protocol Hybridization capture of DNA libraries using xgen Lockdown Probes next generation sequencing For use with:
|
|
|
- Cuthbert Andrews
- 9 years ago
- Views:
Transcription
1 Hybridization capture of DNA libraries using xgen Lockdown Probes For use with: xgen Lockdown Probes or Panels NimbleGen SeqCap Hybridization and Wash Buffers Illumina adapter-ligated libraries or Ion Torrent libraries See what we can do for you at For Research Use Only. Version 4
2 Hybridization capture of DNA libraries using xgen Lockdown Probes Table of contents Introduction 3 xgen Lockdown Probes 3 xgen Lockdown Panels 3 xgen Blocking Oligos 3 Protocol overview 4 Reagents, kits, and equipment 5 Oligos and reagents from IDT 5 Additional materials and equipment 6 Protocol 7 A. Prepare capture probes and blocking oligos 7 B. Combine and dry blocking oligos, Cot-1, and genomic DNA library 8 C. Hybridize DNA capture probes with the library 9 D. Prepare wash buffers 9 E. Prepare the streptavidin beads 10 F. Bind hybridized target to the streptavidin beads 11 G. Wash streptavidin beads to remove unbound DNA 12 H. Perform final, postcapture PCR enrichment 13 I. Purify postcapture PCR fragments 14 J. Validate and quantify library 14 K. Sequencing 15 Protocol revision history 16 2 See what we can do for you at
3 next generation sequencing Introduction This includes the steps necessary for hybridization of xgen Lockdown Probes or Panels with a library (i.e., Illumina single-index or dual-index, adapter-ligated library; or Ion Torrent library) prepared from genomic DNA and for target enrichment by PCR before sequencing. If using an alternative platform, contact [email protected] for advice about PCR enrichment. xgen Lockdown Probes xgen Lockdown Probes are individually synthesized, 5 -biotinylated oligos for target capture applications in next generation sequencing. These probes are useful for creating custom capture panels that can be optimized, expanded, and combined with other panels. xgen Lockdown Probes can also be used to enhance the performance of existing capture panels, rescuing poorly represented regions, such as areas of high GC content. If you plan to use xgen Lockdown Probes for spike-ins into existing probe sets or panels, please contact our NGS technical support group at [email protected], who will provide tailored recommendations for your specific experimental design. xgen Lockdown Panels xgen Lockdown Panels are stocked enrichment panels for targeted next generation sequencing and are typically based on 1X tiling of xgen Lockdown Probes. We currently offer the following: xgen Exome Research Panel xgen Acute Myeloid Leukemia Cancer Panel xgen Pan-Cancer Panel xgen Inherited Diseases Panel xgen Blocking Oligos xgen Universal Blocking Oligos bind to platform-specific adapter sequences on a designated strand (usually the inverse of the synthetic adapter) to help prevent non-specific binding, improve the number of reads on-target, and increase the depth of enrichment. Note: Visit to verify that you are using the most recent version of this. See the Protocol revision history table for a summary of changes to this document. Hybridization capture of DNA libraries using xgen Lockdown Probes 3
4 Protocol overview Hybridization capture of DNA Protocol step Approximate time libraries using xgen Lockdown Probes A Prepare capture probes and blocking oligos 45 minutes B Combine and dry blocking oligos, Cot-1, and genomic DNA library C Hybridize capture probes to the library 4 hours D E Prepare buffers and streptavidin beads F Bind hybridized targets to streptavidin beads 1.75 hours G Wash streptavidin beads to remove unbound DNA H Perform PCR enrichment I Purify postcapture PCR fragments 2.5 hours J Validate and quantify library Ready for sample preparation and sequencing Total: 9 hours Optional stopping points 4 See what we can do for you at
5 next generation sequencing Reagents, kits, and equipment Oligos and reagents from IDT Size Storage conditions Ordering information Target capture xgen Lockdown Probes Varies 20 C* xgen Lockdown Panels 16 or 96 rxns 20 C* xgen Universal Blocking Oligos Varies 20 C* Custom DNA oligonucleotides Illumina P5 Primer: AATGATACGGCGACCACCGA Varies 20 C Illumina P7 Primer: CAAGCAGAAGACGGCATACGA Varies 20 C Ion Torrent Primer A: CCATCTCATCCCTGCGTGTC Varies 20 C Custom DNA Oligos page Ion Torrent Primer P1: CCACTACGCCTCCGCTTTCCTCTCTATG Varies 20 C Reagents IDTE ph 8.0 (1X TE Solution) 10 2 ml Room temp. (15 25 C) Cat # Nuclease-Free Water 10 2 ml Room temp. (15 25 C) Cat # * See resuspension and storage instructions at Go to for safety data sheets (SDSs) and certificates of analysis (COAs) for IDT products. Hybridization capture of DNA libraries using xgen Lockdown Probes 5
