Goals for Today. Clinical and Molecular Aspects of Genetic Hearing Loss. Case presentation. Case presentation continued. Case presentation continued

Transcription

1 Clinical and Molecular Aspects of Genetic Hearing Loss Kathleen Arnos, PhD Department of Science, Technology, & Mathematics Gallaudet University Washington, DC Goals for Today Describe the role of genetic factors as a cause of hearing loss in infants and school-aged children. Provide an update on modes of inheritance and molecular mechanisms of genetic forms of hearing loss. Discuss the impact of genetic testing on clinical diagnosis of cause of hearing loss. Discuss the referral process and how to talk to parents about the benefits of and procedures for genetic evaluation and counseling. JD is a healthy 2 month old Caucasian female, product of a normal pregnancy and delivery. Case presentation Newborn hearing screening by OAE at day 2 of life indicated a possible hearing loss. Follow-up testing by diagnostic ABR at 1 month Figure from Betsy Sanford, MCD, CCC-A of age confirmed at least a moderate to severe, bilateral, sensorineural hearing loss. Case presentation continued JD was born at 38.5 weeks gestational age. Birth weight was 3.2 kilos (7.05 pounds). JD has no history of ototoxic medications, asphyxia, hyperbilirubinemia, or infection. TORCH titers are negative. JD s mother has just asked you why her daughter is deaf. Case presentation continued According to JD s parents, there is no other family history of hearing loss. A referral for genetic evaluation and counseling is appropriate for this child. The referring professional explains to the parents what they can expect to happen during a genetics evaluation. Genetic Evaluation Family history Medical history Physical examination by a genetics physician Genetic testing, if appropriate This evaluation will help to determine if there are or will be other physical or medical characteristics associated with the hearing loss. 1

2 Physical Examination rule out specific causes of hearing loss search for evidence of a genetic syndrome associated with hearing loss determine the general health status examinations of several family members Preauricular pit. ( Sellars, S, Beighton, P. (1983). The Waardenburg syndrome in deaf children in southern Africa. 63: Measure a (inner canthal distance), b (interpupillary distance) and c (outer canthal distance) in millimeters. The measurement a in the second set of eyes indicates dystopia canthorum, an increased inner canthal distance, seen in Waardenburg syndrome, Type 1. Plantar hyperkeratosis. Goiter from: square.umin.ac.jp/~massie-tmd/ goiter.jpg 2

3 Case presentation, continued JD has no additional clinical findings, dysmorphic features or syndromic stigmata. There is no family history of hearing loss. JD s parents both have normal hearing. The geneticist recommends genetic testing for common genes for deafness. Navy Medical Center, Department of Oral and Maxillofacial Pathology. ( How can a genetic test help this family? Informative genetic test results can provide: Precise diagnosis Precise genetic counseling Carrier/diagnostic testing of at risk relatives Early diagnosis and intervention for affected relatives Improved management of patients and families (in this family, genetic testing may eliminate the need for additional medical testing to rule out genetic syndromes) Testing for Genes for Deafness Research versus clinical testing Genetic counselors can explain: the type of sample needed the cost of the test turn-around time for results if research, are results given to families? implications for other family members When to refer? When to refer? It wasn't until my second son was born that genetic testing was available to me... I believe if I had had more information about deafness earlier in my children's lives, I would have been better at advocating for them in the sense that I would have some knowledge, less ambiguity, and therefore more authority where they are concerned. - mother of 2 deaf children I think genetic evaluation is part of the healing process... When your child is first diagnosed, you are in denial, however, if you get enough information, follow-up and resources it helps solidify things. After genetic testing, it was very clear how my baby became deaf. Ok we found this out now what? - mother of a deaf child 3

4 Genetic Deafness Genetic factors account for 50-60% of congenital and early-onset deafness. Autosomal dominant (20%) Autosomal recessive (75-80%) X-linked recessive (1-2%) Mitochondrial (1-20%) Genetic Heterogeneity There are more than 400 types of genetic hearing loss. Syndromic versus non-syndromic hearing loss Konigsmark s Classifications of Genetic Hearing Loss No associated abnormalities External ear abnormalities Eye disease Musculoskeletal disease Integumentary system disease Renal disease Nervous system disease Metabolic and other abnormalities *Toriello, Reardon & Gorlin (2004). Hereditary Hearing Loss and Its Syndromes. New York: Oxford University Press. Numbering of Chromosome Bands Karyotype of a human male 46, XY. Courtesy of Colleen Jackson-Cook, Cytogenetics Laboratory, Department of Human Genetics, Medical College of Virginia. From: Eugene Pergament, MD, PhD, Northwestern University Medical School, Chicago, and Morry Fiddler, PhD, School for New Learning, DePaul University, Chicago. 4

