Detection of HBV DNA in Serum Using a PCR-Based Assay
|
|
|
- Virgil Burke
- 10 years ago
- Views:
Transcription
1 2 Detection of HBV DNA in Serum Using a PCR-Based Assay Hau Tim Chung 1. Introduction Detection of minute amounts of hepatitis B virus (HBV) DNA in the serum using polymerase chain reaction (PCR) based assay involves extracting the viral DNA from the viral particle in the serum, removing inhibitors of PCR, performing the PCR, and detecting the PCR product. PCR is an extremely sensitive assay, and preventing cross contamination is an important part of the assay HBV DNA Extraction from Viral Particles and Removal of Inhibitor of PCR HBV DNA in viral particles in serum is covered by a coat of hepatitis B core antigen (HBcAg) particles and a lipid coat with hepatitis B surface antigen (HBsAg) in it. Removal of the HBcAg and the HBsAg with the lipid coat can be easily accomplished by treatment with a detergent or alkali. However, there are many inhibitors of the PCR reaction in the serum. Deproteinization removes most of these inhibitors and it forms the basis of the procedure being described and used by the author. Alternatively, PCR can also be performed from DNA extracted directly from serum Proteinase K/Phenol/Phenol Chloroform/Ethanol Precipitation Extraction of HBV DNA from serum is a tedious procedure, and its yield is variable, which directly affects the sensitivity or detection limit of the assay. Moreover, each step in the procedure creates a risk for cross contamination. However, it will also serve as a concentration method. The sensitivity of the assay can be improved by simply increasing the amount of serum used for the extraction. The volume limit of the actual PCR, which is a result of the need to change the temperature at a rapid pace, does not count here. The negative strand of the HBV DNA molecule is covalently bound to a small piece of protein, and thus the whole molecule may stay in the interface if the proteinase K digestion is not performed well. This is one of the many problems that affect the yield From: Methods in Molecular Medicine, vol. 95: Hepatitis B and D Protocols, volume 1 Edited by: R. K. Hamatake and J. Y. N. Lau Humana Press Inc., Totowa, NJ 15
2 16 Chung in HBV DNA extraction using proteinase K/phenol/phenol chloroform/ethanol precipitation. In a well-digested specimen, the interface between the aqueous and phenol phase should be almost nonexistent. The presence of any significant amount of interface will drastically reduce the yield and thus affects the detection limit of the assay Alkali Denaturization PCR can also be performed using neat deproteinized serum that has been treated with a denaturing agent to release the nucleic acid from the lipid and protein coat. Proteinase K digestion is one of the methods for removing protein, but this process can also be achieved by alkali treatment of the serum and heat denaturing of the protein. PCR can be performed in the same tube with the denatured protein spun down. This method reduces dramatically the number of steps needed in the procedure and saves time, labor, and cost. More important, fewer steps and tube changes also reduce the risk of cross contamination Performing PCR and Detection of Its Products PCR can be performed in the standard way using the deproteinized neat serum. When two sequential PCR steps of 30 cycles each are used with two sets of nested primers, the level of DNA can be amplified from as low as one molecule to a level that can easily be detected using ethidium bromide staining of a polyacrylamide gel. This method is much easier and less expensive than using a more sensitive detection method, such as Southern blotting, to detect a smaller amount of product from a single round of 30-cycle PCR. The turnaround time of the protocol described below is within one working day, compared with at least five for PCR-Southern blotting. It also removes the need to work with radioisotopes Choice of Primers All published sequences of the hepatitis B virus (1 10) were aligned using a computer program. The HBV sequences have a reasonably conserved sequence among various isolates. There are only a few regions with significant variations: , , , and (HBV DNA sequence numbering system is according to Galibert et al. [1]). Regions of fewer than 300 base pairs in length of highly conserved regions