6 Additional materials and equipment Reagents, kits, and equipment Materials Ordering information >80% Ethanol General laboratory supplier Agencourt AMPure XP PCR Purification beads Digital electrophoresis chips Beckman-Coulter, Cat #A63880 Bio-Rad Experion DNA 1K Analysis Kit, Cat # ; Agilent High Sensitivity DNA Kit, Cat # ; Agilent High Sensitivity D1000 ScreenTape, Cat # ; or equivalent Dynabeads M-270 Streptavidin Life Technologies, Cat #65305 Invitrogen Human Cot-1 DNA Life Technologies, Cat # KAPA HiFi HotStart ReadyMix Library Quantification Kit Illumina/Universal Library Quantification Kit Ion Torrent/Universal MAXYmum Recovery Microtubes, 1.7 ml MAXYmum Recovery PCR Tubes, 0.2 ml flat cap Qiagen Buffer EB (or equivalent: 10 mm Tris-Cl, ph 8.5) Kapa Biosystems, Cat #KK2601 Kapa Biosystems, Cat #KK4824 Kapa Biosystems, Cat #KK4827 VWR, Cat # VWR, Cat # Qiagen, Cat #19086 (or general laboratory supplier) (Optional) Qubit Assay Tubes Life Technologies, Cat #Q32856 (Optional) Qubit dsdna HS Assay Kit Life Technologies, Cat #Q32851 SeqCap EZ Hybridization and Wash Kits (24 or 96 rxns) Equipment 96-Well and 384-well thermal cyclers Digital electrophoresis system Magnetic separation rack Microcentrifuge Roche NimbleGen, Cat # or Ordering information General laboratory supplier Bio-Rad Experion Electrophoresis Station Cat # ; Agilent 2100 Electrophoresis Bioanalyzer, Cat #G2939AA; Agilent 2200 TapeStation, Cat #G2965AA; or equivalent NEB 6-tube separation rack, Cat #S1506S; Life Technologies 16-tube DynaMag -2 Magnet, Cat #12321D; Diagenode DiaMag02 magnetic rack, Cat #B ; or equivalent General laboratory supplier (Optional) Qubit 3.0 Fluorometer Life Technologies, Cat #Q33216 Vacuum concentrator or oven Vortex mixer Water bath or heating block General laboratory supplier General laboratory supplier General laboratory supplier 6 See what we can do for you at
7 next generation sequencing Prepare capture probes and blocking oligos A xgen Lockdown Probes If you received the xgen Lockdown Probes as a hydrated solution: 1. Thaw at room temperature (15 25 C). 2. Mix thoroughly and briefly spin down. If you received the xgen Lockdown Probes dry: Resuspend in IDTE ph 8.0 to a final concentration of 0.75 pmol/µl. If the concentration of your capture probe pool is <0.75 pmol/µl, we recommend the following: 1. Dry the portion of material for your capture. 2. Resuspend in nuclease-free water to a final concentration of 0.75 pmol/µl. For additional support regarding resuspension of Lockdown Probes pools, visit xgen Lockdown Probes Support tab expand Number of Reactions and Resuspension Volumes. xgen Universal Blocking Oligos Resuspend xgen Universal Blocking Oligos in IDTE ph 8.0 to a final concentration of 1 rxn/μl (1X final concentration). For additional support regarding resuspension of xgen Blocking Oligos, visit xgen Blocking Oligos Support tab view the Resuspension Instructions. Hybridization capture of DNA libraries using xgen Lockdown Probes 7
8 B Hybridization capture of DNA libraries using xgen Lockdown Probes Combine and dry blocking oligos, Cot-1, and the genomic DNA library 1. Based on your library type, mix the following in a low-bind 1.7 ml PCR tube (e.g., MAXYmum Recovery tube): Pooled, barcoded library Illumina LT-adapter ligated libraries Illumina HT-adapter ligated libraries Ion Torrent libraries 500 ng 500 ng 500 ng Cot-1 DNA 5 µg 5 µg 5 µg xgen Universal Blocking Oligo (1) xgen Universal Blocking Oligo (2) xgen Universal Blocking Oligo (3) 1 µl (TS-p5) 1 µl (TS HT-i5) 1 µl (IT-P1) X µl (TS-p7, 6 nt)* 1 µl (TS HT-i7) 1 µl (IT-A) Y µl (TS-p7, 8 nt)* * Important: If you are using a combination of 6 nt (adapters 1 12) and 8 nt (adapters 13 27) barcoded LT adapters (for example, if you are using TruSeq LT adapters), use the following formulas to determine the fractions of 6 nt (X) and 8 nt (Y) blocking oligos you need: X = (number of libraries with adapters 1 12) (total number of barcoded libraries) (number of libraries with adapters 13 27) Y = (total number of barcoded libraries) X + Y = 1 No calculations are necessary for determining the required amounts of HT blocking oligos, because the lengths of the barcoded regions are fixed. If the A adapter does not contain a barcode sequence, use 1 µl of xgen Standard Blocking Oligos (that is, the IT A Blocker). 2. Dry the contents of the tube using a vacuum concentrator (for example, SpeedVac System or a similar evaporator device) set at 70 C or lower. Optional stopping point: After drying, tubes can be stored overnight at room temperature (15 25 C). 8 See what we can do for you at