5 DNA Gene Chromosome Genome National Cancer Institute: Understanding Gene Testing A typical page of the human instruction book GAAATAATTAATGTTTTCCTTCCTTCTCCTATTTTGTCCTTTACTTCAATTTATTTATTTATTATTAATATTATTATTTTTTGAGACGGAG TTTCACTCTTGTTGCCAACCTGGAGTGCAGTGGCGTGATCTCAGCTCACTGCACACTCCGCTTTCTGGTTTCAAGCGATTCTCCTGCCTCA GCCTCCTGAGTAGCTGGGACTACAGTCACACACCACCACGCCCGGCTAATTTTTGTATTTTTAGTAGAGTTGGGGTTTCACCATGTTGGCC AGACTGGTCTCGAACTCCTGACCTTGTGATCCGCCAGCCTCTGCCTCCCAAAGAGCTGGGATTACAGGCGTGAGCCACCGCGCTCGGCCCT TTGCATCAATTTCTACAGCTTGTTTTCTTTGCCTGGACTTTACAAGTCTTACCTTGTTCTGCCTTCAGATATTTGTGTGGTCTCATTCTGG TGTGCCAGTAGCTAAAAATCCATGATTTGCTCTCATCCCACTCCTGTTGTTCATCTCCTCTTATCTGGGGTCACATATCTCTTCGTGATTG CATTCTGATCCCCAGTACTTAGCATGTGCGTAACAACTCTGCCTCTGCTTTCCCAGGCTGTTGATGGGGTGCTGTTCATGCCTCAGAAAAA TGCATTGTAAGTTAAATTATTAAAGATTTTAAATATAGGAAAAAAGTAAGCAAACATAAGGAACAAAAAGGAAAGAACATGTATTCTAATC CATTATTTATTATACAATTAAGAAATTTGGAAACTTTAGATTACACTGCTTTTAGAGATGGAGATGTAGTAAGTCTTTTACTCTTTACAAA ATACATGTGTTAGCAATTTTGGGAAGAATAGTAACTCACCCGAACAGTGTAATGTGAATATGTCACTTACTAGAGGAAAGAAGGCACTTGA AAAACATCTCTAAACCGTATAAAAACAATTACATCATAATGATGAAAACCCAAGGAATTTTTTTAGAAAACATTACCAGGGCTAATAACAA AGTAGAGCCACATGTCATTTATCTTCCCTTTGTGTCTGTGTGAGAATTCTAGAGTTATATTTGTACATAGCATGGAAAAATGAGAGGCTAG TTTATCAACTAGTTCATTTTTAAAAGTCTAACACATCCTAGGTATAGGTGAACTGTCCTCCTGCCAATGTATTGCACATTTGTGCCCAGAT CCAGCATAGGGTATGTTTGCCATTTACAAACGTTTATGTCTTAAGAGAGGAAATATGAAGAGCAAAACAGTGCATGCTGGAGAGAGAAAGC TGATACAAATATAAATGAAACAATAATTGGAAAAATTGAGAAACTACTCATTTTCTAAATTACTCATGTATTTTCCTAGAATTTAAGTCTT TTAATTTTTGATAAATCCCAATGTGAGACAAGATAAGTATTAGTGATGGTATGAGTAATTAATATCTGTTATATAATATTCATTTTCATAG TGGAAGAAATAAAATAAAGGTTGTGATGATTGTTGATTATTTTTTCTAGAGGGGTTGTCAGGGAAAGAAATTGCTTTTTTTCATTCTCTCT TTCCACTAAGAAAGTTCAACTATTAATTTAGGCACATACAATAATTACTCCATTCTAAAATGCCAAAAAGGTAATTTAAGAGACTTAAAAC TGAAAAGTTTAAGATAGTCACACTGAACTATATTAAAAAATCCACAGGGTGGTTGGAACTAGGCCTTATATTAAAGAGGCTAAAAATTGCA ATAAGACCACAGGCTTTAAATATGGCTTTAAACTGTGAAAGGTGAAACTAGAATGAATAAAATCCTATAAATTTAAATCAAAAGAAAGAAA CAAACTGAAATTAAAGTTATTATACAAGAATATGGTGGCCTGGATCTAGTGAACATATAGTAAAGATAAAACAGAATATTTCTGAAAAATC CTGGAAAATCTTTTGGGCTAACCTGAAAACAGTATATTTGAAACTATTTTTAAAATGCAGTGATACTAGAAATATTTTAGAATCATATGTA