BioProcess Product Guide

Transcription

1 GE Healthcare Life Sciences BioProcess Product Guide 2012/2013 Scale-up Single-use Validation QbD Manufacturing IDEA Process development Time Purity Process economy Flexibility Security of supply

2 How to contact us or by phone (T), fax (F), and Europe Austria T: F: [email protected] Italy T: F: [email protected] Belgium T: F: +32 (2) [email protected] Netherlands T: F: [email protected] Czech Republic T: F: [email protected] Norway T: F: [email protected] Denmark T: F: [email protected] Poland T: F: [email protected] Eire T: F: [email protected] Portugal T: F: [email protected] Finland and Baltics (Estonia, Latvia and Lithuania) T (Finland): T (Baltics): +358 (0) F (0) [email protected] France T: +33 (0) F: +33 (0) [email protected] Slovakia T: [email protected] South East Europe T: F: [email protected] (Albania, Bosnia-Herzegovina, Bulgaria, Croatia, Kosovo, Macedonia, Montenegro, Romania, Serbia and Slovenia) Germany T: F: [email protected] Spain T: F: [email protected] Great Britain T: F: [email protected] Sweden T: +46 (0) /01 F: +46 (0) [email protected] Hungary T: F: [email protected] Switzerland T: F: [email protected]

3 North America Canada T: F: International USA T: Press 1 Press 2 Press 3 Press 0 To reach an extension, sales or service representative Customer Service to place an order or for pricing and product availability Hours: 8.30 am 7.30 pm Eastern Time For Technical Support or Instrument Repair Hours: 9.00 am 6.30 pm Eastern Time To reach an operator F: [email protected] Argentina T: [email protected] Australia T: F: [email protected] Belarus See listing for Russian Federation Brazil T: F: [email protected] China (Beijing, Guangzhou, Hong Kong & Shanghai) T: or [email protected] India (Bangalore) T: F: [email protected] India (Mumbai) T: /41/42/43 F: [email protected] Israel T: F: [email protected] Japan T: F: [email protected] Kazakhstan See listing for Russian Federation Korea T: F: [email protected] Malaysia T: F: [email protected] Mexico T: F: [email protected] Middle East T: F: [email protected] (Africa, Middle East, Greece, Malta, Cyprus, Pakistan, Afghanistan and Mongolia) Moldavia See listing for Russian Federation New Zealand T: F: +64 (9) [email protected] Russian Federation and other CIS/NIS T: F: [email protected] Singapore T: F: [email protected] South Africa T: +27 (0) F: +27 (0) [email protected] Taiwan T: F: [email protected] Thailand T: F: [email protected] Ukraine See listing for Russian Federation

4 Sales branch offices Europe Austria GE Healthcare Europe GmbH Zweigniederlassung Österreich Europlaza, Gebäude E Wienerbergstrasse 41 A-1120 Wien T: F: [email protected] Technical Support T: Belgium GE Healthcare Europe GmbH Branch office Benelux Kouterveldstraat 20 B-1831 Diegem T: F: [email protected] Czech Republic AP Czech s.r.o. Hostalkova 48 CZ Praha 6 T: F: [email protected] Denmark GE Healthcare Europe GmbH Park Allé 295, 2. Sal Brondby DK DENMARK T: F: [email protected] Labcrew T: [email protected] Technical Support T: [email protected] Sales support to Iceland Finland and Baltics (Estonia, Latvia and Lithuania) GE Healthcare Europe GmbH Suomen sivuliike PL 3130 FIN Helsinki FINLAND T: F: [email protected] Labcrew T: +358 (9) [email protected] Technical Support T: +358 (9) [email protected] France GE Healthcare Europe GmbH Branch France 24 Avenue de l'europe CS F Vélizy Villacoublay T: +33 (0) F: +33 (0) [email protected] Germany GE Healthcare Europe GmbH Munzinger St Freiburg T: F: [email protected] Great Britain GE Healthcare UK Ltd Amersham Place Little Chalfont Bucks HP7 9NA T: F: [email protected] Hungary AP Hungary Etele út Budapest 1119 T: F: [email protected] Italy GE Healthcare Europe GmbH Filiale Italiana Via Galeno 36 I Milano (MI) T: F: [email protected] Netherlands GE Healthcare Europe GmbH Branch office Benelux Kouterveldstraat 20 B-1831 Diegem BELGIUM T: F: [email protected] Norway GE Healthcare Europe GmbH P.O. Box 4665 Nydalen N-0450 Oslo T: F: [email protected] Labcrew T: [email protected] Technical support T: F: [email protected] Poland LKB Biotech al. Bohaterow Wrzesnia 9, lok Warszawa T: F: [email protected] Portugal GE Healthcare Europe GmbH Sucursal em Portugal Av. Do Forte no. 6 6A Edifício Ramazzotti Carnaxide T: F: [email protected] South East Europe (Albania, Bosnia-Herzegovina, Bulgaria, Croatia, Kosovo, Macedonia, Montenegro, Romania, Serbia and Slovenia) LKB Vertriebs GmbH Wurzbachgasse 18 P.O.Box 54 A-1152 Wien AUSTRIA T: F: [email protected] Spain GE Healthcare Europe GmbH Sucursal en España Rosselló i Porcel, 21 Planta Barcelona T: F: [email protected]

