New Genetic Testing in Pregnancy

Transcription

1 Oklahoma Academy of Family Physicians New Genetic Testing in Pregnancy J. Stephen Jones. MD Maternal Fetal Medicine Saint Francis Tulsa Oklahoma 16 June,

2 Prenatal Testing for Fetal Aneuploidy Noninvasive Prenatal Testing for Fetal Aneuploidy (NIPT) Cell Free Fetal DNA Testing (CffDNA) 2

3 Prenatal Testing for Fetal Aneuploidy Significant patient population 5 M pregnancies every year in the U.S. Majority of women undergo prenatal testing today (>70%) 1,2 ACOG guidelines for universal prenatal testing published in Current options have limitations Blood tests and ultrasound lack specificity 4 Invasive testing poses risk of fetal loss 5 1. American Pregnancy Association, ; 2. Frost and Sullivan, Strategic Analysis of the U.S. Prenatal Testing Market, N940-55, 2011.; 3. ACOG Practice Bulletin, Screening for fetal chromosomal abnormalities. Obstet Gynecol. 2007;109: ; 4. Ibid, ACOG Practice Bulletin 2007.; 5. ACOG Practice Bulletin, Invasive prenatal testing for aneuploidy. Obstet Gynecol. 2007; 110:

4 The Case for Widespread Prenatal Testing Majority of babies born with Down syndrome are in women under 35 years old 2007 Universal Screening Guidelines Source: Provider handbook for The California Prenatal Screening Program 4

5 Conventional Prenatal Testing Options Screening Assesses risk for trisomy 21 and trisomy 18/13 1 st trimester serum markers and/or nuchal translucency 2 nd trimester serum markers Risk score for T21, T18 Detection: 70-92% 1 False positive 5% 2 ~3M screenings tests/yr 3 Diagnosis Can detect wide array of genetic conditions Invasive procedures 1 st trimester chorionic villus sampling 2 nd trimester amniocentesis Gold standard for trisomy diagnosis Risk of fetal loss 1 in 400 to 1 in ~200,000 procedures/yr 1. ACOG Practice Bulletin, Screening for fetal chromosomal abnormalities. Obstet Gynecol. 2007;109: ;2. Ibid, ACOG Practice Bulletin 2007.; 3. Frost and Sullivan, Strategic Analysis of the U.S. Prenatal Testing Market, N940-55, ; 4. ACOG Practice Bulletin, Invasive prenatal testing for aneuploidy. Obstet Gynecol. 2007; 110:

6 Potential Limitations of Current Testing High false positives Screening tests may have up to a 5% false positive rate 1 potentially creating anxiety for many women every year. Convenience Current screening tests may require multiple visits and specialized ultrasound, and may limit access. Timeline Current screening tests that provide highest detection are not complete until the second trimester, extending the timeline for results. Safety concerns Many women decline invasive procedures (CVS, amnio) because of risk concerns. 1 Strategic Analysis of the U.S. Prenatal Testing Market: Increasing Maternal Age, Improved Screening Algorithms, and Maturation of Noninvasive Prenatal Diagnostics, May 2011, page 42 6

7 Prevalence of Trisomies 21, 18, 13 Trisomy Type Condition Name Frequency Chromosome 21 Down syndrome 1 in 750 live births Chromosome 18 Edwards syndrome 1 in 3,000-6,000 live births Chromosome 13 Patau syndrome 1 in 16,000 live births U.S. National Library of Medicine. Genetics Home Reference. Down Syndrome. Trisomy Trisomy Accessed July 12,

8 Cell-free DNA in Maternal Blood Cell-free DNA (cfdna) are short DNA fragments In pregnancy, cfdna from both the mom and fetus are in maternal blood Amount of fetal cfdna present is a small fraction of the maternal cfdna 8

9 Principles of Fetal Trisomy Testing From a Maternal Blood Sample Using DNA Sequencing ~10% of the DNA fragments in a pregnant woman s blood are from the fetus ( ) ~90% are from the mother ( ) Schematic of DNA Fragments Isolated From Maternal Plasma Containing Maternal DNA and Euploid Fetal DNA Schematic of DNA Fragments Isolated From Maternal Plasma Containing Maternal DNA, Fetal DNA and Extra Fragments of Chromosome 21, 18 or 13 Contributed by a Fetal Trisomy 21, 18 or 13 Euploid Fetus Fetus with Trisomy 21, 18 or 13