from chromosome 7 Our sequences are not quite all the same. GAAATAATTAATGTTTTCCTTCCTTCTCCTATTTTGTCCTTTACTTCAATTTATTTATTTATTATTAATATTATTATTTTTTGAGACGGAG TTTCACTCTTGTTGCCAACCTGGAGTGCAGTGGCGTGATCTCAGCTCACTGCACACTCCGCTTTCCGGTTTCAAGCGATTCTCCTGCCTCA GCCTCCTGAGTAGCTGGGACTACAGTCACACACCACCACGCCCGGCTAATTTTTGTATTTTTAGTAGAGTTGGGGTTTCACCATGTTGGCC AGACTGGTCTCGAACTCCTGACCTTGTGATCCGCCAGCCTCTGCCTCCCAAAGAGCTGGGATTACAGGCGTGAGCCACCGCGCTCGGCCCT TTGCATCAATTTCTACAGCTTGTTTTCTTTGCCTGGACTTTACAAGTCTTACCTTGTTCTGCCTTCAGATATTTGTGTGGTCTCATTCTGG TGTGCCAGTAGCTAAAAATCCATGATTTGCTCTCATCCCACTCCTGTTGTTCATCTCCTCTTATCTGGGGTCACCTATCTCTTCGTGATTG CATTCTGATCCCCAGTACTTAGCATGTGCGTAACAACTCTGCCTCTGCTTTCCCAGGCTGTTGATGGGGTGCTGTTCATGCCTCAGAAAAA TGCATTGTAAGTTAAATTATTAAAGATTTTAAATATAGGAAAAAAGTAAGCAAACATAAGGAACAAAAAGGAAAGAACATGTATTCTAATC CATTATTTATTATACAATTAAGAAATTTGGAAACTTTAGATTACACTGCTTTTAGAGATGGAGATGTAGTAAGTCTTTTACTCTTTACAAA ATACATGTGTTAGCAATTTTGGGAAGAATAGTAACTCACCCGAACAGTGTAATGTGAATATGTCACTTACTAGAGGAAAGAAGGCACTTGA AAAACATCTCTAAACCGTATAAAAACAATTACATCATAATGATGAAAACCCAAGGAATTTTTTTAGAAAACATTACCAGGGCTAATAACAA AGTAGAGCCACATGTCATTTATCTTCCCTTTGTGTCTGTGTGAGAATTCTAGAGTTATATTTGTACATAGCATGGAAAAATGAGAGGCTAG TTTATCAACTAGTTCATTTTTAAAAGTCTAACACATCCTAGGTATAGGTGAACTGTCCTCCTGCCAATGTATTGCACATTTGTGCCCAGAT CCAGCATAGGGTATGTTTGCCATTTACAAACGTTTATGTCTTAAGAGAGGAAATATGAAGAGCAAAACAGTGCATGCTGGAGAGAGAAAGC TGATACAAATATAAATGAAACAATAATTGGAAAAATTGAGAAACTACTCATTTTCTAAATTACTCATGTATTTTCCTAGAATTTAAGTCTT TTAATTTTTGATAAATCCCAATGTGAGACAAGATAAGTATTAGTGATGGTATGAGTAATTAATATCTGTTATATAATATTCATTTTCATAG TGGAAGAAATAAAATAAAGGTTGTGATGATTGTTGATTATTTTTTCTAGAGGGGTTGTCAGGGAAAGAAATTGCTTTTTTTCATTCTCTCT TTCCACTAAGAAAGTTCAACTATTAATTTAGGCACATACAATAATTACTCCATTCTAAAATGCCAAAAAGGTAATTTAAGAGACTTAAAAC TGAAAAGTTTAAGATAGTCACACTGAACTATATTAAAAAATCCACAGGGTGGTTGGAACTAGGCCTTATATTAAAGAGGCTAAAAATTGCA ATAAGACCACAGGCTTTAAATATGGCTTTAAACTGTGAAAGGTGAAACTAGAATGAATAAAATCCTATAAATTTAAATCAAAAGAAAGAAA CAAACTAAAATTAAAGTTAATATACAAGAATATGGTGGCCTGGATCTAGTGAACATATAGTAAAGATAAAACAGAATATTTCTGAAAAATC CTGGAAAATCTTTTGGGCTAACCTGAAAACAGTATATTTGAAACTATTTTTAAAATGCAGTGATACTAGAAATATTTTAGAATCATATGTA Three variants are present in this sequence 5