9 next generation sequencing C Hybridize DNA capture probes with the library 1. Add the following to the tube from Step B.2, and incubate at room temperature for 5 10 min: 8.5 µl SeqCap 2X Hybridization Buffer (vial 5) 3.4 µl SeqCap Hybridization Component A (vial 6) 1.1 µl Nuclease-Free Water 2. Pipette up and down to mix, and transfer to a low-bind 0.2 ml PCR tube (e.g., MAXYmum Recovery tube). 3. Incubate in a thermal cycler at 95 C for 10 min. 4. Remove samples from thermal cycler and immediately add 4 µl of the xgen Lockdown Probe pool. Note: Final volume will be 17 µl. 5. Vortex and briefly spin down. 6. Incubate samples in a thermal cycler at 65 C (with the heated lid at 75 C) for 4 hr. Note: The 65 C hybridization temperature improves the percentage of on-target capture. Prepare wash buffers D 1. For a single capture reaction, dilute the following SeqCap buffers to create 1X working solutions as follows: Note: 1X working solutions can be stored at room temperature for up to 2 weeks. Concentrated buffer Concentrated buffer (µl) Nuclease-free water (µl) 2.5X Bead Wash Buffer X Wash Buffer I X Wash Buffer II X Wash Buffer III X Stringent Wash Buffer Hybridization capture of DNA libraries using xgen Lockdown Probes 9
10 D Hybridization capture of DNA libraries using xgen Lockdown Probes 2. Prepare aliquots of Wash Buffer I and Stringent Wash Buffer from Step D.1, and store at the temperature specified in the following table: Buffer Wash Buffer I Stringent Wash Buffer Volumes of 1X working solution for each capture 100 µl 200 µl Temperature for 1X working solution 65 C* room temp (15 25 C) 400 µl 65 C* * Important: Preheat buffers in a 65 C water bath for at least 2 hours before use in Step G. 3. Keep the remaining 1X buffers at room temperature. Prepare the streptavidin beads E Important: Beads should be prepared immediately before use. Do not allow beads to dry out. 1. Equilibrate Dynabeads M-270 Streptavidin beads at room temperature for approximately 30 min before use. Important: We do not recommend using alternative streptavidin magnetic beads, because many of these have delivered significantly reduced capture yields Mix the beads thoroughly by vortexing for 15 sec. 3. Aliquot 100 μl of beads per capture into a single 1.7 ml low-bind tube. For example: for 1 capture, prepare 100 μl of beads and for 2 captures, prepare 200 µl of beads. For more than 6 captures, you will need more than one tube. 4. Place the tube in a magnetic separation rack (magnetic rack), allowing beads to fully separate from the supernatant. 5. Remove and discard the clear supernatant, ensuring that the beads remain in the tube. 10 See what we can do for you at
11 next generation sequencing 6. Perform the following wash: a. Add 200 µl of 1X Bead Wash Buffer per capture, and vortex for 10 sec. E b. Place the tube in the magnetic rack, allowing beads to fully separate from the supernatant. c. Carefully remove and discard the clear supernatant. 7. Perform a second wash by repeating Step E Add 100 μl of 1X Bead Wash Buffer per capture (refer to Step E.3) and vortex. 9. Transfer 100 μl of the resuspended beads into a new 0.2 ml low-bind tube for each capture reaction. 10. Place the tube in a magnetic rack, allowing beads to fully separate from the supernatant. 11. Carefully remove and discard the clear supernatant. Note: Small amounts of residual Bead Wash Buffer will not interfere with downstream binding of the DNA to the beads. Important: Proceed immediately to the next section, Bind hybridized target to the streptavidin beads. F Bind hybridized target to the streptavidin beads 1. Transfer the hybridization samples (from Step C.6) to the tube containing prepared beads (from Step E.11). 2. Mix thoroughly by pipetting up and down 10 times. 3. Bind the DNA to the beads by placing the tube into a thermal cycler set to 65 C (with the heated lid at 75 C) for 45 min. 4. Every 12 min during the 65 C incubation, vortex the tubes for 3 sec to ensure that the beads remain in suspension. Hybridization capture of DNA libraries using xgen Lockdown Probes 11
12 G Hybridization capture of DNA libraries using xgen Lockdown Probes Wash streptavidin beads to remove unbound DNA Note: Use the 1X wash buffers from Step D. 1) Perform 65 C washes. 1. Add 100 μl preheated 1X Wash Buffer I to the tube from Step F Important: Vortex briefly, and spin to collect contents at the bottom of the tube. 3. Transfer the mixture to a new low-bind 1.7 ml tube. 4. Important: Vortex briefly. 5. Place the tube in the magnetic rack, allowing beads to fully separate from the supernatant. 6. Pipet and discard the supernatant, which contains unbound DNA. 7. Perform the following wash: a. Add 200 μl of preheated 1X Stringent Wash Buffer, and slowly pipet up and down 10 times. Important: Do not create bubbles during pipetting. b. Incubate in a water bath at 65 C for 5 min. c. Place the tube in the magnetic rack, allowing beads to fully separate from the supernatant. d. Pipet and discard the supernatant, which contains unbound DNA. 8. Repeat Step 7 (wash with Stringent Wash Buffer). 2) Perform room temperature washes. 1. Add 200 μl of room temperature 1X Wash Buffer I and vortex for 2 min. 2. Place the tube in the magnetic rack, allowing beads to fully separate from the supernatant. 3. Pipet and discard the supernatant. 4. Add 200 μl of room temperature 1X Wash Buffer II and vortex for 1 min. 5. Place the tube in the magnetic rack, allowing beads to fully separate from the supernatant. 6. Pipet and discard the supernatant. 7. Add 200 μl of room temperature 1X Wash Buffer III and vortex for 30 sec. 8. Place the tube in the magnetic rack, allowing beads to fully separate from the supernatant. 9. Pipet and discard the supernatant. 12 See what we can do for you at