10 Fetal Trisomy Detection With cfdna Fetal cfdna Extra fragments derived from fetal trisomy 21 Maternal cfdna Reference chromosome Chromosome 21 fragments Each bar represents thousands of cfdna fragments The overabundance of chromosome 21 cfdna fragments in trisomy 21, although small, can be measured with DNA sequencing 10

11 Principles of Fetal Trisomy 21 Testing From a Maternal Blood Sample Using DNA Sequencing The total number of ccf-fetal fragments vs. ccf-maternal fragments of any one chromosome is proportional to the size of the chromosome, and is consistent from sample to sample, and patient to patient. Sequencing tells you which chromosome the combined maternal and fetal fragments come from. Chromosome 1 Chromosome 21

12 Principles of Fetal Trisomy Testing From a Maternal Blood Sample Using DNA Sequencing Sequencing tells you which chromosome the ccf fragment comes from. TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr21 chr10 chr14 chr10 chr21 chr10 chr10 chr10 chr21 chr14 chr10 chr21 chr10 chr10 chr14 chr X Y

13 Cell Free Fetal DNA Performance Detection Rate False Positive Rate T21 (99-100%) 0-2% T18 (84-100%) 0-2% T13 (44-100%) 0-6% 40% 60% 80% 100% Trisomy 21 accuracy appears to be more robust than that for trisomy 18 and trisomy Palomaki GE, Kloza EM, Lambert-Messerlian GM, et al. DNA sequencing of maternal plasma to detect Down syndrome: an international clinical validation study. Genet Med 2011 Nov;13(11): ; 2. Bianchi DW, Platt LD, Goldberg JD, Abuhamad AZ, Sehnert AJ, Rava RP, Genome-Wide Fetal Aneuploidy Detection by Maternal Plasma DNA Sequencing. Obstet Gynecol. [Epub ahead of print] 2012 Feb 22.; 3. Chiu et. Al BMJ 2011;342:c7401 Chen et.al (2011) 13

14 Clinical Study & Publication Overview Study Status Description NICE (Non-Invasive Chromosomal Evaluation) Average Risk (Nicolaides) Ariosa Blinded Nicolaides Blinded Proof of Concept Trisomy 13 Fetal Fraction NICE substudy Fetal Fraction Published Editor s choice in The Gray Journal (August 2012) Published The Gray Journal (2012, avail online) Published Editor s choice in The Gray Journal (April 2012) Published Editor s choice in The Gray Journal (April 2012) Published cover article Prenatal Diagnosis (Jan 2012) Published The White Journal (2012, avail online) Published J Mat Fet Med (2012, avail online) Published Fetal Diagnosis and Therapy (2012) 14 Multi-center (50 sites) clinical validation study, combined high risk and low risk women. Largest NIPT cohort study. Exclusive average-risk study of Harmony test in 1 st trimester pregnancy Blinded study with risk score reporting 1 st trimester blinded study Initial description of directed cfdna approach with combined average-risk and high-risk women Performance for T13 detection with combined average-risk and high-risk women Fetal fraction same in high-risk and low-risk women Fetal fraction correlated to placental mass 14

15 NICE Study Non-Invasive Chromosomal Evaluation (NICE) Study: Results of a Multicenter, Prospective, Cohort Study for Detection of Fetal Trisomy 21 and Trisomy 18 Norton, M., Brar, H., Weiss, J., Karimi, A., Laurent, L.C., Caughey, A., Rodriguez, M.H., Williams III, J., Mitchell, M.E., Adair, C.D, Lee, H., Jacobbson, B., Tomlinson, M.W., Oepkes, D., Hollemon, D., Sparks, A.B., Oliphant, A., Song, K. Published August 2012 in American Journal of Obstetrics and Gynecology Laboratory validation study 15

16 NICE Study Design International multicenter prospective study across 50 clinical sites Cohort study all eligible subjects were analzyed Study Population Singleton pregnancy Gestational age 10 weeks or later Invasive testing for any indication Sensitivity and specificity of Harmony test reported at 1% risk score cut-off 16 Norton, M., Brar, H., Weiss, J., Karimi, A., et al. Non-Invasive Chromosomal Evaluation (NICE) Study: Results of a Multicenter, Prospective, Cohort Study for Detection of Fetal Trisomy 21 and Trisomy 18, Am J Obstet Gynecol. (2012), doi: /j.ajog