5 Sales branch offices Sweden GE Healthcare Europe GmbH Filial Sverige Björkgatan 30 Box 605 SE UPPSALA T: +46 (0) /01 F: +46 (0) Labcrew T:+46 (0) Technical Support T: +46 (0) Switzerland GE Healthcare Europe GmbH Zweigniederlassung Schweiz Europastrasse 31 CH-8152 Glattburg T: F: North America Canada GE Healthcare Bio-Sciences, Inc. 500 Morgan Blvd., Baie d Urfé, Québec, H9X-3V1 Customer Service T: F: [email protected] Technical Support [email protected] USA GE Healthcare Bio-Sciences Corp 800 Centennial Avenue P.O. Box 1327 Piscataway, NJ T: Technical Support [email protected] Customer Service [email protected] Instrument Service [email protected] International Argentina GE Healthcare Life Sciences Argentina SA Nicolas de Vedia 3616 C1430DAH Ciudad Autonoma de Buenos Aires ARGENTINA T: [email protected] Sales support to Argentina, Uruguay, Paraguay, Chile, and Bolivia Australia GE Healthcare Australia Pty. Ltd. Building 4B, Parklands Estate 21 South Street Rydalmere NSW, 2116 AUSTRALIA T: F: [email protected] Postal address: PO Box 21 Rydalmere, NSW 1701 AUSTRALIA Sales support to New Zealand Brazil GE Healthcare Life Sciences do Brasil Ltda. Rua Domingos Marchetti, 192 Bairro do Limão SP BRAZIL T: F: [email protected] Sales support to Brazil, Colombia, Costa Rica, Dominican Republic, Ecuador, Guatemala, Honduras, Panamá, Perú, Tobago, Trinidad and Venezulea China (Beijing) GE Healthcare Life Sciences Beijing Representative Office No. 1, Yongchong North Road Beijing Economic & Technological Development Area Beijing T: x F: [email protected] China (Guangzhou) GE Healthcare Life Sciences Guangzhou Representative Office 10/F, GE Tower, No.87 Hua Cheng Avenue, Pearl River New City, Tianhe District, Guangzhou T: F: [email protected]

6 Sales branch offices China (Hong Kong) GE Healthcare Life Sciences L12 Office Tower, Langham Place 8 Argyle Street, Mongkok Kowloon HONG KONG T: F: [email protected] China (Shanghai) GE Healthcare Life Sciences Shanghai Representative Office No 1 Hua Tuo Road, Zhang Jiang- High-Tech Park, Pudong, Shanghai T: F: [email protected] India (Bangalore) Bangalore Regional Office Wipro GE Healthcare Pvt. Ltd. 7th Floor, Summit Tower B, 73/1, Brigade Metropolis, Mahadevapura, Bangalore INDIA T: F: [email protected] Sales support to Bangladesh and Sri Lanka India (Mumbai) Mumbai Regional Office Wipro GE Healthcare Pvt Ltd., No. 881, Solitaire Corporate Park, Andheri Ghatkopar Link Road, Andheri (E), Mumbai INDIA T: /41/42/43 F: [email protected] Sales support to Bangladesh and Sri Lanka Israel Danyel Biotech Ltd. Hamada Street 1 Science Park, P.O.B Rehovot T: F: [email protected] Japan GE Healthcare Japan Corporation Sanken Bldg , Hyakunincho Shinjuku-ku Tokyo BioDirect Line T: F: [email protected] Korea Address from May 2012: GE Healthcare Korea Ltd. Pharos Tower 7F, 119, Nonhyeon-dong, Gangnam-gu, Seoul T: F: [email protected] Malaysia GE Healthcare Bio-Sciences Ltd. Level 6, 1 Sentral Jalan Travers, Kuala Lumpur Sentral Kuala Lumpur T: F: [email protected] Mexico GE Sistemas Medicos S. A. de C. V. Antonio Dovali Jaime no. 70, Torre B, 4er. Piso 4. Col. Santa Fe Mexico D. F. CP T: F: [email protected] Middle East (Africa, Middle East, Greece, Malta, Cyprus, Pakistan, Afghanistan and Mongolia) HVD Biotech Vertriebs GmbH Vouliagmenis Avenue 16 P.O. Box GR Glyfada GREECE T: F: [email protected] New Zealand GE Healthcare Ltd Level 1, 8 Tangihua Street Auckland 1010 T: F: [email protected] Postal address: PO Box Auckland City Post Shop Auckland 1143 Russian Federation and other CIS/NIS CJSC GE Healthcare ZAO Presnenskaya nab., 10C, 12th floor RF , Moscow T: +7 (495) F: +7 (495) [email protected] Contact Moscow office for Ukraine, Kazakhstan, Belarus, and other CIS countries (former Soviet Union excluding Baltic countries) Singapore GE Healthcare Pte. Ltd. 1 Maritime Square #13-01 Harbourfront Centre Singapore SINGAPORE T: F: [email protected] Sales support to South East Asia Region including Brunei, Philippines, Indonesia, and Vietnam South Africa Separation Scientific (SA) (Pty) Ltd Unit 29 Honeydew Shopping Centre Cnr Beyers Naude & Blueberry Street Honeydew, 2040 T: +27 (0) F: +27 (0) [email protected] Taiwan GE Medical Systems Taiwan, Ltd. Taiwan Branch Office 11F, No.68, Sec.3, Nanjing E. Rd., Taipei 104 T: F: [email protected] Thailand GE Medical Systems (Thailand) Ltd. Thanapoom Tower, 32nd Floor 1550 New Petchburi Road Makasan, Ratthewi Bangkok, T: F: [email protected]

7 Main offices GE Healthcare Bio-Sciences AB Björkgatan 30 SE Uppsala SWEDEN T: +46 (0) F: +46 (0) GE Healthcare Europe GmbH Munzinger Strasse 5 D Freiburg GERMANY T: F: GE Healthcare UK Ltd. Amersham Place Little Chalfont Bucks HP7 9NA UK T: +44 (0) F: +44 (0) GE Healthcare Bio-Sciences Corp 800 Centennial Avenue P.O. Box 1327 Piscataway, NJ USA T: F: GE Healthcare Japan Corporation Sanken Bldg , Hyakunincho Shinjuku-ku Tokyo JAPAN T: F: Fast Trak Regional Fast Trak Centers Europe GE Healthcare Europe GmbH Oskar-Schlemmer-Strasse München GERMANY T: +49 (0) F: +49 (0) [email protected] North America GE Healthcare Bio-Sciences Corp. 800 Centennial Avenue Piscataway, NJ USA T: F: [email protected] China GE Healthcare GE (China) Research and Development Center Co.,Ltd 1800 Cai Lun Road Zhangjiang High-Tech Park, Pudong Shanghai T: F: [email protected] India GE India Technology Centre Pvt. Ltd. John F. Welch Technology Center 122, EPIP, Whitefield Road Bangalore T: F: [email protected] Japan GE Healthcare Sanken Bldg, Hyakunincho 3-chome Shinjuku-ku Tokyo T: +81 (0) F: +81 (0) [email protected] Singapore GE Healthcare Life Sciences 1 Maritime Square #13-01 HarbourFront Centre Singapore T: F: [email protected] Administrative office Sweden GE Healthcare Bio-Sciences AB Björkgatan 30 SE Uppsala T: +46 (0) [email protected] Website:

8 Contents Product highlights 16 Cell culture 26 ReadyToProcess 34 Cell culture media, sera and reagents 28 Microcarrier 31 ReadyToProcess Platform 36 WAVE Bioreactor systems 38 Single-use fluid management and filtration 52 ReadytoProcess connectivity 66 ReadyToProcess chromatography Products for process development 150 High-throughput process development 153 PreDictor 96-well filter plates 154 PreDictor RoboColumn 156 HiScreen columns 157 Examples of prepacked columns 158 Selection kits 160 Custom-packed columns 161 Systems for method and process development 162 Filtration products 164 Cross flow filtration 170 Normal flow filtration 189 Filtration hardware 194 Protein interaction and stability analysis 200 Biacore systems 202 MicroCal systems

9 4 5 6 Chromatography media 74 Ion exchange 77 Affinity 82 Hydrophobic interaction 87 Multimodal 90 Reversed phase 94 Gel filtration 96 Custom designed media 100 Chromatography columns 102 AxiChrom 106 Chromaflow 110 BPG 114 INdEX 122 FineLINE 126 HiScale 132 Custom-packed laboratory columns 134 Manufacturing Solutions column packing 136 Chromatography systems 138 ÄKTA avant 140 ÄKTApilot 141 ÄKTAprocess 142 Inline conditioning 144 Customized BioProcess Solutions 145 UNICORN control Oligonucleotide synthesis 208 Synthesizers 211 Columns 213 Solid supports 214 Service and support 216 Service agreements 218 Smart Asset Management Services 219 Application services - Fast Trak 220 Validation Services 224 Online regulatory and technical support 226 System and column support 228 Security of supply 229 Literature 230 Index and legal 232 A to Z of media and chemicals 234 Terms and conditions of sale 268 Trademarks 271 Licensing information 271 Alphabetical index

10 Inspiring science transforms your ideas into therapies Transforming ideas into innovative drug candidates brings multidisciplinary teams together with a vast array of complex equipment and processes. That, of course, is only the beginning. Taking those candidates and methods quickly and reliably from explorative discovery environments, through testing and clinical trials, and into highly regulated biopharmaceutical production environments, all with optimized processes, merely adds to a difficult equation. At GE Healthcare Life Sciences, we understand you want confidence in your decisionmaking as early as possible. Our aim is to help you and your bioprocessing teams, at every step, to bring drugs to market in a faster, simpler, more reliable and cost effective manner according to your plan. Understanding your aspirations and challenges, and defining innovations that can support you in navigating the path to success, is a world we thrive in. Every day, we ask ourselves, how can we best support you? It could be in the form of modern media engineering to withstand repeated cleaning-in-place, or intelligent column packing that saves hours of precious time. Analysis technology that increases sensitivity and precision. Single-use systems that bring unprecedented flexibility to manufacturing. Validation support to lighten the regulatory load. Collaboration on critical projects or even acting as your partner in the design, construction and start-up of an entire plant. These are just a few examples of innovations, big and small, prompted by the demands of the industry, incubated at GE Healthcare Life Sciences.

11 Time to market is key Transforming ideas into innovative drug candidates, optimizing processes, and manufacturing biotherapeutics are multidisciplinary activities. The challenge is to take candidates and methods quickly and reliably from exploratory discovery environments, through testing and clinical trials, and into highly regulated biopharmaceutical production environments. In today s competitive market, the focus is on improving efficiency and productivity, as well as ensuring process robustness and economy. GE Healthcare continues to develop products and services to support your needs from idea to biopharmaceutical.

12 Our technologies and products for efficient upstream and downstream processing, include the ReadyToProcess platform of single-use products, PreDictor formats for highthroughput process development, MabSelect media for monoclonal antibody purification, Capto media for ion exchange, hydrophobic interaction and multi-modal separations, AxiChrom columns, WAVE Bioreactor cell culture systems, ÄKTA chromatography and filtration systems, services and education. In 2011, GE Healthcare acquired PAA Laboratories, a developer and manufacturer of cell culture media for the biopharmaceutical and vaccine manufacturing industry. Adding upstream capabilities will enable us to provide an end-to-end, integrated service to our customers. We believe that an integrated approach, where we can help customers optimize every stage of their manufacturing process, has the potential to reduce cost of entry, deliver higher yields of finished product, and reduce time to market. Flexible solutions designed for your application needs GE Healthcare continues to develop quality products, services, and platform technologies that enable rapid process development and efficient production of biopharmaceuticals. Our solutions support the manufacture of biomolecules, including plasma proteins, recombinant proteins, antibodies, and recombinant viral vectors for biopharmaceutical therapy. We provide comprehensive solutions to support you at every step, from research to market. Antibodies The capacity to manage high titers The successful production and application of therapeutic antibodies has increased the demand for more effective tools and solutions. Efficient tools to characterize the experimental design space are required, as well as optimization of upstream and downstream protocols in order to achieve robust and high-yield processes at manufacturing scale. Improvement in antibody processing has increased titer concentrations from a few milligrams to multiple grams per liter. High titers require chromatography media with high capacity, high rigidity and chemical stability. MabSelect, MabSelect Xtra, MabSelect SuRe, and MabSelect SuRe LX are examples of Protein A-based media that meet these criteria. High titers also reduce process volumes and thereby create new opportunities for flexible manufacturing. The ReadyToProcess platform has the flexibility to speed throughput and reduce up-front investment. The growing product portfolio includes WAVE Bioreactor and Cellbag culture chambers, as well as ReadyCircuit single-use assemblies and ReadyToProcess filtration and chromatography solutions. Recombinant proteins Solutions to the most difficult production challenges Purification challenges with recombinant DNA technology vary depending upon the specific protein, the expression system and location of the product. GE Healthcare can help you every step of the way with proven and well-integrated filtration and chromatography platforms with the Capto range, combined with AxiChrom process columns and ÄKTA chromatography systems as well as the ReadyToProcess platform. 12