13 next generation sequencing 3) Resuspend beads. G 1. Remove the tube containing the beads with captured DNA from the magnetic rack. 2. Add 20 µl of Nuclease-Free Water to the beads. 3. Pipet up and down 10 times and ensure any beads stuck to the side of the tube have been resuspended. Important: Do not discard the beads. Use the entire 20 µl of resuspended beads with captured DNA in Step H. Perform final, postcapture PCR enrichment H 1. Based on your library type, prepare the PCR mix in 0.2 ml low-bind PCR tubes as follows: For Illumina libraries For Ion Torrent libraries 2X KAPA HiFi HotStart ReadyMix 25 µl 2X KAPA HiFi HotStart ReadyMix 25 µl 10 µm Illumina P5 primer 2.5 µl 10 µm Ion Torrent A primer 2.5 µl 10 µm Illumina P7 primer 2.5 µl 10 µm Ion Torrent P1 primer 2.5 µl Beads with captured DNA (from Step G.3.2) 20 µl Beads with captured DNA (from Step G.3.2) 20 µl Total volume 50 µl Total volume 50 µl 2. Briefly vortex and spin the PCR mix, but ensure that the beads remain in solution. 3. Place the PCR tube in the thermal cycler, and run the following program with the heated lid set at 105 C: Number of cycles Temperature ( C) Time Polymerase activation sec Amplification 12 Denaturation sec Annealing sec Extension sec Final extension min Hold 1 4 Hold Cycling conditions recommended by Kapa Biosystems. Optional stopping point: PCR-enriched captures may be stored at 4 C overnight. Hybridization capture of DNA libraries using xgen Lockdown Probes 13
14 I Hybridization capture of DNA libraries using xgen Lockdown Probes Purify postcapture PCR fragments 1. Add 75 µl (1.5X volume) of Agencourt AMPure XP beads to each PCR-enriched capture. 2. Follow the binding and washing steps in the Agencourt AMPure, except use 80% ethanol for the washes. 3. Elute in 22 µl of Qiagen Buffer EB or equivalent (10 mm Tris-Cl, ph 8.5). 4. Transfer 20 µl of eluted product to a fresh 1.7 ml low-bind tube, ensuring no beads are carried over. Optional stopping point: Purified PCR fragments may be stored at 20 C for up to 1 week. Validate and quantify library J 1. (Optional) Measure the concentration of the captured library using a Qubit Fluorometer and the Qubit dsdna HS Assay Kit. Note: This can be done to ensure that the concentration of the captured library is within the detection limits of the chip or tape used in Step J.2 (below) for your digital electrophoresis system. 2. Measure the average fragment length of the captured library on a digital electrophoresis system (e.g., the BioRad Experion System using a DNA 1K chip, the Agilent 2100 Bioanalyzer using a high sensitivity DNA chip, or Agilent 2200 TapeStation using a DNA tape). 3. Quantify libraries using the appropriate KAPA Library Quantification Kit, as directed by the manufacturer. Optional stopping point: Library may be stored at 20 C overnight. 14 See what we can do for you at
15 next generation sequencing Sequencing K Perform sequencing according to the instructions for your specific platform. For Illumina libraries: Use the calculated concentration of undiluted library stock (from Step J.3) to prepare the library for sequencing. For Ion Torrent libraries: Use the calculated concentration of undiluted library stock (from Step J.3) to prepare the library for emulsion PCR. Hybridization capture of DNA libraries using xgen Lockdown Probes 15
16 Protocol revision history Hybridization capture of DNA libraries using xgen Lockdown Probes Tech support: Version Date released 4 March September November January 2014 Description of changes Removed requirement to work quickly at Step G.1. Added instructional detail to bead resuspension steps. Removed KAPA library quantification tables. Updated the title from Rapid Protocol for DNA Probe Hybridization and Target Capture Using an Illumina TruSeq or Ion Torrent Library. Corrected Ion Torrent P1 adapter sequence. Changed the annealing temperature for the postcapture PCR from 65 C to 60 C. Clarified instructions in steps G, I, and J. Added optional stopping points. Added some important notes. Updated template. Product began shipping wet (already resuspended): added instructions for use of product received wet. Changed some reagent volumes to reflect further optimization. Removed Appendix A: Spike-In Protocol. This is available separately upon request to [email protected]. Changed hybridization temperature from 47 C to 65 C. Changed hybridization time from 48 hr to 4 hr. Added Ion Torrent information. Changed post-capture amplification from off-bead to on-bead. 1 May 2013 Original. For Research Use Only Integrated DNA Technologies, Inc. All rights reserved. Trademarks contained herein are the property of Integrated DNA Technologies, Inc. or their respective owners. For specific trademark and licensing information, see NGS PR 03/16 Integrated DNA Technologies, Inc Commercial Park Coralville, Iowa
