next lecture: Read R&N 18.1-18.4

Bayesian Networks. Read R&N Ch. 14.1-14.2. Next lecture: Read R&N 18.1-18.4 Bayesian Networks Read R&N Ch. 14.1-14.2 Next lecture: Read R&N 18.1-18.4 You will be expected to know Basic concepts and vocabulary of Bayesian networks. Nodes represent random variables. Directed arcs

More information

Decision Theory. 36.1 Rational prospecting

Decision Theory. 36.1 Rational prospecting 36 Decision Theory Decision theory is trivial, apart from computational details (just like playing chess!). You have a choice of various actions, a. The world may be in one of many states x; which one

More information

Course Outline Department of Computing Science Faculty of Science. COMP 3710-3 Applied Artificial Intelligence (3,1,0) Fall 2015

Course Outline Department of Computing Science Faculty of Science. COMP 3710-3 Applied Artificial Intelligence (3,1,0) Fall 2015 Course Outline Department of Computing Science Faculty of Science COMP 710 - Applied Artificial Intelligence (,1,0) Fall 2015 Instructor: Office: Phone/Voice Mail: E-Mail: Course Description : Students

More information

Neural Networks for Machine Learning. Lecture 13a The ups and downs of backpropagation

Neural Networks for Machine Learning. Lecture 13a The ups and downs of backpropagation Neural Networks for Machine Learning Lecture 13a The ups and downs of backpropagation Geoffrey Hinton Nitish Srivastava, Kevin Swersky Tijmen Tieleman Abdel-rahman Mohamed A brief history of backpropagation

More information

CHAPTER 2 Estimating Probabilities

CHAPTER 2 Estimating Probabilities CHAPTER 2 Estimating Probabilities Machine Learning Copyright c 2016. Tom M. Mitchell. All rights reserved. *DRAFT OF January 24, 2016* *PLEASE DO NOT DISTRIBUTE WITHOUT AUTHOR S PERMISSION* This is a

More information

Supervised Learning (Big Data Analytics)

Supervised Learning (Big Data Analytics) Supervised Learning (Big Data Analytics) Vibhav Gogate Department of Computer Science The University of Texas at Dallas Practical advice Goal of Big Data Analytics Uncover patterns in Data. Can be used

More information

Basic Probability. Probability: The part of Mathematics devoted to quantify uncertainty

Basic Probability. Probability: The part of Mathematics devoted to quantify uncertainty AMS 5 PROBABILITY Basic Probability Probability: The part of Mathematics devoted to quantify uncertainty Frequency Theory Bayesian Theory Game: Playing Backgammon. The chance of getting (6,6) is 1/36.

More information

STOCHASTIC MODELING. Math3425 Spring 2012, HKUST. Kani Chen (Instructor)

STOCHASTIC MODELING. Math3425 Spring 2012, HKUST. Kani Chen (Instructor) STOCHASTIC MODELING Math3425 Spring 212, HKUST Kani Chen (Instructor) Chapters 1-2. Review of Probability Concepts Through Examples We review some basic concepts about probability space through examples,

More information

Entropy and Mutual Information

Entropy and Mutual Information ENCYCLOPEDIA OF COGNITIVE SCIENCE 2000 Macmillan Reference Ltd Information Theory information, entropy, communication, coding, bit, learning Ghahramani, Zoubin Zoubin Ghahramani University College London

More information

Circuits and Boolean Expressions

Circuits and Boolean Expressions Circuits and Boolean Expressions Provided by TryEngineering - Lesson Focus Boolean logic is essential to understanding computer architecture. It is also useful in program construction and Artificial Intelligence.

More information

Sample Space and Probability

Sample Space and Probability 1 Sample Space and Probability Contents 1.1. Sets........................... p. 3 1.2. Probabilistic Models.................... p. 6 1.3. Conditional Probability................. p. 18 1.4. Total Probability

More information

3.2 Roulette and Markov Chains

3.2 Roulette and Markov Chains 238 CHAPTER 3. DISCRETE DYNAMICAL SYSTEMS WITH MANY VARIABLES 3.2 Roulette and Markov Chains In this section we will be discussing an application of systems of recursion equations called Markov Chains.