13 Regardless of the expression system type, a downstream process normally follows the Capture - Intermediate Purification - Polishing approach. This often results in a process containing three to five purification steps. It is important to link different techniques and steps optimally for industrial robustness and scalability. When standard chromatography media cannot provide optimal purity and economy our Custom Designed Media (CDM) service can often be the swiftest way to a robust and economic process. The CDM service can help by tailoring a chromatography medium to specific processing needs. Vaccines Technologies for safer, more efficacious and cost-effective vaccines Vaccine development has progressed from whole microorganisms to subunit vaccines that contain only antigenic proteins. Today, the vaccine field is very diverse and covers many molecule types, including conjugated polysaccharides, recombinant proteins, live-attenuated virus, inactivated viruses, virus-like particles and whole cells. Recent developments in immunology have also opened pathways for the development of therapeutic vaccines. A large part of therapeutic vaccine research is focused on the development of cancer vaccines. GE Healthcare offers a number of opportunities for manufacturers wanting to deliver safer, more efficacious and cost-effective vaccines. Our technologies and products include solutions for upstream manufacture, downstream purification and analytical assays. Comprehensive and reliable support We aspire to be a trusted, knowledgeable supplier and offer an array of specialized services and support for process development, validation, security of supply, and compliance. Our Fast Trak team provides education courses and process development assistance, while our Enterprise Solutions team can act as your partner in the design, construction and start-up of an entire plant. To support GMP compliance, Regulatory Support Files (RSFs) and Validation Guides (VGs) are available for all BioProcess consumables, and similar documentation is available for BioProcess hardware. Secure supply Over the past decades GE Healthcare has supported the rapid growth in biopharmaceutical production we currently deliver approximately laboratory and pilot-scale columns per year, and over the years we have supplied more than liters/kgs of chromatographic media, more than process scale columns, 2000 BioProcess systems, membrane devices, and 1000 filtration skids. We have recently increased our production capacity and services to match demands. We believe security-of-supply is about quality as well as timely delivery of the right quantity, thus we have validated production processes and manufacture according to ISO Over the past years we have invested over US$100 million in business continuity systems, processes, training, and equipment. We have worked with a combination of market-leading safety and business continuity consulting firms. Customers and notified bodies/regulatory authorities closely scrutinize our production routines through on-site audits an important catalyst in our continuous improvement program. 13

14 Products and platforms across bioprocessing Through continuous development of innovative products and with the recent acquisition of PAA Laboratories, we are able to support bioprocessing from cell culture and fermentation through recovery and purification to formulation. Our products and platform solutions are designed to meet the key challenges posed at every stage in the process, delivering the desired product at the required purity and safety: all with fast development and integrated solutions in mind. 14

15 Key goals Technology Key products Downstream Upstream Cell Culture Recovery Capture Purification High product titer Product folding & post translational modifications correct Product easily transferred to DSP Isolate and prepare product for purification Removal of cells and cells debris Secure process robustness & economy Initial purification of target molecule Removal of process related impurities from clarified feed, including host cell protein, DNA, viruses and endotoxins High producer cell grown in reactors and fermenters Cell disruption methods Cross flow filtration Normal flow filtration Affinity chromatography Ion exchange Multi-modal Ion exchange chromatography Multi-modal Hydrophobic interaction Ultrafiltration/ diafiltration WAVE Bioreactor WAVE Mixer Microcarriers ReadyCircuit PAA cell culture media PAA supplements ULTA filters ReadyToProcess hollow fibers ReadyToProcess chromatography MabSelect, Capto media PreDictor formats Sepharose, Sephadex, CDM media UniFlux, ÄKTA systems, UNICORN AxiChrom columns ReadyToProcess chromatography ReadyToProcess hollow fiber Capto, PlasmidSelect, CDM media Sepharose, Sephadex, SOURCE PreDictor, HiScreen, AxiChrom columns Kvick cassettes, hollow fibers ÄKTA systems, UNICORN, UniFlux Polishing Removal of remaining traces of process- and product-related impurities Ion exchange Reversed phase Hydrophobic interaction Gel filtration ReadyToProcess chromatography Capto ImpRes, Superdex prep grade Sephacryl, Sepharose, SOURCE UniFlux, ÄKTA systems AxiChrom columns Formulation Long-term product stability Ultrafiltration/ diafiltration Kvick cassettes, Hollow fiber filters ReadyToProcess hollow fibers Analytics Manufacturing support Buffer preparation Cell culture media preparation QC/QA Rapid, flexible preparation of buffer stock Removal of bioburden and/or particulates Consistent cell culture performance Sterilization of heat labile components Flexible preparation and storage systems Rapid, selective measurement of target proteins or specific contaminants Filtration Mixing technology Connectivity and storage solutions Inline conditioning Sterile filtration and mycoplasma removal Mixing technology Connectivity and storage solutions Surface plasmon resonance Ultrasensitive microcalorimetry ULTA filters WAVE Mixer ReadyMate connectors ReadyCircuit assemblies ÄKTA Inline conditioning systems ULTA filters WAVE Mixer ReadyMate connectors ReadyCircuit assemblies Biacore systems MicroCal systems 15

16 1Product highlights ReadyCircuit assemblies and ReadyKart stations 18 Capto media 21 WAVEPOD II Integrated Controller 18 MabSelect SuRe LX 22 UNICORN DAQ ÄKTA avant system 22 ph sensor for Cellbag bioreactor 19 ActiCHO Media System 19 Slurry tanks 23 Inline conditioning for process chromatography systems 23 PreDictor RoboColumn 20 MicroCal DSC systems 24 HiScale columns 20 Smart Asset Management Services