were deemed suitable to be amplified using PCR and will achieve a high yield. This region has to be framed by two pairs of perfectly conserved short sequences, each about 20 nucleotides long, to be used as pairs of nested primers. One set of nested pairs of primers was chosen from the surface-antigen-coding region and another from the core-coding region. Running two PCR s for each specimen using two different sets of nested primers reduces the theoretical risk of variant viruses failing to be detected if one of the primers does not match the target sequence. It may also pick up cases of false-positive results caused by inadvertent cross contamination by PCR products from previous reactions Sequence of the Chosen Primers Nested primer sets for surface-antigen-coding region: Primer set for first PCR:
3 Detection of HBV DNA in Serum Using PCR-Based Assay 17 Primer 1: CCTGCTGGTGGCTCGAGTTC (58 77) Primer 2: CAAACGGGCAACATACCTTG ( ) Primer set for the second PCR: Primer 3: ACATCAGGATTCCTAGGACC ( ) Primer 4: CGCAGACACATCCAGCGATA ( ) These sets of primers used in a nested PCR will give a product of 221 base pairs in length. Nested primer sets for the core-antigen-coding region: Primer set for the first PCR: Primer 5: GGAGTGGGATTCGCACTCC ( ) Primer 6: ATACTAACATTGAGATTCCC ( ) Primer set for the second PCR: Primer 7: AGACCACCAAATGCCCCTAT ( ) Primer 8: GATCTTCTGCGACGCGGCGA ( ) These sets of primers used in a nested PCR will give a product of 131 or 137 base pairs in length, depending on the subtype of the HBV target Prevention of Cross Contamination Cross contamination can be caused by HBV DNA present in the laboratory environment, on bench tops, on utensils, and as aerosol within the piston mechanism of pipetting instruments left from previous experiments performed in the same laboratory. More important, PCR products are short DNA sequences that can survive in the environment for a long period and are potential target sequences that will give a positive result in an assay. The number of copies of these PCR products totals millions- to trillions-fold that of HBV DNA handled in a clinical specimen and thus has a much higher risk of cross contamination. The following steps are used to reduce the chance of cross contamination: 1. Most instruments should be used only once when collecting a blood specimen from the subject. They include needles, needle holders, specimen tubes, and syringes. Gloves should be changed in between subjects, and extra care should be taken to avoid soiling of the tourniquet by blood. 2. Care should be taken to avoid contamination of the laboratory environment or cross contamination when centrifuging blood and separating serum from the specimen. Serum should be sucked out using a single-use Pasteur pipet with bulbs attached. Reusable bulbs cannot be used. 3. Consideration in avoiding cross contamination should be observed in storing specimens for future analyses, when thawing the specimen, and when aliquoting specimens for assay. Serum should not be stored in Eppendorf tubes with flip-open lids. Tiny amounts of serum always get into the lid when it is inverted for mixing after thawing and contaminate the glove
4 18 Chung used to open it. Serum should be stored in screw-top tubes designed in such a way that serum will not get onto the glove when it is handled, inverted for mixing, or opened. 4. Procedures before PCR should be physically isolated from those after PCR. Ideally, they should be performed on different benches using different sets of instruments, in particular, pipettors. Gloves should be changed in between handling samples in the steps before and after PCR. 5. All solutions should be prepared using single-use utensils. They are prepared in large lots, aliquoted to portions sufficient for a single run, and stored in a refrigerator or freezer until used. Unused portions are discarded. The only exception to this rule is the Taq polymerase enzyme. It is added into the PCR mix just before it is dispensed into the reaction tube. 6. All pipetting should be performed using either a positive displacement pipet (Microman, Gilson, France) or an ordinary pipettor with filtered pipet tips (United States Biochemical Corps., Cleveland, OH, USA). This approach was found to be the single most important step in preventing cross contamination, with the vast majority of cases containing aerosol contaminations. 