6 Pedigree Construction and Analysis The fundamental method of genetic analysis in humans is collecting a family history to follow the inheritance of a trait. Cummings, 2006 Standard Pedigree Information Names or initials Ages or dates of birth Specific details of disorder Age and cause of death Both maternal and paternal information Standard Pedigree Information A minimum of three generations Ethnic background, country of origin, and religious/cultural group Key for any symbols used Indicate who is the proband (or index case, consultand) Common Pedigree Symbols P Male Female Sex unspecified Pregnancy 4 Males d.35 y 4 N N Proband Affected male Adopted female Deceased male Unknown # of Males/females Marriage Siblings 4 th cousins Consanguineous (related) Monozygotic twins (identical twins) Divorced Dizygotic twins (fraternal twins) 6

7 JD s Pedigree Sensorineural Hearing Loss Deaf German Down syndrome English/Scottish Cystic Fibrosis Irish Mexican 3 4 d. teens Mike a. 32 Sarah Stephanie a JD a. 2m Mod-severe SNHL 10 wks 10 wks Cindy a.10 Ellie a.7 Toby a. 3 mos Transmission Genetics Important Terminology Mendelian Inheritance Genotype The specific genetic constitution of an organism; the allele combinations in an individual that cause a particular trait or disorder. Phenotype The observable properties of an organism; the expression of genes in traits or symptoms. Heterogeneity Transmission Genetics - Important Terminology Several different genes result in one phenotype. Example: Deafness Allele Locus Homozygous Heterozygous 7

8 Transmission Genetics - Important Terminology An allele is one of several alternative forms of a gene. For each autosomal gene, an individual has two alleles, one inherited from the father and one from the mother. A wild-type allele is the normal version of the allele. Many genes have several normal versions called polymorphisms. A mutant allele which is associated with a trait or a disorder can also exist in one of several different forms. Autosomal Dominant Inheritance Autosomal Dominant Inheritance D = allele for deafness (mutant allele) d = allele for hearing (wild-type allele) A person can have one of three patterns. Genotype DD = homozygote Dd = heterozygote dd = homozygote Phenotype deaf deaf hearing Male Female Deaf 8

9 Characteristics of Autosomal Dominant (AD) Traits only one copy of an allele is necessary to produce phenotype chance of recurrence is ½ vertical family pattern persons with the trait have a parent with the trait, unless they represent a new mutation male:female = 1:1 male to male transmission can occur Characteristics of Autosomal Dominant (AD) Traits only one copy of an allele is necessary to produce phenotype chance of recurrence is ½ vertical family pattern persons with the trait have a parent with the trait, unless they represent a new mutation male:female = 1:1 male to male transmission can occur Male Female Deaf Dominant Genes Penetrance The percentage of individuals who possess a dominant gene and express it. A trait is incompletely penetrant when not every individual who has the genotype displays the phenotype. Variable Expressivity A genotype producing a phenotype that varies among individuals. Incomplete Penetrance Otosclerosis is another example of a disorder inherited in an autosomal dominant fashion which is incompletely penetrant. The genes for otosclerosis are less than 50% penetrant. 9