17

18 1 ReadyCircuit assemblies and ReadyKart stations Product highlights ReadyCircuit bags and tubing assemblies provide flexible solutions for fluid storage and transfer while eliminating cleaning and sterilization steps. They also reduce batch changeover time and improve facility throughput. ReadyCircuit assemblies are conveniently organized on ReadyKart mobile processing station - a configurable cart that provides ergonomic support and enhances the use of ReadyToProcess fluid processing products. ReadyCircuit assemblies and ReadyKart stations provide: A sterile fluid path for storage and transfer of process fluids Configurable process solutions for single-use fluid handling For more information see page 52. WAVEPOD II Integrated Controller The WAVEPOD II module integrates all the instrumentation associated with the WAVE Bioreactor 20/50 system, including dissolved oxygen, optical ph, and CO2/O2 gas mixing controls, to meet individual cell culture needs for insect cell, mammalian cell, and perfusion applications. The unit combines these four key instruments into a single compact device, which controls WAVE Bioreactor base via a digital link. A large color touchscreen allows easy access to all parameters, including data from the bioreactor. For further information, see page 48. UNICORN DAQ 1.0 UNICORN DAQ 1.0 software provides data acquisition for the management and evaluation of results from cell cultures performed in WAVE Bioreactor systems. UNICORN DAQ software provides the following benefits: Real time data acquisition allows you to monitor the run status of a connected WAVE Bioreactor 20/50 or 200 system Simultaneous monitoring of up to four different instrument configurations enables efficient data acquisition A common platform and user interface for all culture volumes simplifies scale up Secure and unalterable result files For more information see page

19 ph sensor for Cellbag bioreactor Cellbag bioreactor can be fitted with an optical ph sensor, a sterile, single-use spot sensor embedded into the bottom of the bioreactor. To measure ph using the sensor, a WAVEPOD II controller is required for WAVE Bioreactor 20/50 system. Cellbag bioreactor ph sensor provides: High measurement accuracy with minimal drift over time Single-use format Optimized for minimum as well as maximum Cellbag working volumes 1 Product highlights For more information, see page 45. ActiCHO Media System Fed-batch culture improves the yield and the concentration of highly active recombinant proteins by continuous supplementation with essential nutrients. PAA has developed an innovative media system for fed-batch culture of Chinese hamster ovary (CHO) cells that significantly speeds up the entire process. After a short adaptation phase the optimal feeding strategy can be rapidly identified, allowing early transfer from shaker flask to protein production in larger scale in a bioreactor. The ActiCHO Media System is specially optimized to provide high performance and protein yield with recombinant CHO-DG44 cells in suspension culture. The ActiCHO Media System consists of the adaptation medium ActiCHO SM, the production medium ActiCHO P, and two matched feeding supplements ActiCHO Feed-A and ActiCHO Feed-B, and a separate, concentrated stock solution of glucose. Features of the ActiCHO Media System include: Ready-to-use starter kit and scale-up kit Chemically defined Significant increase in productivity Production of proteins with high potency Speeds up time to market For more information, see page

20 1 PreDictor RoboColumn Product highlights PreDictor RoboColumn units are miniaturized columns prepacked with a wide range of BioProcess chromatography media for high-throughput process development (HTPD). Designed for robotic liquid handling, they offer workstation owners a fast and flexible means of generating valuable data. HTPD shortens time-to-clinic and increases understanding in early process development by allowing the parallel evaluation of large numbers of experimental parameters with less sample consumption. With screening results from PreDictor RoboColumn and/or PreDictor plates, process developers can move on to prepacked HiTrap or HiScreen columns for further optimization/finetuning and verification prior to scale-up. PreDictor RoboColumn units include the following benefits: Supports HTPD by allowing parallel screening of chromatographic conditions Facilitates screening of a wide range of parameters with small sample consumption Prepacked with a range of GE Healthcare BioProcess chromatography media High-throughput workflow allows investigation of enlarged experimental workspace for better process understanding For more information, see page 156. HiScale columns HiScale columns were developed to simplify and accelerate process development and preparative chromatography. Key design features enable precise column packing, easy handling, and increased method reproducibility. The column tubing material is PEEK, which allows for increased pressure specifications. The QuickLock mechanism of the adapter shaft facilitates rapid and easy movement of the adapter, simplifying adjustments as well as disassembly and cleaning. Primary benefits of HiScale columns are: Pressure stability up to 20 bar Wide range of packing protocols Ergonomical design enabling precise packing Simple column handling and cleaning For more information, see page

21 Capto Q ImpRes and Capto SP ImpRes Capto SP ImpRes and Capto Q ImpRes are strong cation and strong anion exchange media, respectively, for high-throughput intermediate purification and polishing of a wide range of biomolecules. The combination of the high flow agarose and the small particle size of Capto ImpRes media results in good pressure-flow properties as well as outstanding resolution. Strong anion exchangers with high resolution for late intermediate purification and polishing when high throughput is essential High resolution for high purity and high yield Flexible process design due to a large operational window of flow rates and bed heights Traditional Q and SP ligands for robust and predictable separations, and easy optimization and scale-up. For more details on Capto Q ImpRes and Capto SP ImpRes, see page Product highlights Capto L Capto L is an affinity chromatography medium for the process-scale capture of a broad range of antibodies and antibody fragments. It combines a rigid, high-flow agarose matrix with the immunoglobulin-binding protein L ligand. Capto L is therefore suitable for capture of a wide range of antibody fragments such as Fabs, single-chain variable fragments (scfv), and domain antibodies (dabs). Key performance features of Capto L include: High specificity for kappa light chain allows efficient capture of a broad selection of antibodies and antibody fragments High dynamic binding capacity reduces process time and amount of medium used High-flow agarose matrix increases productivity, economy and process design flexibility For more details, see page 84. Capto Core 700 Capto Core 700 is designed for flowthrough purification of large proteins or viruses in vaccine processes. The core bead design of this medium gives dualfunctional properties that make it possible to combine size separation with binding chromatography. The performance of the medium can be compared with gel filtration chromatography, but Capto Core 700 offers improved productivity and process economy. The multimodal property of the ligand in the core ensures strong binding with most impurities over a wide range of ph and salt concentration. Capto Core 700 enables: Higher sample loads Higher flow rates Simple optimization and scale-up For more details, see page