7. All PCR products should be disposed of carefully to avoid contaminating the laboratory environment. The protocol described in the following paragraphs used a minimum number of steps, a minimum number of pipettings, and a minimum number of tubes. Pipet tips, Eppendorf tubes, electrophoresis apparatus, the polyacrylamide gel, and the ultraviolet (UV) light box used to view the gel are potential sources of PCR products that could cause cross contamination. Eppendorf tubes are disposed of with lids closed, and pipet tips and gel are disposed of carefully, making sure the bench top and environment are not contaminated. Electrophoresis solutions are discarded carefully into the sink and flushed with ample amounts of water. The electrophoresis apparatus is washed with plenty of water. The UV light box can be wiped with 1 N HCl and neutralized with 1 M Tris-HCl ph 7 5 minutes later. Gloves are changed after handling these steps. 2. Materials 1. 1 N NaOH. 2. Tris-HCl/HCl: mixture of equal volume of 2 M Tris HCl, ph 8.3 and 2 N HCl. 3. PCR mix 1 2: 12.5 mm Tris-HCl, ph 8.3, 62.5 mm KCl, mm MgCl 2, 250 M each of the four deoxyribonucleotides (datp, dttp, dctp, and dgtp), 1.25 M each of primer 1 and primer PCR mix 3 4: same as PCR mix 1 2, but use primer 3 and primer 4 instead of primer 1 and primer PCR mix 5 6: same as PCR mix 1 2, but use primer 5 and primer 6 instead of primer 1 and primer PCR mix 7 8: same as PCR mix 1 2, but use primer 7 and primer 8 instead of primer 1 and primer Taq polymerase enzyme. 8. 6X loading buffer: 15% Ficoll 400/0.15% bromphenol blue. 3. Methods The following protocol utilizing alkali denaturization was used regularly by the author and will work, except if the specimen is heavily hemolyzed before separation (11 14). 1. Serum has to be separated from the blood specimen in a timely fashion to avoid hemolysis. 2. Put 10 L of serum into a 500- L Eppendorf tube.
5 Detection of HBV DNA in Serum Using PCR-Based Assay Add 1 L of 1 N NaOH solution. 4. Cover with 10 L of mineral oil. 5. Heat to 37 C for 1 hour. 6. Add 1 L of Tris-HCl/HCl. Care has to be taken that the solution is added into the aqueous phase of the tube and is not floating on the top of the mineral oil layer as a result of surface tension. 7. Heat to 98 C for 5 min, Protein will be denatured and come out of the solution as a yellowish precipitate. 8. Centrifuge in a microcentrifuge for 5 min. The denatured protein precipitate will stay in the bottom of the tube and will not interfere with the subsequent reaction. 9. Add Taq polymerase enzyme into a volume of PCR mix 1 2 just enough for the total number of tubes in the run. The final amount of enzyme should be 2.5 U per 40 L of PCR mix. 10. Add 40 L of solution from step 9 into the aqueous phase of specimen in step 8. There is no need for mixing, and care has to be taken not to disturb the protein precipitate at the bottom of the tube. 11. Put the Eppendorf tube into a PCR machine. 12. Run 30 cycles of PCR, each consisting of 54 seconds at 94 C, 1 minute at 50 C, and 1 minute at 72 C. 13. When PCR in step 12 is about to finish, add Taq polymerase enzyme into a volume of PCR mix 3 4 just enough for the total number of tubes in the run. The final amount of enzyme should be 2.5 U per 40 L of PCR mix. 14. Set up the same number of Eppendorf tubes as the number of specimens run in step 2. Fill each of them with 40 L of solution from step 13 and cover with 10 L of mineral oil. 15. Pipet 10 L of the PCR product from step 12 into each of the tubes from step Run 30 cycles of PCR, each consisting of 54 seconds at 94 C, 1 minute at 50 C, and 1 minute at 72 C. 17. Add 10 L 6X loading buffer into each tube. Mix by pipetting and load 10 L into a 5% polyacrylamide gel using the same pipet tip. Run electrophoresis and stain with ethidium bromide. Lanes with staining at 221 base pairs are positive. 18. Each run should include negative and positive controls. The positive control is made by diluting a positive serum with a known amount of hepatitis B virus (determined using dot blot hybridization) using a negative serum. The concentration of the positive control should be about 1 2 molecules of HBV DNA (the author used the equivalent of about g HBV DNA) per 10 L. 19. The above steps are also run using the core protein-coding region primers by substituting PCR mix 1 2 in step 9 with PCR mix 5 6 and PCR mix 3 4 in step 13 with PCR mix 7 8. In step 17, lanes with staining at 131 or 137 base pairs are positive. 