More information

Chapter 20: Data Analysis

Chapter 20: Data Analysis Chapter 20: Data Analysis Database System Concepts, 6 th Ed. See www.db-book.com for conditions on re-use Chapter 20: Data Analysis Decision Support Systems Data Warehousing Data Mining Classification

More information

Betting with the Kelly Criterion

Betting with the Kelly Criterion Betting with the Kelly Criterion Jane June 2, 2010 Contents 1 Introduction 2 2 Kelly Criterion 2 3 The Stock Market 3 4 Simulations 5 5 Conclusion 8 1 Page 2 of 9 1 Introduction Gambling in all forms,

More information

1 Introduction to Option Pricing

1 Introduction to Option Pricing ESTM 60202: Financial Mathematics Alex Himonas 03 Lecture Notes 1 October 7, 2009 1 Introduction to Option Pricing We begin by defining the needed finance terms. Stock is a certificate of ownership of

More information

MAS113 Introduction to Probability and Statistics

MAS113 Introduction to Probability and Statistics MAS113 Introduction to Probability and Statistics 1 Introduction 1.1 Studying probability theory There are (at least) two ways to think about the study of probability theory: 1. Probability theory is a

More information

In the situations that we will encounter, we may generally calculate the probability of an event

In the situations that we will encounter, we may generally calculate the probability of an event What does it mean for something to be random? An event is called random if the process which produces the outcome is sufficiently complicated that we are unable to predict the precise result and are instead

More information

Study Plan for the Master Degree In Industrial Engineering / Management. (Thesis Track)

Study Plan for the Master Degree In Industrial Engineering / Management. (Thesis Track) Study Plan for the Master Degree In Industrial Engineering / Management (Thesis Track) Plan no. 2005 T A. GENERAL RULES AND CONDITIONS: 1. This plan conforms to the valid regulations of programs of graduate

More information

CCNY. BME I5100: Biomedical Signal Processing. Linear Discrimination. Lucas C. Parra Biomedical Engineering Department City College of New York

CCNY. BME I5100: Biomedical Signal Processing. Linear Discrimination. Lucas C. Parra Biomedical Engineering Department City College of New York BME I5100: Biomedical Signal Processing Linear Discrimination Lucas C. Parra Biomedical Engineering Department CCNY 1 Schedule Week 1: Introduction Linear, stationary, normal - the stuff biology is not

More information

Lecture Note 1 Set and Probability Theory. MIT 14.30 Spring 2006 Herman Bennett

Lecture Note 1 Set and Probability Theory. MIT 14.30 Spring 2006 Herman Bennett Lecture Note 1 Set and Probability Theory MIT 14.30 Spring 2006 Herman Bennett 1 Set Theory 1.1 Definitions and Theorems 1. Experiment: any action or process whose outcome is subject to uncertainty. 2.

More information

Problems often have a certain amount of uncertainty, possibly due to: Incompleteness of information about the environment,

Problems often have a certain amount of uncertainty, possibly due to: Incompleteness of information about the environment, Uncertainty Problems often have a certain amount of uncertainty, possibly due to: Incompleteness of information about the environment, E.g., loss of sensory information such as vision Incorrectness in

More information

comp4620/8620: Advanced Topics in AI Foundations of Artificial Intelligence

comp4620/8620: Advanced Topics in AI Foundations of Artificial Intelligence comp4620/8620: Advanced Topics in AI Foundations of Artificial Intelligence Marcus Hutter Australian National University Canberra, ACT, 0200, Australia http://www.hutter1.net/ ANU Foundations of Artificial

More information

Threat Density Map Modeling for Combat Simulations

Threat Density Map Modeling for Combat Simulations Threat Density Map Modeling for Combat Simulations Francisco R. Baez Christian J. Daren Modeling, Virtual Environments, and Simulation (MOVES) Institute Naval Postgraduate School 700 Dyer Road, Watins

More information

Probability, statistics and football Franka Miriam Bru ckler Paris, 2015.