22 1 MabSelect SuRe LX Product highlights MabSelect SuRe LX is an alkali-stabilized, Protein A-derived affinity medium with a binding capacity for monoclonal antibodies (MAbs) exceeding that of MabSelect SuRe at longer residence times. As an example, at 6 min residence time, the dynamic binding capacity of MabSelect SuRe LX for human IgG is approximately 60 g/l. This special combination of high binding capacity plus alkaline stability gives manufacturers of MAbs many opportunities to improve process economics and product quality. Benefits of MabSelect SuRe LX include: Outstanding binding capacity Quick, efficient processing of large volumes of high-titer bioreactor feeds Higher density eluates increase operating flexibility and allow smaller unit operations Alkali-tolerant Protein A-derived ligand allows the use of M sodium hydroxide for Cleaning-In-Place (CIP) Enhanced protease resistance of the Protein A ligand reduces leakage Generic elution conditions for different monoclonal antibodies enable platform purifications For more information, see page 83. ÄKTA avant system Available in two versions, ÄKTA avant is a preparative chromatography system intended for method and process development. With flow rates up to 25 ml/min, ÄKTA avant 25 is designed for media screening and method optimization. ÄKTA avant 150, with flow rates up to 150 ml/min, is designed for scaling up to larger columns. ÄKTA avant is operated by UNICORN 6 control software, which has been developed to increase productivity and efficiency. ÄKTA avant offers a complete solution for fast, high-quality protein separations while maintaining flexibility and reliability. Speed, scalability, and security: Maximum information from minimum number of experiments with integrated Design of Experiments (DoE) support Quick and predictable scale-up from screening and optimization on HiScreen columns to fine-tuning and robustness testing on AxiChrom columns Built-in cooled fraction collector, column run data log book and FDA 21 CFR Part 11 compliant software For more information on ÄKTA avant, see page

23 Slurry tanks 1 Slurry tanks help to generate a homogenous slurry and thus play a critical role in ensuring a well-packed column and a robust and efficient purification process. A well-packed column is characterized by high resolution (with positive impacts on purity and yield) and high bed stability, characteristics that help to avoid costly repacking due to poor HETP and asymmetry. Slurry tanks provide: Homogenous slurry concentrations More efficient column packing Improved operator safety and process economics Product highlights For more information, see page 137. Inline conditioning for process chromatography systems Current trends in manufacturing biopharmaceuticals have put demands on securing increased buffer supplies delivered at precise times and at correct concentration and flow rates. To meet these demands, advanced technologies such as inline conditioning (IC) have gained increasing interest, not only because they reduce the need for large storage tanks, but also because IC can deliver correct solutions for a specific process need at a lowered total cost of ownership. GE Healthcare has delivered a wide range of IC systems, providing a reproducible, fully automated IC process. Advantages of inline conditioning include: Timely buffer delivery Automated IC process increases reproducibility Allows for use of smaller tanks or disposable bags Reduces or eliminates the need for CIP and WFI demands Provides better process economics For more information, see page

24 1 MicroCal DSC systems Product highlights MicroCal Differential Scanning Calorimetry (DSC) systems help you to screen for changes in protein stability and provide critical guidance in protein engineering through pre-formulation, process development, to formulation of the final biopharmaceutical product. The technique measures heat absorbed by the sample as the protein unfolds during a controlled temperature increase and without the use of labels or artificial probes. The resulting measure of thermostability gives an indication of the protein s long-term stability, without having to perform time-consuming accelerated stability studies. MicroCal DSC systems are designed to provide: Selection of the most stable engineered antibody Selection for the most stable protein storage conditions Identification of the optimal elution conditions in antibody purification For more information, see page 206. Smart Asset Management Services Pharmaceutical and biotech companies face many challenges today, such as higher operational costs, regulatory pressures, and shrinking profit margins. For corporations, it is critical to reduce costs while improving scientific productivity. To help with these challenges, GE Healthcare offers an array of services, including the Smart Asset Management Services program, Performance Solutions, LEAN Six-Sigma, Fast Trak process development and facility validation services. Smart Asset Management Services (SAMS) is helping leading companies around the world meet the challenges of controlling costs and improving productivity in a difficult business environment. For more information on how GE Healthcare Smart Asset Management Services can help your company, visit Our SAMS program can help companies: Reduce operating costs by up to 20% through the implementation of an asset management program Deploy on-site service engineers to improve instrument uptime and output Apply LEAN Six-Sigma to operations to enhance productivity Remove administrative tasks from your scientists to allow increased scientific productivity Gain access to innovative financing solutions Facilitate informed decision-making on capital purchases, improve asset productivity, and reduce maintenance costs through Asset Intelligence Solutions 24

25 25

26 2Cell culture Cell culture media, sera and reagents 28 Microcarrier

27 2 Cell culture 27

28 2 Cell culture media, sera and reagents Cell culture A suitable cell culture medium is a prerequisite for a successful cell cultivation process, irrespective of culture size or specific target application. The outcome of the cultivation will affect subsequent harvest and purification steps and consequently the yield and quality of the end-product. GE Healthcare's PAA product offering includes animal and human sera, liquid and powder media, reagents and supplements. Production facilities in Austria, North America, and Australia, sales subsidiaries and a network of more than 50 distributors provide the highest service level to meet customer requirements. In 2009 PAA expanded its FDA registered and GMP licensed manufacturing site in Europe with a modern powder production facility. The entire powder facility is strictly free of animal components (ACF) and designed to facilitate the regulatory submission process for biopharmaceutical production. The latest technologies in both milling and blending (including Process Analytical Technology; PAT) provide customers with true inter- and intra-batch homogeneity of powder media up to 8000 kg batch sizes. In addition, PAA now offers a complete service from cell clone optimization and media adaptation to contract manufacturing. For more information about PAA s products and offerings, please visit or