How To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent
SPARK DNA Sample Prep Kit Ion Torrent (SPK0002-V08) Frequently Asked Questions Under what circumstances would I use SPARK DNA Sample Prep Kit for Ion Torrent? Enzymatics SPARK DNA Sample Prep Kit for Ion
FOR REFERENCE PURPOSES
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
Application Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
NimbleGen SeqCap EZ Library SR User s Guide Version 3.0
NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 For life science research only. Not for use in diagnostic procedures. Copyright 2011 Roche NimbleGen, Inc. All Rights Reserved. Editions Version
NimbleGen DNA Methylation Microarrays and Services
NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the
TruSeq DNA Methylation Library Preparation Guide
TruSeq DNA Methylation Library Preparation Guide Kit Contents 3 Consumables and Equipment 4 Preparation 5 Quality Control of Bisulfite-Converted DNA 6 TruSeq DNA Methylation Kit Protocol 7 Sequencing the
Sequencing Library qpcr Quantification Guide
Sequencing Library qpcr Quantification Guide FOR RESEARCH USE ONLY Introduction 3 Quantification Workflow 4 Best Practices 5 Consumables and Equipment 6 Select Control Template 8 Dilute qpcr Control Template
Amplicon Template Preparation and Sequencing
Please note: the shared protocols described herein may not have been validated by Pacific Biosciences and are provided as-is and without any warranty. Use of these protocols is offered to those customers
Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform
Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 2 Sample Prep Workflow, 3 Best Practices, 4 DNA Input Recommendations, 6
PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System)
How To Get Rid Of Small Dna Fragments
AxyPrep TM Mag FragmentSelect-I Protocol (Fragment Size Selection for Illumina Genome Analyzer and Life Technologies SoLiD) Introduction The AxyPrep Mag FragmentSelect-I purification kit utilizes a unique
Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products
Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B
SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual
Toll Free: 866-252-7771 752A Lincoln Blvd. Phone: 732-469-7771 Fax: 732-469-7782 Middlesex, NJ 08846 Web: www.purebiotechllc.com SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual Product: SOLIDscript
1) Vector Preparation sg 1371 w/blp1 Ef1α puro t29 BFP (602 ng/ul)
1) Vector Preparation sg 1371 w/blp1 Ef1α puro t29 BFP (602 ng/ul) a) Digest 5 ug of vector with Thermo Scientific FastDigest BstX1 and Blp1 for 1h at 37ºC. Set up reaction as follows: 100 ul Reaction
RNA Fragment DeepSeq Library Preparation Protocol
RNA Fragment DeepSeq Library Preparation Protocol I) LIGATION Recommended input: RNA between 0.05-2 pmol; must have 3' OH 1. Thaw 10X T4 RNA Ligase Reaction Buffer, 50% PEG8000, 20 mm DTT, 7 um App Adaptor
16S Metagenomic Sequencing Library Preparation Preparing 16S Ribosomal RNA Gene Amplicons for the Illumina MiSeq System
16S Metagenomic Sequencing Library Preparation Preparing 16S Ribosomal RNA Gene Amplicons for the Illumina MiSeq System Introduction 2 16S Library Preparation Workflow 5 Amplicon PCR 6 PCR Clean Up 8 Index
USER GUIDE. Encore PART NOS. 8041 and 8042. SP Rapid Library Systems
USER GUIDE Encore PART NOS. 8041 and 8042 SP Rapid Library Systems Patents, Licensing and Trademarks 2012 2013 NuGEN Technologies, Inc. All rights reserved. The Encore, Ovation and Applause families of
Protocol 001298v001 Page 1 of 1 AGENCOURT RNACLEAN XP IN VITRO PRODUCED RNA AND CDNA PURIFICATION
Page 1 of 1 AGENCOURT RNACLEAN XP IN VITRO PRODUCED RNA AND CDNA PURIFICATION Please refer to http://www.agencourt.com/technical for updated protocols and refer to MSDS instructions when handling or shipping
TIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
AxyPrep TM Mag PCR Clean-up Protocol
AxyPrep TM Mag PCR Clean-up Protocol Intro The AxyPrep Mag PCR Clean-up kit utilizes a unique paramagnetic bead technology for rapid, high-throughput purification of PCR amplicons. Using this kit, PCR
Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform
Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 3 Sample Prep Workflow, 4 Best Practices, 5 DNA Input Recommendations,
empcr Amplification Method Manual - Lib-A