10 Variable Expression of Autosomal Dominant Hearing Loss Deaf Hard of Hearing Sellars, S, Beighton, P (1983). The Waardenburg syndrome in deaf children in southern Africa. South African Medical Journal. 63: Autosomal Recessive Inheritance R = allele for hearing (wild-type allele) r = allele for deafness (mutant allele) A person can have one of three patterns: Genotype RR = homozygous Rr = heterozygous rr = homozygous Phenotype hearing hearing deaf Autosomal Recessive Inheritance I II III IV 10

11 I Autosomal Recessive Inheritance Recessive Inheritance II III IV Characteristics of Autosomal Recessive (AR) traits Double dose of the allele is required for the trait to express itself Chance of recurrence ¼ for carrier (heterozygous) parents Horizontal family pattern Male:Female 1:1 Y-linked Inheritance? Genes carried on the Y chromosome are said to be Y-linked Y-linked traits occurs only in males Father to son transmission only Only a few Y-linked traits have been discovered Only one family with Y-linked inheritance of hearing loss has been described 11

12 Y-linked Transmission of Deafness Wang, Q J et al. J Med Genet 2004;41:e80 Subsequent detailed characterization of the DFNY1 Y chromosome and comparison with the Y chromosome from an unaffected branch of the family by CGH showed that the DFNY1 chromosome carries a complex rearrangement, including an insertion of ~ 160 kb of DNA from chromosome 1. This segment of chromosome 1 is derived entirely from within a known deafness locus, DFNA49. Wang et al. Am J Hum Genet 92: , Feb Copyright 2004 BMJ Publishing Group Ltd. Genetic Heterogeneity Gene Mapping and Cloning Autosomal dominant hearing loss tends to be delayed and progressive. Only a few forms of AD hearing loss occur in the 1 st decade of life. Autosomal recessive hearing loss is more likely to be congenital and severe to profound. Gene Mapping - Identification of the approximate or exact location of a gene on a chromosome. Gene Cloning - Characterization of the gene by identification of its base pair components. Mapping and Cloning of Deafness Genes >40 syndromic loci mapped >100 nonsyndromic loci mapped DFNA autosomal dominant (~24 genes cloned) DFNB autosomal recessive (~40 genes cloned) DFNX X-linked recessive (2 genes cloned) DFNM 2 modifier loci mapped AUNA 1 auditory neuropathy loci mapped CX31 KCNQ4 A9 OTOF B9 A37 A7 A16 -q23trma A34 CX26/Cx30 A2/B1 COCH/A9 B6 B15 A18 B25 A6,14 A27 A39 B26 A24 COL11A2 A13 Diaphanous A1, POU4F3 EYA4 A10 A15 DFNA5 PDS B4 B14,B17 B13 A28 A36 B7,B11 B23 A19 CDH3/B12 A32/B18 MYO7A TECTA B20 A25 OTSC otosclerosis, 8 loci mapped (0 cloned) A23 B16 A30 -q12 TBS MYO15/B3 A20/A26 B19 A4 -p12bbs TMPRSS3 B8/10 B29 POU3F4 CLDN14 B29 MYH9 A17 12

13 From Morton & Nance, NEJM 354: Willems, P.J Genetic Causes of Hearing Loss. NEJM, 342(5): Genetics and Auditory Function Genes which control the transport of ions across membranes (homeostasis). Genes which control the structural integrity of the organ of Corti. Genes which have regulatory functions. Willems, P.J Genetic Causes of Hearing Loss. NEJM, 342(5): Genes Involved in Ion Transport GJB2 (DFNB1- Connexin 26) GJB6 (DFNA3 - Connexin 30) GJB3 (DFNA2 - Connexin 31) KVLQT1, KCNE1 (JLN syndrome, DFNA2) SLC26A4 (PDS) Steel, KP, Kros, CJ (2001). A genetic approach to understanding auditory function. Nature Genetics, 27:

14 Genes Involved in Structural Integrity of the Cochlea Regulatory Genes Transcription Factors TECTA (DFNA8, DFNA12, DFNB21) COL11A2 (DFNA13) COL4A5, COL4A3, COL4A4 (Alport syndrome) MYO7A (unconventional myosin DFNA11, DFNB2, Usher syndrome1b) MYO15 (unconventional myosin DFNB3) Claudin-14 (tight junction protein DFNB29) POU3F4 (DFN3 stapes fixation w/gusher) EYA1 (Branchio-Oto-Renal syndrome) EYA4 (DFNA10) PAX3, SOX10, MITF, SNAI2 (Waardenburg syndrome) Terminology: Connexin Deafness Locus: DFNB1 (at Chromosome 13q11-q12) Gene: GJB2, GJB6 Protein: connexin 26 (Cx26), connexin 30 (Cx30) Mutation: 35delG, 309 kb del, etc. GJB2: Connexin 26 The gene GJB2 encodes the Connexin 26 protein. GJB2 maps to Chromosome 13q11.12 Connexin 26 is a beta type gap junction protein. GJB2 = gap junction beta 2 In the inner ear, Connexin 26 is expressed in the cochlea, in the stria vascularis, basilar membrane, spiral prominence and limbus. GJB2-based hearing loss ~20% of all congenital hearing loss 50-80% of nonsyndromic, recessive, hereditary hearing loss Mutational Spectrum in the GJB2 gene More than 110 mutations: Carrier rates: 2-3% of Caucasians 4-5% of Ashkenazi Jewish 1% of Japanese Recessive nonsyndromic hearing loss due to mutations in GJB2 can vary from mild-moderate to profound. Most cases are severe to profound. Variability occurs between and within families. 35delG 167delT 235delC W44C (G to C at 132) M34T (T to C at 101) European descent Ashkenazi Jews Asian descent dominant mutation? pathogenic 14

15 The most common mutation in GJB2 Control 35delG homozygote Electropherograms provided by Baylor DNA Diagnostic Laboratory cctggggggtgt cctggggg-tgt Willems, P.J Genetic Causes of Hearing Loss. NEJM, 342(5): Willems, P.J Genetic Causes of Hearing Loss. NEJM, 342(5): Connexin 26 gap junction Connexin 26 in the inner ear Connexin 26 is involved in K+ recycling in the cochlea. Mutations in GJB2, the gene encoding Connexin 26, are the most common cause of autosomal recessive, nonsyndromic, congenital hereditary hearing loss. From David P Corey PhD Norris et al. (2006). Does universal newborn hearing screening identify all children with GJB2 (connexin 26) deafness? Penetrance of GJB2 deafness. Ear & Hearing 27(6):

16 JD s Pedigree Sensorineural Hearing Loss JD s DNA test results Control JD JD a. 2m Mod-severe SNHL Electropherograms provided by Baylor DNA Diagnostic Laboratory JD s connexin 26 test results 35delG / 35delG What does this genetic test result mean for JD and her family? The cause of JD s hearing loss has been precisely diagnosed at the molecular genetic level. JD is affected by autosomal recessive, nonsyndromic, sensorineural hearing loss associated with mutations in both copies of her GJB2 gene. JD s parents are both presumed to be carriers of the 35delG mutation in GJB2. What does this genetic test result mean for JD and her family? There is a 25% recurrence risk for hearing loss for every child born to JD s biological parents. That is: with each subsequent pregnancy of JD s parents, there is a 25% chance that the child will be homozygous for the 35delG mutation and have hearing loss. What does this genetic test result mean for JD and her family? The degree of hearing loss experienced by JD s siblings and other relatives may or may not be similar to JD s. Since JD has non-syndromic hearing loss, there is no need for her to have other tests such as thyroid screening, cardiac testing or MRI/CT scans of the cochlea to rule out syndromic forms of hearing loss. Other relatives may also be carriers and may be at risk for having affected children. 16

17 What if JD s connexin 26 test results turned out this way? GJB2 Gene Interactions 35delG / - 35delG/- 35delG/- GJB6/Connexin 30 GJB2/GJB6 Gene Interactions Cx30del (309 kb) CEN GJA3 GJB2 13q12 TEL GJB6 50kb Diagrammatic illustration of 309 kb deletion on 13q12 that includes the GJB6 (Cx30) locus GJB2: 35delG/- GJB6: 309del/- GJB2: 35delG/- GJB6: 309del/- GJB6 (Connexin 30) GJB6 (Connexin 30) The GJB6 gene located on chromosome 13q11.12, just upstream of the GJB2 (connexin 26) locus. A 309-kilobase deletion of GJB6 was first identified in some deaf patients from Spain in Mutations in any two of the four alleles from GJB2 or GJB6 can result in deafness. A new study using a knock-out mouse model (Boulay, 2013) has shown that GJB6 mutations do not directly cause hearing loss. Cx30 modulates the expression of Cx26. Cx30, together with Cx26 forms gap junctions in the cochlea. Mutations in GJB6 (Cx30) cause defective Cx26 expression, which is the cause of hearing loss. Boulay et al Hearing is normal without Connexin 30. Journal of Neuroscience. 33(2):