29 Product portfolio More than 20 years of experience as a cell culture media manufacturer have made PAA a global expert. Its processes are set at pharmaceutical standards and GMP regulations defined by the European Union, the United States FDA, and the ICH. PAA Laboratories uses only carefully selected and screened raw materials and EP grade water in the manufacture of its liquid cell culture products. The high standard of the QA and QC procedures ensures that only highest quality products are supplied to customers. Liquid and powdered media The product range includes classical media (DMEM, RPMI 1640, etc.), serum and protein free media, and cell type specific media for different applications such as stem cell, hybridoma and neuronal cultivation, as well as cytogenetic diagnosis. PAA offers a range of powdered basal media and buffer solutions. From raw material selection to the finished product, the whole process conforms to the FDA and EU GMP guidelines. Sera A core competence of PAA is the sourcing and manufacturing of a variety of sera products from a wide range of origins. PAA manufactures large true pool batches ensuring high levels of batch-to-batch consistency. PAA s sera portfolio comprises: Bovine sera (fetal bovine serum, newborn calf serum, calf serum, aldult bovine serum) and a variety of other animal sera and human sera. Special treatments such as gamma irradiation, heat inactivation, UV treatment, dialysis, and others are available. Special testing can be performed upon request. Reagents PAA offers a range of amino acid solutions, vitamins, antibiotics, selection antibiotics and cell detachment agents. In addition, they offer cell type specific growth supplements for hybridoma cloning, amniocyte cultivation and serum-free cell culture. Buffer solutions PAA supplies standard salt solution buffers (PBS, DPBS), balanced salt solutions (HBSS), and ph control buffers (sodium bicarbonate and HEPES). Cell culture grade water purified to EP standards is also available. Powder media for biopharmaceutical production PAA`s manufacturing plant in Austria houses a modern dry powder media production unit that meets the ongoing demands of the Biopharmaceutical Industry of the 21st century. PAA developed and implemented several new technologies, including Process Analytical Technology (PAT) for the manufacturing process of dry powder media. From raw material selection to the finished product, the whole process conforms to the FDA and EU-GMP guidelines. The latest technologies in both milling and blending provide customers with full homogeneity of powder media from 1 to 8000 kg batch sizes. PAA utilizes air classification mills that consist of an impact mill and air classifier. The high air flow rates feature temperature controlled grinding to minimize the impact on temperature sensitive components. The particle size distribution of the end product is narrow and tightly controlled by the air classifier. For excellent media solubility, the cut off is precisely defined at 250 μm. Four different conical blenders guarantee a consistent blending process from small scale up to large volume batch sizes. The result is a high quality, free flowing, easy to dissolve, and fully homogenized powder. Modern technology: GMP production processes Strictly free of animal components (ACF) Multi-channel FTIR measurement Temperature and humidity control CIP and DIP systems High flexibility: Batch sizes from 1 to 8000 kg Customized media production Pure EP/USP grade chemicals upon request Short lead time Flexible packaging and delivery options 2 Cell culture 29

30 2 Cell culture Network of competence speeds your time to market As one the world s leading cell culture companies, PAA provides expertise in the design, development and production of culture media. Combining this in-depth knowledge with the expertise of two business partners, including cloning and vector design, cell line development, media optimization, and upstream processing, the expert team offers its customers individual process optimization for every aspect of their cell culture requirements. In addition, PAA can provide support and guidance on a range of technical issues to make sure its customers achieve their milestones. ActiCHO Media System the all-inclusive CHO media kit for active cells PAA has developed a ready-to-use fed-batch and batch media system for recombinant CHO-DG44 cells. The ActiCHO Media System for easy feeding and easy scale-up provides high performance, high protein yield, and speeds up the process significantly. The ActiCHO Media System consists of the adaptation medium ActiCHO SM, the production medium ActiCHO P, and two matched feeding supplements ActiCHO Feed-A and ActiCHO Feed-B. The media and supplements do not contain hydrolysates or animal components, in compliance with regulatory demands related to virus safety. The special feature of the ActiCHO Media System is the fact that PAA offers the system as a ready-to-use starter kit. After a short adaptation phase, the defined and easy feeding strategy allows early transfer from shaker flasks to protein production on a larger scale in a bioreactor. PAA developed a level 1 starter kit for the initial testing on a 25 ml scale. The next scale up option is a level 2 test kit with enough material to run a 5 L scale fed-batch. Both liquid kits are available with or without insulin. Additionally, PAA offers a 10 L media system starter powder kit. All kit components can be purchased individually, and customized production and filling is also available. Features: Ready-to-use starter- and scale-up kit Chemically defined Significant increase in productivity Production of proteins with high potency Speeds up time to market Available ActiCHO Test Kits ActiCHO Test Kit, Level 1, with or without insulin Product Volume (ml) Units ActiCHO SM CD ActiCHO P CD ActiCHO Feed-A CD ActiCHO Feed-B CD 10 2 ActiCHO Test Kit, Level 2, with or without insulin Product Volume (ml) Units ActiCHO SM CD ActiCHO P CD ActiCHO Feed-A CD ActiCHO Feed-B CD 50 5 ActiCHO Powder Kit without insulin Product Prepares for Units ActiCHO SM Powder Base CD 5 L 1 ActiCHO P Powder Base CD 10 L 1 ActiCHO Feed-A Powder Base CD 5 L 1 ActiCHO Feed-B Powder Base CD 0.5 L 1 For more information about PAA s products and offerings, please visit or

31 Microcarrier cell culture Microcarrier selection guide Industrial-scale cell culture using microcarriers has proven to be reliable and cost-effective for the manufacture of both human and animal healthcare products including viral vaccines, interferons, and animal and human growth hormones. Microcarrier technology can reduce culture medium and serum costs by over 50%, decrease labor and lessen the risk of contamination. Interest in microcarrier technology has grown today to include in vivo use in a number of therapeutic applications. GE Healthcare supplies microcarriers for a wide range of applications for cell immobilization, particularly in the area of eucaryotic cell culture. Microcarriers can be used to grow a variety of cell types, and with different hardware investments, or production technology. Our range of microcarrier products includes Cytodex, Cytopore, and Cytoline. Quality control The entire line of microcarriers from GE Healthcare is thoroughly quality controlled, including a function test on all batches with at least one cell type. Certificates of Analysis are available. Regulatory Support Files Regulatory Support Files have been prepared for Cytodex, Cytopore and Cytoline microcarriers. These files contain information to help industrial scale manufacturers validate their own production processes. For more information, please visit 2 Cell culture Surface Macroporous High Density Macroporous Cytodex 1 & 3 Cytopore 1 & 2 Cytoline 1 Stirred tank Batch culture Stirred tank Perfusion culture Fluidized bed Perfusion culture 31