17 NICE Study 50 participating clinical sites in U.S. and Europe Largest cohort study to date All eligible subjects evaluated Study population was women undergoing invasive testing for any indication and thus included low risk women Sensitivity Specificity False Positive Rate Trisomy % (81/81) 99.97% (2887/2888) 0.03% (1/2888) Trisomy 18 97% (37/38) 99.93% (2886/2888) 0.07% (2/2888) Norton ME et al. (2012) American Journal of Obstetrics and Gynecology 17

18 Clinical Performance Studied in over 6,000 patients, including >2,000 low-risk women Detection Rate False Positive Rate T21 >99% (214 of 214) <0.1% T18 >98% (103 of 105) <0.1% T13 8 of 10 detected with Harmony <0.1% 1. Sparks, A.B., Struble, C.A., Wang, E.T., Song, K., Oliphant, A., Non-invasive Prenatal Detection and Selective Analysis of Cell-free DNA Obtained from Maternal Blood: Evaluation for Trisomy 21 and Trisomy 18, Am J Obstet Gynecol. (2012), doi: /j.ajog ; 2. Ashoor, G., Syngelaki, A., Wagner, M., Birdir, C., Nicolaides, K.H., Chromosome-selective sequencing of maternal plasma cell-free DNA for first trimester detection of trisomy 21 and trisomy 18, Am J Obstet Gynecol. (2012), doi: /j.ajog ; 3. Sparks, A.B., Wang, E.T., Struble, C.A., Barrett, W., et al, Selective analysis of cell-free DNA 18 in maternal blood for evaluation of fetal trisomy. Prenat Diagn (2012);32(1):3-9. doi: /pd Epub 2012 Jan 6.; 4. Norton, M., Brar, H., Weiss, J., Karimi, A., et al. Non-Invasive Chromosomal Evaluation (NICE) Study: Results of a Multicenter, Prospective, Cohort Study for Detection of Fetal Trisomy 21 and Trisomy 18, Am J Obstet Gynecol. (2012), doi: /j.ajog ; 5. Nicolaides KH, Syngelaki A, Ashoor G, et al. Noninvasive prenatal testing for fetal trisomies in a routinely screened first-trimester population. Am J Obstet Gynecol (2012);207:x.ex-x.ex.; 6. Ashoor G, Syngelaki A, Nicolaides KH, et al. Trisomy 13 detection in the first trimester of pregnancy using a chromosome-selective cell-free DNA analysis method, ULTRASOUND Obstet Gynecol. (2012), DOI: /uog

19 Screening Options for T21, T18 and T13 AFP4 (Quad) Sensitivity for T21 is 81% False Positive is 5% Sensitivity for T18 is 80% False Positive is 5% Does not calculate a T13 Performed between weeks List price is $304 First Trimester with Nasal Bone ** NTD Laboratories Sensitivity for T21 is 95% False Positive is 2% Sensitivity for T18 is 95% False Positive is 0.3% Sensitivity for T13 is 95% False Positive is 0.3% **ACOG Practice Bulletin 77 Sensitivity for T % False Positive is 5% Harmony Sensitivity for T21 is greater than 99% False positive is 0.1% Sensitivity for T18 is greater than 98% False positive is 0.1% Sensitivity for T13 is 80% False Positive is 0.1% Performed 10 weeks throughout pregnancy List Price is $795 MaterniT21 Plus Sensitivity for T21 is 99.1% False Positive is 0.1% Sensitivity for T18 is greater than 99.9% False Positive is 0.4% Sensitivity for T13 is 91.7% False Positive is 0.3% Y Chromosome accuracy is 99.4% Performed 10 weeks throughout pregnancy List Price is $1500 Performed between weeks List Price is $160

20 Importance of Low False Positive Rate The less common a genetic condition, the more important it is to have a low false positive rate Example: Delivery service with 5,000 births/yr # of true trisomies # of false positives (at below false positive rates) 1% 0.5% 0.1% T21 (1 in 740) T18 (1 in 5,000) T13 (1 in 16,000)

21 Educational Tool for Patients English and Spanish language versions available Education about trisomy detection, the test and suggested follow-up if a result comes back low risk or high risk 21 21

22 Who do we Screen? Any woman who desires information regarding her baby Discuss screening options for all pregnancies -- 50% of all Trisomy 21 fetuses have no abnormal U/S findings -- 50% of all Trisomy 21 fetuses have a congenital heart defect Genetic Screening should be offered in a PRO pregnancy format 22