20. One way of controlling for the absence of PCR inhibitors in each specimen is to run a positive control for each specimen by spiking it with a known positive serum. References 1. Galibert, F., Mandart, E., Fitoussi, F., Tiollais, P., and Charnay, P. (1979) Nucleotide sequence of the hepatitis B virus genome (subtype ayw) cloned in E. coli. Nature 281, Pasek, M., Goto, T., Gilbert, W., et. al. (1979) Hepatitis B virus genes and their expression in E. coli. Nature 282, Valenzuela, P., Gray, P., Quiroga, M., Zaldivar, J., Goodman, H. M., and Rutter, W. J. (1979) Nucleotide sequence of the gene coding for the major protein of hepatitis B virus surface antigen. Nature 280,
6 20 Chung 4. Valenzuela, P., Quiroga, M., Zalvidar, J., Gray, P., Rutter, W. J. (1980) The nucleotide sequence of the hepatitis B viral genome and the identification of the major viral genes. In: Fields, B.N., Jaenisch, R. (eds.) Animal Virus Genetics, Ono, Y., Onda, H., Sasada, R., Igarashi, K., Sugino, Y., and Nishioka, K. (1983) The complete nucleotide sequences of the cloned hepatitis B virus DNA: subtype adr and adw. Nucleic Acids Res. 11, Fujiyama, A., Miyanohara, A., Nozaki, C., Yoneyama, T., Ohtomo, N., and Matsubara, K. (1983) Cloning and structural analyses of hepatitis B virus DNAs, subtype adr. Nucleic Acids Res. 11, Pumpen, P. P., Kozlovskaya, T. M., Borisova, G. L., et al. (1984) Synthesis of the surface antigen of hepatitis B virus in Escherichia coli. Dokl. Biochem. Sect. 271, Kobayashi, M., and Koike, K. (1984) Complete nucleotide sequence of hepatitis B virus DNA of subtype adr and its conserved gene organization. Gene 30, Bichko, V., Dreilina, D., Pushko, P., Pumpen, P., and Gren, E. (1985) Subtype ayw variant of hepatitis B virus. FEBS Lett. 185, Lo, S. J., Chen, M.-L., Chien, M.-L., and Lee, Y.-H.W. (1986) Characteristics of pre-s2 region of hepatitis B virus. Biochem. Biophys. Res. Commun. 135, Chung, H.T., Lai, C.L., and Lok, A.S.F. (1989) Hepatitis B virus has an etiological role in the pathogenesis of cirrhosis in patients positive for anti-hbs or anti-hbc. Hepatology 10, Chung, H.T., Lok, A.S.F., and Lai, C.L. (1993) Re-evaluation of alpha-interferon treatment of chronic hepatitis B using polymerase chain reaction. J. Hepatol. 17, Chung, H.T., Lee, J.S.K, and Lok, A.S.F. (1993) Prevention of post-transfusion hepatitis B and C by screening for antibody to hepatitis C virus and antibody to hepatitis B core antigen. Hepatology 18, Chung, H.T., Lai, C.L., and Lok, A.S.F. (1995) Pathogenic role of hepatitis B virus in hepatitis B surface antigen negative cirrhosis. Hepatology 22,
7
HBV Quantitative Real Time PCR Kit
Revision No.: ZJ0002 Issue Date: Aug 7 th, 2008 HBV Quantitative Real Time PCR Kit Cat. No.: HD-0002-01 For Use with LightCycler 1.0/LightCycler2.0/LightCycler480 (Roche) Real Time PCR Systems (Pls ignore
Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products
Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B
The Techniques of Molecular Biology: Forensic DNA Fingerprinting
Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins
VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10
Topic J10+11: Molecular-biological methods + Clinical virology I (hepatitis A, B & C, HIV) To study: PCR, ELISA, your own notes from serology reactions Task J10/1: DNA isolation of the etiological agent
Reverse Transcription System
TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/
Southern Blot Analysis (from Baker lab, university of Florida)
Southern Blot Analysis (from Baker lab, university of Florida) DNA Prep Prepare DNA via your favorite method. You may find a protocol under Mini Yeast Genomic Prep. Restriction Digest 1.Digest DNA with
UltraClean PCR Clean-Up Kit
UltraClean PCR Clean-Up Kit Catalog No. Quantity 12500-50 50 Preps 12500-100 100 Preps 12500-250 250 Preps Instruction Manual Please recycle Version: 02212013 1 Table of Contents Introduction... 3 Protocol
UltraClean Forensic DNA Isolation Kit (Single Prep Format)
UltraClean Forensic DNA Isolation Kit (Single Prep Format) Catalog No. Quantity 14000-10 10 preps 14000-S 1 prep Instruction Manual Please recycle Version: 10302012 1 Table of Contents Introduction...