GS Junior Titanium Series May 2010 (Rev. April 2011) For life science research only. Not for use in diagnostic procedures. 1. WORKFLOW The emulsion-based clonal amplification (empcr amplification) of a
ab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
ncounter Gene Expression Assay Manual Total RNA and Cell Lysate Protocols
ncounter Gene Expression Assay Manual Total RNA and Cell Lysate Protocols v.20090807 For research use only. Not for use in diagnostic procedures. Limited License Subject to the terms and conditions of
DNA IQ System Database Protocol
TECHNICAL BULLETIN DNA IQ System Database Protocol Instruc ons for Use of Products DC6700 and DC6701 Revised 11/13 TB297 DNA IQ System Database Protocol All technical literature is available at: www.promega.com/protocols/
Genomic DNA Extraction Kit INSTRUCTION MANUAL
Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview
ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas
ExpressArt Bacterial H-TR cdna synthesis kit With extreme selectivity against rrnas suitable for 2 to 4 µg total RNA Catalogue No. 8004-A30 (30 rxns) Reagents Materials are provided for 30 cdna synthesis
PROTOCOL: Illumina Paired-end Whole Exome Capture Library Preparation Using Full-length Index Adaptors and KAPA DNA Polymerase
PROTOCOL: Illumina Paired-end Whole Exome Capture Library Preparation Using Full-length Index Adaptors and KAPA DNA Polymerase This protocol provides instructions for preparing DNA paired-end capture libraries
Agencourt RNAdvance Blood Kit for Free Circulating DNA and mirna/rna Isolation from 200-300μL of Plasma and Serum
SUPPLEMENTAL PROTOCOL WHITE PAPER Agencourt RNAdvance Blood Kit for Free Circulating DNA and mirna/rna Isolation from 200-300μL of Plasma and Serum Bee Na Lee, Ph.D., Beckman Coulter Life Sciences Process
RT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
Dynabeads mrna DIRECT Micro Kit
USER GUIDE Dynabeads mrna DIRECT Micro Kit Catalog Number 61021 Revision 004 Revision Date 14 May 2012 For Research Use Only. Not for human or animal therapeutic or diagnostic use. For Research Use Only.
qpcr Quantification Protocol Guide
qpcr Quantification Protocol Guide FOR RESEARCH USE ONLY Topics 3 Introduction 5 User-Supplied Consumables and Equipment 7 Select Template 8 Dilute qpcr Template 9 Dilute Libraries 10 Prepare Reaction
DNA Isolation Kit for Cells and Tissues
DNA Isolation Kit for Cells and Tissues for 10 isolations of 00 mg each for tissue or 5 x 10 7 cultured cells Cat. No. 11 81 770 001 Principle Starting material Application Time required Results Benefits
User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
UltraClean Soil DNA Isolation Kit
PAGE 1 UltraClean Soil DNA Isolation Kit Catalog # 12800-50 50 preps New improved PCR inhibitor removal solution (IRS) included Instruction Manual (New Alternative Protocol maximizes yields) Introduction
Sanger Sequencing: Sample Preparation Guide
Sanger Sequencing: Sample Preparation Guide Use this as a guide to prepare your samples for Sanger sequencing at AGRF CONTENTS 1 Overview... 2 1.1 Capillary Separation (CS) or electrophoretic separation
The RNAi Consortium (TRC) Broad Institute
TRC Laboratory Protocols Protocol Title: One Step PCR Preparation of Samples for Illumina Sequencing Current Revision Date: 11/10/2012 RNAi Platform,, [email protected] Brief Description: This
ISOLATE II PCR and Gel Kit. Product Manual
ISOLATE II PCR and Gel Kit Product Manual 2 Product Manual www.bioline.com/isolate PCR and Gel Kit ISOLATE II PCR and Gel Kit ISOLATE II PCR and Gel Kit 1 Kit contents 04 2 Description 04 3 Storage 04
MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C
microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr
Stratagene QPCR Mouse Reference Total RNA
Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits
qstar mirna qpcr Detection System
qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr
Classic Immunoprecipitation
292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
Procedure for RNA isolation from human muscle or fat
Procedure for RNA isolation from human muscle or fat Reagents, all Rnase free: 20% SDS DEPC-H2O Rnase ZAP 75% EtOH Trizol Chloroform Isopropanol 0.8M NaCitrate/1.2M NaCl TE buffer, ph 7.0 1. Homogenizer-probe
RNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr)
RNA Extraction and Quantification, Reverse Transcription, and Real-time Preparation of Samples Cells: o Remove media and wash cells 2X with cold PBS. (2 ml for 6 well plate or 3 ml for 6cm plate) Keep
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
Troubleshooting Sequencing Data
Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page
Plant Genomic DNA Extraction using CTAB
Plant Genomic DNA Extraction using CTAB Introduction The search for a more efficient means of extracting DNA of both higher quality and yield has lead to the development of a variety of protocols, however