Probability, statistics and football Franka Miriam Bru ckler Paris, 2015. Probability, statistics and football Franka Miriam Bru ckler Paris, 2015 Please read this before starting! Although each activity can be performed by one person only, it is suggested that you work in groups

More information

Chapter 5 A Survey of Probability Concepts

Chapter 5 A Survey of Probability Concepts Chapter 5 A Survey of Probability Concepts True/False 1. Based on a classical approach, the probability of an event is defined as the number of favorable outcomes divided by the total number of possible

More information

(67902) Topics in Theory and Complexity Nov 2, 2006. Lecture 7

(67902) Topics in Theory and Complexity Nov 2, 2006. Lecture 7 (67902) Topics in Theory and Complexity Nov 2, 2006 Lecturer: Irit Dinur Lecture 7 Scribe: Rani Lekach 1 Lecture overview This Lecture consists of two parts In the first part we will refresh the definition

More information

Management Decision Making. Hadi Hosseini CS 330 David R. Cheriton School of Computer Science University of Waterloo July 14, 2011

Management Decision Making. Hadi Hosseini CS 330 David R. Cheriton School of Computer Science University of Waterloo July 14, 2011 Management Decision Making Hadi Hosseini CS 330 David R. Cheriton School of Computer Science University of Waterloo July 14, 2011 Management decision making Decision making Spreadsheet exercise Data visualization,

More information

Discrete Math in Computer Science Homework 7 Solutions (Max Points: 80)

Discrete Math in Computer Science Homework 7 Solutions (Max Points: 80) Discrete Math in Computer Science Homework 7 Solutions (Max Points: 80) CS 30, Winter 2016 by Prasad Jayanti 1. (10 points) Here is the famous Monty Hall Puzzle. Suppose you are on a game show, and you

More information

FINAL EXAM, Econ 171, March, 2015, with answers

FINAL EXAM, Econ 171, March, 2015, with answers FINAL EXAM, Econ 171, March, 2015, with answers There are 9 questions. Answer any 8 of them. Good luck! Problem 1. (True or False) If a player has a dominant strategy in a simultaneous-move game, then

More information

Informatics 2D Reasoning and Agents Semester 2, 2015-16

Informatics 2D Reasoning and Agents Semester 2, 2015-16 Informatics 2D Reasoning and Agents Semester 2, 2015-16 Alex Lascarides [email protected] Lecture 29 Decision Making Under Uncertainty 24th March 2016 Informatics UoE Informatics 2D 1 Where are we? Last

More information

Discrete Mathematics and Probability Theory Fall 2009 Satish Rao, David Tse Note 2

Discrete Mathematics and Probability Theory Fall 2009 Satish Rao, David Tse Note 2 CS 70 Discrete Mathematics and Probability Theory Fall 2009 Satish Rao, David Tse Note 2 Proofs Intuitively, the concept of proof should already be familiar We all like to assert things, and few of us

More information

STATISTICS 230 COURSE NOTES. Chris Springer, revised by Jerry Lawless and Don McLeish

STATISTICS 230 COURSE NOTES. Chris Springer, revised by Jerry Lawless and Don McLeish STATISTICS 230 COURSE NOTES Chris Springer, revised by Jerry Lawless and Don McLeish JANUARY 2006 Contents 1. Introduction to Probability 1 2. Mathematical Probability Models 5 2.1 SampleSpacesandProbability...

More information

HUGIN Expert White Paper

HUGIN Expert White Paper HUGIN Expert White Paper White Paper Company Profile History HUGIN Expert Today HUGIN Expert vision Our Logo - the Raven Bayesian Networks What is a Bayesian network? The theory behind Bayesian networks

More information

ECE302 Spring 2006 HW1 Solutions January 16, 2006 1

ECE302 Spring 2006 HW1 Solutions January 16, 2006 1 ECE302 Spring 2006 HW1 Solutions January 16, 2006 1 Solutions to HW1 Note: These solutions were generated by R. D. Yates and D. J. Goodman, the authors of our textbook. I have added comments in italics