GENOTYPING ASSAYS AT ZIRC
GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)
UltraClean Soil DNA Isolation Kit
PAGE 1 UltraClean Soil DNA Isolation Kit Catalog # 12800-50 50 preps New improved PCR inhibitor removal solution (IRS) included Instruction Manual (New Alternative Protocol maximizes yields) Introduction
Classic Immunoprecipitation
292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.
PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System)
1/12 Dideoxy DNA Sequencing
1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide
Hepatitis B Virus Genemer Mix
Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For
Genomic DNA Extraction Kit INSTRUCTION MANUAL
Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview
PowerFecal DNA Isolation Kit
PowerFecal DNA Isolation Kit Catalog No. Quantity 12830-50 50 Preps Instruction Manual Inhibitor Removal Technology (IRT) is a registered trademark of MO BIO Laboratories, Inc. and is covered by the following
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR)
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR) [email protected] Av/ Puerta de Hierro s/n. 28040 Madrid. Tel: (34) 913944082
Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
RT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual
Toll Free: 866-252-7771 752A Lincoln Blvd. Phone: 732-469-7771 Fax: 732-469-7782 Middlesex, NJ 08846 Web: www.purebiotechllc.com SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual Product: SOLIDscript
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides
Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Polyacrylamide gel electrophoresis (PAGE) and subsequent analyses are common tools in biochemistry and molecular biology. This Application
Taq98 Hot Start 2X Master Mix
Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 [email protected]
Crime Scenes and Genes
Glossary Agarose Biotechnology Cell Chromosome DNA (deoxyribonucleic acid) Electrophoresis Gene Micro-pipette Mutation Nucleotide Nucleus PCR (Polymerase chain reaction) Primer STR (short tandem repeats)
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
RealLine HCV PCR Qualitative - Uni-Format
Instructions for use PCR KIT FOR EXTRACTION OF RNA AND REAL TIME PCR DETECTION KIT FOR HEPATITIS C VIRUS RNA Research Use Only Qualitative Uni Format VBD0798 48 tests valid from: December 2013 Rev11122013
Cloning GFP into Mammalian cells
Protocol for Cloning GFP into Mammalian cells Studiepraktik 2013 Molecular Biology and Molecular Medicine Aarhus University Produced by the instructors: Tobias Holm Bønnelykke, Rikke Mouridsen, Steffan
Agencourt RNAdvance Blood Kit for Free Circulating DNA and mirna/rna Isolation from 200-300μL of Plasma and Serum
SUPPLEMENTAL PROTOCOL WHITE PAPER Agencourt RNAdvance Blood Kit for Free Circulating DNA and mirna/rna Isolation from 200-300μL of Plasma and Serum Bee Na Lee, Ph.D., Beckman Coulter Life Sciences Process
How To Make A Tri Reagent
TRI Reagent For processing tissues, cells cultured in monolayer or cell pellets Catalog Number T9424 Store at room temperature. TECHNICAL BULLETIN Product Description TRI Reagent is a quick and convenient
The Biotechnology Education Company
EDVTEK P.. Box 1232 West Bethesda, MD 20827-1232 The Biotechnology 106 EDV-Kit # Principles of DNA Sequencing Experiment bjective: The objective of this experiment is to develop an understanding of DNA
ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas
ExpressArt Bacterial H-TR cdna synthesis kit With extreme selectivity against rrnas suitable for 2 to 4 µg total RNA Catalogue No. 8004-A30 (30 rxns) Reagents Materials are provided for 30 cdna synthesis
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280.