Taq98 Hot Start 2X Master Mix
Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 [email protected]
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR)
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR) [email protected] Av/ Puerta de Hierro s/n. 28040 Madrid. Tel: (34) 913944082
TaqMan Fast Advanced Master Mix. Protocol
TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED
MLX BCG Buccal Cell Genomic DNA Extraction Kit. Performance Characteristics
MLX BCG Buccal Cell Genomic DNA Extraction Kit Performance Characteristics Monolythix, Inc. 4720 Calle Carga Camarillo, CA 93012 Tel: (805) 484-8478 monolythix.com Page 2 of 9 MLX BCG Buccal Cell Genomic
MagExtractor -Genome-
Instruction manual MagExtractor-Genome-0810 F0981K MagExtractor -Genome- NPK-101 100 preparations Store at 4 C Contents [1] Introduction [2] Components [3] Materials required [4] Protocol 1. Purification
How To Write An Ipa
LIBRARY PREPARATION NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) Instruction Manual NEB #E7300S/L 24/96 reactions Sign up for the NEBNext e-newsletter Scan this code or visit www.neb.com/
Arcturus PicoPure RNA Isolation Kit. User Guide
Arcturus PicoPure RNA Isolation Kit User Guide For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.
Real-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
PrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
RealStar HBV PCR Kit 1.0 11/2012
RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 For research use only! (RUO) Product No.: 201003 96 rxns INS-201000-GB-02 Store at -25 C... -15 C November 2012 altona Diagnostics GmbH Mörkenstraße
Paired-End Sample Preparation Guide
Paired-End Sample Preparation Guide FOR RESEARCH USE ONLY Introduction 3 Sample Prep Workflow 4 Best Practices 5 DNA Input Recommendations 7 Kit Contents 9 Consumables and Equipment 11 Fragment DNA 13
Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280.
Technical Bulletin Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280. PRINTED IN USA. Revised 4/06 AF9TB141 0406TB141 Wizard DNA Clean-Up System All technical literature is available on
The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade plasmid DNA.
INSTRUCTION MANUAL ZymoPURE Plasmid Gigaprep Kit Catalog Nos. D4204 (Patent Pending) Highlights The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade
An In-Gel Digestion Protocol
An In-Gel Digestion Protocol This protocol describes the digestion of a protein present in an SDS-PAGE gel band with trypsin. The band can be taken from either a 1D or 2D electrophoresis gel. Reagents
RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl
Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl
50 g 650 L. *Average yields will vary depending upon a number of factors including type of phage, growth conditions used and developmental stage.
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] Phage DNA Isolation Kit Product # 46800, 46850 Product Insert
ELUTION OF DNA FROM AGAROSE GELS
ELUTION OF DNA FROM AGAROSE GELS OBTECTIVE: To isolate specific bands or regions of agarose-separated DNA for use in subsequent experiments and/or procedures. INTRODUCTION: It is sometimes necessary to
Troubleshooting Polyacrylamide Gel Electrophoresis (PAGE)
PIPET TIPS Troubleshooting The IDT gel electrophoresis group runs preparatory polyacrylamide gels to purify certain oligonucleotides and can run up to 500 gels a day based on demand. Running that many
Protein Precipitation Protocols
Protein Precipitation Protocols Notes: All reagents need to high purity/hplc quality. All tubes used should be new or hand cleaned thoroughly with Micro90 detergent. High quality water needs to be used
PicoMaxx High Fidelity PCR System
PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED
QIAGEN Supplementary Protocol
QIAGEN Supplementary Protocol Isolation of Peripheral Blood Mononuclear Cells (PBMC) and Purification of Total RNA from PBMC Using the RNeasy Micro or Mini Kit This protocol describes how to isolate PBMC
Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3
Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA
Technical Manual No. 0173 Update Date 10112010
TissueDirect TM Multiplex PCR System Technical Manual No. 0173 Update Date 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed
All-in-One First-Strand cdna Synthesis Kit
All-in-One First-Strand cdna Synthesis Kit For reliable first-strand cdna synthesis from all RNA sources Cat. No. AORT-0020 (20 synthesis reactions) Cat. No. AORT-0050 (50 synthesis reactions) User Manual
ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.
A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT
Epstein Barr Virus (Human Herpes virus 4) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...
TM Primerdesign Ltd TM Primerdesign Ltd Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere...