More information

Evaluation of Processor Health within Hierarchical Condition Monitoring System

Evaluation of Processor Health within Hierarchical Condition Monitoring System Evaluation of Processor Health within Hierarchical Condition Monitoring System Lenka Pavelková and Ladislav Jirsa Department of Adaptive Systems, Institute of Information Theory and Automation, Czech Academy

More information

Desktop Publishing. Specialized Application Software. 1 Chapter 4. 2 Introduction

Desktop Publishing. Specialized Application Software. 1 Chapter 4. 2 Introduction 1 Chapter 4 Specialized Application Software 2 Introduction Software that for years was only available for mainframe computers is now available for microcomputers. Specialized application software makes

More information

Bayesian Networks. Mausam (Slides by UW-AI faculty)

Bayesian Networks. Mausam (Slides by UW-AI faculty) Bayesian Networks Mausam (Slides by UW-AI faculty) Bayes Nets In general, joint distribution P over set of variables (X 1 x... x X n ) requires exponential space for representation & inference BNs provide

More information

Boolean Algebra. Boolean Algebra. Boolean Algebra. Boolean Algebra

Boolean Algebra. Boolean Algebra. Boolean Algebra. Boolean Algebra 2 Ver..4 George Boole was an English mathematician of XIX century can operate on logic (or Boolean) variables that can assume just 2 values: /, true/false, on/off, closed/open Usually value is associated

More information

ARTIFICIAL INTELLIGENCE AND EXPERT SYSTEMS: KNOWLEDGE-BASED SYSTEMS

ARTIFICIAL INTELLIGENCE AND EXPERT SYSTEMS: KNOWLEDGE-BASED SYSTEMS ARTIFICIAL INTELLIGENCE AND EXPERT SYSTEMS: KNOWLEDGE-BASED SYSTEMS TEACHING SUGGESTIONS The introduction of artificial intelligence concepts can seem overwhelming to some students. This is an excellent

More information

Invited Applications Paper

Invited Applications Paper Invited Applications Paper - - Thore Graepel Joaquin Quiñonero Candela Thomas Borchert Ralf Herbrich Microsoft Research Ltd., 7 J J Thomson Avenue, Cambridge CB3 0FB, UK [email protected] [email protected]

More information

A Few Basics of Probability

A Few Basics of Probability A Few Basics of Probability Philosophy 57 Spring, 2004 1 Introduction This handout distinguishes between inductive and deductive logic, and then introduces probability, a concept essential to the study

More information

Machine Learning. CS 188: Artificial Intelligence Naïve Bayes. Example: Digit Recognition. Other Classification Tasks

Machine Learning. CS 188: Artificial Intelligence Naïve Bayes. Example: Digit Recognition. Other Classification Tasks CS 188: Artificial Intelligence Naïve Bayes Machine Learning Up until now: how use a model to make optimal decisions Machine learning: how to acquire a model from data / experience Learning parameters

More information

CS Master Level Courses and Areas COURSE DESCRIPTIONS. CSCI 521 Real-Time Systems. CSCI 522 High Performance Computing

CS Master Level Courses and Areas COURSE DESCRIPTIONS. CSCI 521 Real-Time Systems. CSCI 522 High Performance Computing CS Master Level Courses and Areas The graduate courses offered may change over time, in response to new developments in computer science and the interests of faculty and students; the list of graduate

More information

Gibbs Sampling and Online Learning Introduction

Gibbs Sampling and Online Learning Introduction Statistical Techniques in Robotics (16-831, F14) Lecture#10(Tuesday, September 30) Gibbs Sampling and Online Learning Introduction Lecturer: Drew Bagnell Scribes: {Shichao Yang} 1 1 Sampling Samples are

More information

Data Modeling & Analysis Techniques. Probability & Statistics. Manfred Huber 2011 1

Data Modeling & Analysis Techniques. Probability & Statistics. Manfred Huber 2011 1 Data Modeling & Analysis Techniques Probability & Statistics Manfred Huber 2011 1 Probability and Statistics Probability and statistics are often used interchangeably but are different, related fields