Technical Bulletin Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280. PRINTED IN USA. Revised 4/06 AF9TB141 0406TB141 Wizard DNA Clean-Up System All technical literature is available on
LAB 11 PLASMID DNA MINIPREP
LAB 11 PLASMID DNA MINIPREP STUDENT GUIDE GOAL The objective of this lab is to perform extraction of plasmid DNA and analyze the results. OBJECTIVES After completion, the student should be able to: 1.
Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes
Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes 1. Aim and field of application The present method concerns the identification
A STUDY ON THE EFFECTIVENESS OF PEER TUTORING AS A TEACHING METHOD IN HIGH SCHOOL BIOTECHNOLOGY LABS. June Camerlengo. Santa Fe High School
A STUDY ON THE EFFECTIVENESS OF PEER TUTORING AS A TEACHING METHOD IN HIGH SCHOOL BIOTECHNOLOGY LABS. 1 June Camerlengo Santa Fe High School A STUDY ON THE EFFECTIVENESS OF PEER TUTORING AS A TEACHING
ab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
NimbleGen DNA Methylation Microarrays and Services
NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the
50 g 650 L. *Average yields will vary depending upon a number of factors including type of phage, growth conditions used and developmental stage.
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] Phage DNA Isolation Kit Product # 46800, 46850 Product Insert
RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl
Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl
Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR
Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR BioTechniques 25:415-419 (September 1998) ABSTRACT The determination of unknown DNA sequences around
DNA: A Person s Ultimate Fingerprint
A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)
AxyPrep TM Mag PCR Clean-up Protocol
AxyPrep TM Mag PCR Clean-up Protocol Intro The AxyPrep Mag PCR Clean-up kit utilizes a unique paramagnetic bead technology for rapid, high-throughput purification of PCR amplicons. Using this kit, PCR
Plant Genomic DNA Extraction using CTAB
Plant Genomic DNA Extraction using CTAB Introduction The search for a more efficient means of extracting DNA of both higher quality and yield has lead to the development of a variety of protocols, however
IMBB 2013. Genomic DNA purifica8on
IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),
Electrophoresis and Electroblotting of Proteins
Electrophoresis and Electroblotting of Proteins The purpose of the next lab exercises will be to study the relative amounts of β-actin in cells of the B-16 melanoma, liver and muscle of mice. Electrophoresis
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
DNA quality: electrophoresis, spectrophotometry and fluorometry
DNA quality: electrophoresis, spectrophotometry and fluorometry Ambika B Gaikwad [email protected] After isolation of DNA, quantification and analysis of quality are necessary to ascertain the approximate
Electrophoresis, cleaning up on spin-columns, labeling of PCR products and preparation extended products for sequencing
Electrophoresis, cleaning up on spin-columns, labeling of PCR products and preparation extended products for sequencing PAGE electrophoresis Polyacrylamide gel electrophoresis (PAGE) is used for separating
Transformation Protocol
To make Glycerol Stocks of Plasmids ** To be done in the hood and use RNase/DNase free tips** 1. In a 10 ml sterile tube add 3 ml autoclaved LB broth and 1.5 ul antibiotic (@ 100 ug/ul) or 3 ul antibiotic
User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
DNA SPOOLING 1 ISOLATION OF DNA FROM ONION
DNA SPOOLING 1 ISOLATION OF DNA FROM ONION INTRODUCTION This laboratory protocol will demonstrate several basic steps required for isolation of chromosomal DNA from cells. To extract the chromosomal DNA,
Terra PCR Direct Polymerase Mix User Manual
Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain
ISOLATE II PCR and Gel Kit. Product Manual
ISOLATE II PCR and Gel Kit Product Manual 2 Product Manual www.bioline.com/isolate PCR and Gel Kit ISOLATE II PCR and Gel Kit ISOLATE II PCR and Gel Kit 1 Kit contents 04 2 Description 04 3 Storage 04
TIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
ELUTION OF DNA FROM AGAROSE GELS
ELUTION OF DNA FROM AGAROSE GELS OBTECTIVE: To isolate specific bands or regions of agarose-separated DNA for use in subsequent experiments and/or procedures. INTRODUCTION: It is sometimes necessary to
Aurora Forensic Sample Clean-up Protocol
Aurora Forensic Sample Clean-up Protocol 106-0008-BA-D 2015 Boreal Genomics, Inc. All rights reserved. All trademarks are property of their owners. http://www.borealgenomics.com [email protected]
Chromatin Immunoprecipitation (ChIP)
Chromatin Immunoprecipitation (ChIP) Day 1 A) DNA shearing 1. Samples Dissect tissue (One Mouse OBs) of interest and transfer to an eppendorf containing 0.5 ml of dissecting media (on ice) or PBS but without
Lab 5: DNA Fingerprinting
Lab 5: DNA Fingerprinting You are about to perform a procedure known as DNA fingerprinting. The data obtained may allow you to determine if the samples of DNA that you will be provided with are from the
Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.