Wizard SV Gel and PCR Clean-Up System
TECHNICAL BULLETIN Wizard SV Gel and PCR Clean-Up System Instruc ons for Use of Products A9280, A9281, A9282 and A9285 Revised 12/10 TB308 Wizard SV Gel and PCR Clean-Up System All technical literature
How To Shear Chromatin
truchip Low Cell Chromatin Shearing Kit with Non-ionic Shearing Buffer Part Number: 010144 Rev C 1 Page INTRODUCTION The truchip Low Cell Chromatin Shearing Kit with Non-ionic Shearing Buffer (PN 520084)
UltraClean Forensic DNA Isolation Kit (Single Prep Format)
UltraClean Forensic DNA Isolation Kit (Single Prep Format) Catalog No. Quantity 14000-10 10 preps 14000-S 1 prep Instruction Manual Please recycle Version: 10302012 1 Table of Contents Introduction...
HBV Quantitative Real Time PCR Kit
Revision No.: ZJ0002 Issue Date: Aug 7 th, 2008 HBV Quantitative Real Time PCR Kit Cat. No.: HD-0002-01 For Use with LightCycler 1.0/LightCycler2.0/LightCycler480 (Roche) Real Time PCR Systems (Pls ignore
RNA Antisense Purification (RAP): Experimental Protocols
RNA Antisense Purification (RAP): Experimental Protocols Jesse Engreitz [email protected] August 23, 2014. Last Updated: October 18, 2014 This document describes the experimental procedures for
Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
PowerFecal DNA Isolation Kit
PowerFecal DNA Isolation Kit Catalog No. Quantity 12830-50 50 Preps Instruction Manual Inhibitor Removal Technology (IRT) is a registered trademark of MO BIO Laboratories, Inc. and is covered by the following
Terra PCR Direct Polymerase Mix User Manual
Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain
mircute mirna qpcr Detection Kit (SYBR Green)
mircute mirna qpcr Detection Kit (SYBR Green) For detection of mirna using real-time RT-PCR (SYBR Green I) www.tiangen.com QP110302 mircute mirna qpcr Detection Kit (SYBR Green) Kit Contents Cat. no. FP401
Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation
BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY REAL-TIME POLYMERASE CHAI REACTIO (PCR)
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY REAL-TIME POLYMERASE CHAI REACTIO (PCR) [email protected] Av/ Puerta de Hierro s/n. 28040 Madrid. Tel: (34) 913944082
Total Exosome RNA and Protein Isolation Kit
USER GUIDE Total Exosome RNA and Protein Isolation Kit For isolation of RNA and protein from exosomes Catalog Number 4478545 Revision A Publication Number MAN0006962 For Research Use Only. Not for use
Qubit dsdna HS Assay Kits
Qubit dsdna HS Assay Kits For use with the Qubit 2.0 Fluorometer Table 1. Contents and storage information. Material Amount Concentration Storage Stability Qubit dsdna HS Reagent (Component A) 250 µl or
U.S. Patent No. 9,051,563 and other pending patents. Ver. 1.1.3
INSTRUCTION MANUAL Direct-zol RNA MiniPrep Catalog Nos. R050, R05, R05, & R053 Highlights Quick, spin column purification of high-quality (DNA-free) total RNA directly from TRIzol, TRI Reagent and other
Kevin Bogart and Justen Andrews. Extraction of Total RNA from Drosophila. CGB Technical Report 2006-10 doi:10.2506/cgbtr-200610
Kevin Bogart and Justen Andrews Extraction of Total RNA from Drosophila CGB Technical Report 2006-10 doi:10.2506/cgbtr-200610 Bogart K and Andrews J. 2006. Extraction of Total RNA from Drosophila. CGB
ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.
User manual imegen Anchovies II ID kit Anchovies species (E. encrasicolus and E. japonicus) DNA detection by sequencing Reference: Made in Spain The information in this guide is subject to change without
Human Herpes Virus 1 (Herpes simplex type 1) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...
TM Primerdesign Ltd TM Primerdesign Ltd Human Herpes Virus 1 (Herpes simplex type 1) Capsid assembly and DNA maturation gene genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere...
GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps)
1 GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps) (FOR RESEARCH ONLY) Sample : Expected Yield : Endotoxin: Format : Operation Time : Elution Volume : 50-400 ml of cultured bacterial
Mir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
Cluster Generation. Module 2: Overview
Cluster Generation Module 2: Overview Sequencing Workflow Sample Preparation Cluster Generation Sequencing Data Analysis 2 Cluster Generation 3 5 DNA (0.1-5.0 μg) Library preparation Single Cluster molecule
Platinum Multiplex PCR Master Mix
USER GUIDE Publication Part Number 4463722 Rev. A Revision Date April 2011 For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject
Global MicroRNA Amplification Kit
Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in
Trimmer-2 cdna normalization kit
Trimmer-2 cdna normalization kit Cat # NK003 User manual PLEASE READ THE ENTIRE MANUAL BEFORE STARTING Contents I Intended use............................ 1 II Method overview..........................