More information

Improving the Effectiveness of Time-Based Display Advertising (Extended Abstract)

Improving the Effectiveness of Time-Based Display Advertising (Extended Abstract) Proceedings of the Twenty-Third International Joint Conference on Artificial Intelligence Improving the Effectiveness of Time-Based Display Advertising (Extended Abstract) Daniel G. Goldstein Microsoft

More information

5. Probability Calculus

5. Probability Calculus 5. Probability Calculus So far we have concentrated on descriptive statistics (deskriptiivinen eli kuvaileva tilastotiede), that is methods for organizing and summarizing data. As was already indicated

More information

Attribution. Modified from Stuart Russell s slides (Berkeley) Parts of the slides are inspired by Dan Klein s lecture material for CS 188 (Berkeley)

Attribution. Modified from Stuart Russell s slides (Berkeley) Parts of the slides are inspired by Dan Klein s lecture material for CS 188 (Berkeley) Machine Learning 1 Attribution Modified from Stuart Russell s slides (Berkeley) Parts of the slides are inspired by Dan Klein s lecture material for CS 188 (Berkeley) 2 Outline Inductive learning Decision

More information

Chapter 12 Discovering New Knowledge Data Mining

Chapter 12 Discovering New Knowledge Data Mining Chapter 12 Discovering New Knowledge Data Mining Becerra-Fernandez, et al. -- Knowledge Management 1/e -- 2004 Prentice Hall Additional material 2007 Dekai Wu Chapter Objectives Introduce the student to

More information

Bayesian Updating with Discrete Priors Class 11, 18.05, Spring 2014 Jeremy Orloff and Jonathan Bloom

Bayesian Updating with Discrete Priors Class 11, 18.05, Spring 2014 Jeremy Orloff and Jonathan Bloom 1 Learning Goals Bayesian Updating with Discrete Priors Class 11, 18.05, Spring 2014 Jeremy Orloff and Jonathan Bloom 1. Be able to apply Bayes theorem to compute probabilities. 2. Be able to identify

More information

Probability Using Dice

Probability Using Dice Using Dice One Page Overview By Robert B. Brown, The Ohio State University Topics: Levels:, Statistics Grades 5 8 Problem: What are the probabilities of rolling various sums with two dice? How can you

More information

Machine Learning. Chapter 18, 21. Some material adopted from notes by Chuck Dyer

Machine Learning. Chapter 18, 21. Some material adopted from notes by Chuck Dyer Machine Learning Chapter 18, 21 Some material adopted from notes by Chuck Dyer What is learning? Learning denotes changes in a system that... enable a system to do the same task more efficiently the next

More information

Chapter 6: Episode discovery process

Chapter 6: Episode discovery process Chapter 6: Episode discovery process Algorithmic Methods of Data Mining, Fall 2005, Chapter 6: Episode discovery process 1 6. Episode discovery process The knowledge discovery process KDD process of analyzing

More information

Chapter 16: law of averages

Chapter 16: law of averages Chapter 16: law of averages Context................................................................... 2 Law of averages 3 Coin tossing experiment......................................................

More information

Probability and Expected Value

Probability and Expected Value Probability and Expected Value This handout provides an introduction to probability and expected value. Some of you may already be familiar with some of these topics. Probability and expected value are

More information

cs171 HW 1 - Solutions

cs171 HW 1 - Solutions 1. (Exercise 2.3 from RN) For each of the following assertions, say whether it is true or false and support your answer with examples or counterexamples where appropriate. (a) An agent that senses only

More information

MAT 211 Introduction to Business Statistics I Lecture Notes

MAT 211 Introduction to Business Statistics I Lecture Notes MAT 211 Introduction to Business Statistics I Lecture Notes Muhammad El-Taha Department of Mathematics and Statistics University of Southern Maine 96 Falmouth Street Portland, ME 04104-9300 MAT 211, Spring

More information

Concepts of Probability

Concepts of Probability Concepts of Probability Trial question: we are given a die. How can we determine the probability that any given throw results in a six? Try doing many tosses: Plot cumulative proportion of sixes Also look

More information