18 Connexin-deafness homepage What if JD s connexin 26 test results turned out this way? -/ - negative for connexin 26 and 30 Genetic Testing Doesn t Always Provide Clear Answers Clinical Work-up for Connexin negative individuals There should be some sort of caveat saying there is no guarantee that genetic testing will give you answers That is what happened with my kids. We still don t know the exact cause of their deafness. There are hundreds of other genes that haven t been discovered. It would help manage our expectations Factors to consider: Ethnicity Family history Syndromes that may have a late presentation - mother of 2 deaf children DNA Microarray Analysis Currently, researchers are developing several variations of a DNA chip to detect mutations in genes for deafness. Current concerns about this technology center around COST. Massively Parallel DNA Sequencing (MPS) Also known as Next Generation Sequencing Developed in the past 5 years Capable of sequencing an entire human genome in one day at a cost of $2 per Mb vs. 73 years at $200,000 per Mb for Sanger sequencing This calculation does not factor in bioinformatics costs (analysis) and the costs associated with high error rates

19 Massively Parallel DNA Sequencing In the future, whole genome sequencing will be an important part of every person s medical record (personalized medicine). Currently not feasible due to cost of sequencing entire 3.2 Gb genome still too high no consensus about a format to store genomic data interpretation of variants in the genome is still too difficult Massively Parallel DNA Sequencing Techniques to reduce cost focus on only a specific part of a patient s genome: Whole exome sequencing Targeted genomic enrichment Special techniques for analyzing the large amounts of data generated are also now under development Genetic Testing Strategies in the Genomics Era The challenge of effective mutation screening for genes for deafness is that of genetic heterogeneity. DNA sequencing for GJB2,GJB6 and other genes is currently the most cost effective approach for most patients. Changes in the testing strategy for hereditary deafness using MPS are on the horizon Genetic Testing Strategies in the Genomics Era Hereditary Hearing Loss Arrayed Primer Extension (HHL APEX) Stanford Method: Single bp primer extension Screens: 198 deafness mutations Inexpensive, but limited screening and not direct sequencing OtoChip TM Harvard Resequencing microarray Screens: 13 deafness genes Inexpensive, but only examines 13 of >60 known genes Genetic Testing Strategies in the Genomics Era OtoSCOPE - University of Iowa Method: Solution-based target enrichment and massively parallel sequencing Screens: 66 deafness genes Screens all known deafness genes, uses direct sequencing, but expensive These platforms will be perfected and will become standardized for diagnostic use within the next year or two. Incidence: ~1 in 7,500 Inheritance: autosomal recessive Clinical features: Severe to profound congenital sensorineural hearing loss Adult onset goiter, showing incomplete penetrance Enlarged vestibular aqueduct and/or Mondini malformation Gene: SLC26A4 (7q31) Pendred syndrome Photographs of mild goiter provided by Richard JH Smith, MD 19

20 Pendred syndrome characterized clinically by goiter (80%), hypothyroidism (40%), enlarged vestibular aqueduct (100%) and/or Mondini dysplasia and progressive hearing loss in some >100 mutations in SLC26A4 have been reported Pendred syndrome and nonsyndromic EVA are now thought to be clinically and genetically distinct entities Jervell & Lange-Nielsen syndrome (JLNS) Clinical features: Severe to profound congenital Normal QT interval sensorineural hearing loss Prolongation of the QT interval Prolonged QT interval Syncope Top image from Dean Jenkins and Stephen Gerred Sudden death Bottom image from Towbin and Vatta Am J Med 2001;110: Jervell & Lange-Nielsen syndrome (JLNS) Incidence: ~1 in 250,000 Inheritance: autosomal recessive Heterozygous family members are at risk for sudden death Genes: KVLQT1 (KCNQ1, 11p15.5) KCNE1 (ISK, mink, 21q22.1-q22.2) Late onset deafness Congenital CMV infections Pendred syndrome Aminoglycoside ototoxicity Dominant NSDF Mitochondrial Genes associated with hearing loss MTRNR1 (encoding 12S rrna) A1555G, 961delT+(C) n MTTS1 (encoding trna for serine) A7443G, A7445G/C, T7510C, T7511C Pandya A. Nonsyndromic hearing loss, Mitochondrial. Gene Reviews. 20