Unzipping Genes MBPCR014 Beta-Thalassemia Detection Kit P r o d u c t I n f o r m a t i o n Description: Thalassemia is a group of genetic disorders characterized by quantitative defects in globin chain
Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a
Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a Ryan S. Stowers, 1 Jacqueline A. Callihan, 2 James D. Bryers 2 1 Department of Bioengineering, Clemson University, Clemson,
mircute mirna qpcr Detection Kit (SYBR Green)
mircute mirna qpcr Detection Kit (SYBR Green) For detection of mirna using real-time RT-PCR (SYBR Green I) www.tiangen.com QP110302 mircute mirna qpcr Detection Kit (SYBR Green) Kit Contents Cat. no. FP401
BacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
Path-ID Multiplex One-Step RT-PCR Kit
USER GUIDE Path-ID Multiplex One-Step RT-PCR Kit TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets Catalog Numbers 4428206, 4428207, 4440022 Publication Part Number 4440907
PicoMaxx High Fidelity PCR System
PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED
RAGE. Plugs for RAGE/PFGE
1 RAGE Rotating Field Gel Electrophoresis (RAGE) is a variation on Pulsed Field Gel Electrophoresis (PFGE) and gives similar results. We use equipment that was only briefly marketed by Stratagene, at far
DNA and Forensic Science
DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief
Running protein gels and detection of proteins
Running protein gels and detection of proteins 1. Protein concentration determination using the BIO RAD reagent This assay uses a colour change reaction to give a direct measurement of protein concentration.
Blood Collection and Processing SOP
Brisbane Breast Bank Blood Collection and Processing SOP Breast Pathology Laboratory University of Queensland Centre for Clinical Research Blood Collection We collect 30ml of blood from patients who have
Western Blotting. Prepare samples:
Western Blotting Sive Lab Protocol March 2007 Prepare samples: For zebrafish embryos: Option 1: Take live embryos and put into 1.5 ml tube with E3. Centrifuge gently for 1-2 minutes -yolk lipids will rise
Real-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
RNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr)
RNA Extraction and Quantification, Reverse Transcription, and Real-time Preparation of Samples Cells: o Remove media and wash cells 2X with cold PBS. (2 ml for 6 well plate or 3 ml for 6cm plate) Keep
JIANGSU CARTMAY INDUSTRIAL CO.,LTD www.labfurniture.asia mail: [email protected]
The basic layout, the main functions and instrumentation concept of micro Inspection Division laboratory, 1, Virology Laboratory 1. Functions: for the city to monitor the prevalence of HIV disease, dealing
Application Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
GENOME RUSSIA PROJECT BLOOD SAMPLES COLLECTION, DNA EXTRACTION AND DNA QUALITY CONTROL PROTOCOLS
ST-PETERSBURG STATE UNIVERSITY THEODOSIUS DOBZHANSKY CENTER FOR GENOME BIOINFORMATICS GENOME RUSSIA PROJECT BLOOD SAMPLES COLLECTION, DNA EXTRACTION AND DNA QUALITY CONTROL PROTOCOLS 2015 The object of
RealStar HBV PCR Kit 1.0 11/2012
RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 For research use only! (RUO) Product No.: 201003 96 rxns INS-201000-GB-02 Store at -25 C... -15 C November 2012 altona Diagnostics GmbH Mörkenstraße
DNA Isolation Kit for Cells and Tissues
DNA Isolation Kit for Cells and Tissues for 10 isolations of 00 mg each for tissue or 5 x 10 7 cultured cells Cat. No. 11 81 770 001 Principle Starting material Application Time required Results Benefits
Objectives: Vocabulary:
Introduction to Agarose Gel Electrophoresis: A Precursor to Cornell Institute for Biology Teacher s lab Author: Jennifer Weiser and Laura Austen Date Created: 2010 Subject: Molecular Biology and Genetics
Olympic B3 Summer Science Camp 2015 Weller, Smith, Putnam L3
Chestnut Leaf DNA Extraction Protocol Introduction: we will extract the nucleic acid from leaf tissue by grinding it in a reducing medium (the beta-mercaptoethanol chemical is a reducing agent, it smells
MagExtractor -Genome-
Instruction manual MagExtractor-Genome-0810 F0981K MagExtractor -Genome- NPK-101 100 preparations Store at 4 C Contents [1] Introduction [2] Components [3] Materials required [4] Protocol 1. Purification
Viral Safety of Plasma-Derived Products
Viral Safety of Plasma-Derived Products SLIDE 1 This presentation will cover viral validation studies for plasma-derived products. FDA requires that the manufacturing process for biopharmaceutical products
CompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
PrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
Chromatin Immunoprecipitation
Chromatin Immunoprecipitation A) Prepare a yeast culture (see the Galactose Induction Protocol for details). 1) Start a small culture (e.g. 2 ml) in YEPD or selective media from a single colony. 2) Spin
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
Analysis of the DNA Methylation Patterns at the BRCA1 CpG Island
Analysis of the DNA Methylation Patterns at the BRCA1 CpG Island Frédérique Magdinier 1 and Robert Dante 2 1 Laboratory of Molecular Biology of the Cell, Ecole Normale Superieure, Lyon, France 2 Laboratory
PCR Optimization. Table of Contents Fall 2012
Table of Contents Optimizing the Polymerase Chain Reaction Introduction.....1 Review of Mathematics........ 3 Solving Problems of Dilution and Concentration: Two Approaches.. 4 Experiment Overview 7 Calculations
Guide to using the Bio Rad CFX96 Real Time PCR Machine
Guide to using the Bio Rad CFX96 Real Time PCR Machine Kyle Dobbs and Peter Hansen Table of Contents Overview..3 Setup Reaction Guidelines 4 Starting up the Software 5 Setup Protocol on Software 6 Setup
Denaturing Gradient Gel Electrophoresis (DGGE)
Laboratory for Microbial Ecology Department of Earth, Ecological and Environmental Sciences University of Toledo Denaturing Gradient Gel Electrophoresis (DGGE) Background information Denaturing gradient
Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform
Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 2 Sample Prep Workflow, 3 Best Practices, 4 DNA Input Recommendations, 6
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
ELISA BIO 110 Lab 1. Immunity and Disease
ELISA BIO 110 Lab 1 Immunity and Disease Introduction The principal role of the mammalian immune response is to contain infectious disease agents. This response is mediated by several cellular and molecular
HBV PCR detection Kit USER MANUAL
For professional use only HBV PCR detection Kit (PREP-NA DNA/RNA Extraction Kit included) USER MANUAL "DNA-Technology, Research & Production" LLC Russia, 142281, Moscow Region, Protvino, 2 Zheleznodorozhnaya
Troubleshooting for PCR and multiplex PCR
Page 1 of 5 Page designed and maintained by Octavian Henegariu (Email: Tavi's Yale email or Tavi's Yahoo email). As I am currently pursuing a new junior faculty position, the Yale URL and email may change
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
Mouse Creatine Kinase MB isoenzyme (CKMB) ELISA
KAMIYA BIOMEDICAL COMPANY Mouse Creatine Kinase MB isoenzyme (CKMB) ELISA For the quantitative determination of mouse CKMB in serum, plasma, cell culture fluid and other biological fluids Cat. No. KT-57681