21 The Mitochondrial Chromosome thousands of copies in the cell circular small (16,500 base pairs) each mitochondrial chromosome codes for 37 genes (13 ox phos, 2 rrna, 22 trna) inherited from mothers only 125Hz 250Hz 500Hz 1000Hz 2000Hz 4000Hz 8000Hz * X O XO XO X O O X X O XO O Genetic Susceptibility to Aminoglycoside Ototoxicity mitochondrial mutation A1555G in a rrna gene mutation in combination with exposure to aminoglycosides results in rapid onset of hearing loss prevalent in Chinese and other oriental ethnic groups but has also been found in Caucasians, Greeks, etc. Aminoglycoside Ototoxicity Common cause of irreversible hearing loss Characteristic matrilineal inheritance History of exposure to streptomycin Homoplasmic A1555G change in 12SrRNA Mutation resembles bacterial ribosomal target Spanish/Oriental ethnicity 21

22 Mitochondrial Deafness The A1555G mutation is also a frequent cause of deafness in Spanish and Asian populations, without exposure to aminoglycosides. A nuclear modifier gene on chromosome 8 was recently identified and is thought to account for the deafness in those individuals who do not have aminoglycoside exposure. Who should be tested for mitochondrial mutations? 1. Families exhibiting matrilineal inheritance 2. Individuals from high risk families Talking to Parents about Genetics 3. Individuals from high risk ethnic groups 4. All infants admitted to neonatal intensive units? Genetic Evaluation Why? A genetic evaluation should be considered part of the normal diagnostic process of a child with hearing loss.. to determine if there are or will be other physical or medical characteristics associated with the hearing loss. to determine if other family members are affected or at risk. if genetic, to determine the pattern of inheritance and the chance of recurrence for the parents. Discussing a Genetics Referral with Parents Timing What time is right for that family? Cost Benefits Identification of the precise cause of the hearing loss may be possible Getting a better idea of what factors were not responsible for the hearing loss can help May relieve guilt feelings May help in understanding the prognosis Will help in understanding the chance of recurrence 22

23 How can genetic testing help? Informative genetic test results can provide: Precise diagnosis Precise genetic counseling Early diagnosis and intervention for relatives Improved management of patients and families (in some families, genetic testing may eliminate the need for additional medical testing to rule out genetic syndromes) Professional and Parent Resources for Genetics and Hearing Loss Resources for Parent and Consumer Information Genetics Home Reference, U.S. National Library of Medicine Resources for Parent and Consumer Information Harvard Medical School Center for Hereditary Deafness 23

24 Resources for Parent and Consumer Information Resources for Professional Information in Genetics American College of Medical Genetics brochure: Hearing Loss, Genetics and Your Child Available free of charge in English and Spanish from the National Coordinating Center for the Regional Genetic and Newborn Screening Services Collaboratives (NCC), Genetics Testing Registry, National Library of Medicine Gene Tests/Gene Clinics, University of Washington PST 756 Genetics and Hearing Loss for EHDI Professionals Dates: This online course is offered once a year, every Fall. 3.7 ASHA or AAA CEUs Registration and further information: Future Directions identification of new genes for hearing loss Molecular newborn screening for congenital CMV Molecular newborn screening for common forms of genetic hearing loss gene therapy Resources Arnos & Pandya (Guest Editors). Genetics and Hearing Loss. Seminars in Hearing, Vol 27 (3), August Yan D, Tekin M, Blanton SH, Liu XZ (2013). Next generation sequencing in genetic hearing loss. Genet Test Mol Biomarkers Aug;17(8): Schwartz, S. (editor). Choices in Deafness. 3 rd edition. Woodbine House,