32 2 Cell culture Cytodex 1 and 3 Cytodex microcarriers are based on cross-linked dextran beads. The microporous beads are transparent, spherical and hydrated, and are substituted with positively charged groups. The microcarriers have a mean diameter of 200 µm and a density of 1.04 g/ml. Their small size allows them to be easily transported through tubing. Cytodex has been derivatized form two types, 1 and 3. Cytodex 3 has been coated with gelatine of porcine skin origin. Cytodex microcarriers are designed for use in stirred tank cultures homogeneous environments for cell growth in which culture parameters are easily monitored and controlled. Cells grow on the surface of Cytodex, which facilitates inspection, harvesting and infection of the cells. The microporosity of Cytodex enables nutrient supply to all sides of the cells. Cytodex microcarriers are autoclavable at 121 C for 20 min. Application areas Cytodex is intended for the culture of truly anchoragedependent cells, a large proportion of which are used in the production of viral vaccines. Another major application for Cytodex is in the production of recombinant proteins. Epithelial and endothelial cells connect through tight junctions and form a cellular layer around the microcarriers. Cytodex microcarriers are used in batch and perfusion systems, in stirred cultures, and WAVE Bioreactors, as well as to increase the surface area of traditional stationary monolayers and roller cultures. Transmission electron micrograph of pig kidney cells growing on Cytodex 1. (Original photograph by B. Meignier and J. Tektoff, IFFA-Mérieux, Lyon, France, reproduced with kind permission.) Cytopore 1 and 2 Cytopore microcarriers are hydrophilic DEAE exchangers with a mean diameter of 230 µm and a density of 1.03 g/ml. They are based on a cross-linked cotton cellulose matrix and have an average pore size of 30 µm. The microcarriers are both macroporous and microporous. Cells can enter the interior of the microcarrier where they are protected from shear forces generated by the stirrer, aeration, spin filter or bubbles created through sparging. The microporosity facilitates nutrient supply to all sides of the cells. Cytopore microcarriers are transparent before reaching higher cell densities and easily transported through tubing. They can be autoclaved at 121 C for 20 min. The macroporous structure of Cytopore is clearly seen on a cross-sectioned empty microcarrier. Application areas Cytopore 1 has a charge density of 1.0 meq/g and is designed primarily for the production of recombinant CHO cells in stirred tank cultures. Cytopore 2, with a charge density of 1.8 meq/g, is optimized for truly anchoragedependent cells which require a higher charge capacity for optimal cell growth. Cytopore functions well in the final stages of protein production when anchorage-dependent cells remain on the microcarriers for prolonged periods of time, protected from shear forces. Cytopore is suitable for the culture of other shear-sensitive cells including some hybridomas, insect cells and even some bacteria. Cytopore 1 cut in half, filled with CHO cells. 32

33 Cytoline 1 Cytoline microcarriers are based on a matrix of polyethylene and silica. The polyethylene makes the microcarrier hydrophobic while the silica gives it a slightly negative charge. The silica also increases the density of the microcarriers, enabling them to be used in fluidized bed cultures. Cytoline 1 has a density of 1.3 g/ml. Cytoline microcarriers are macroporous with a pore size between 10 and 400 µm. Cells gain easy access to the interior of Cytoline, where they are protected from shear forces. Since the microcarriers are not microporous, nutrients can only reach the cells through the macroporous structure. Cytoline microcarriers are lentil-shaped with a length of 2 to 2.5 mm. This size makes their transfer through tubing more difficult, but facilitates their retention in fluidized bed or perfusion cultures. Weighted Cytoline microcarriers are intended for use in fluidized bed reactors such as Cytopilot Mini, but can also be used in stirred tank, packed bed and suspension cultures. They are autoclavable at 121 C, but melt at higher temperatures. 2 Cell culture Application areas Cytoline 1 is intended for the culture of CHO cells. It can also be used for the culture of other cells that attach well, are less sensitive to shear forces, and require a high circulation rate in the reactor. Cytoline microcarriers can also be used to immobilize insect cells and bacteria. Cytoline 1 with recombinant CHO cells attached. 33

34 3ReadyToProcess ReadyToProcess Platform 36 WAVE Bioreactor systems 38 Single-use fluid management and filtration 52 ReadytoProcess connectivity 66 ReadyToProcess chromatography

35 1 2 3 ReadyToProcess 35

36 1 2 3 ReadyToProcess ReadyToProcess platform A complete suite of systems and accessories for cell culture and fermentation, separation and purification, fluid management, and connectivity, GE Healthcare s ReadyToProcess platform is designed to help you plug right into today s challenges simplifying and accelerating biopharmaceutical manufacturing, reducing timeconsuming routines, and ultimately increasing your manufacturing agility. ReadyToProcess brings seamless, scalable implementation to your biopharmaceutical operations both upstream and downstream. Flexibility, rapid response, and improved product safety are possible from start to finish. And of course our systems are manufactured to the high quality and regulatory standards you have come to expect from GE Healthcare. Easier setup and changeover, no need for cleaning and validation procedures, ReadyToProcess helps to turn downtime into uptime while also maintaining the integrity of your operations. Visit us on the web at readytoprocess 36

37 1 2 3 ReadyToProcess 37

38 1 WAVE Bioreactor systems 2 3 ReadyToProcess WAVE Bioreactor is an effective, cost efficient system for cell culture. Cells and culture medium reside within the presterilized Cellbag bioreactor. A rocking motion generates waves in the culture fluid, providing optimal mixing and gas transfer, resulting in an excellent environment for cell growth. The disposable Cellbag eliminates the need for cleaning, sterilization, and validation. Multiple instrument configurations are available for suspension, microcarrier, batch, fedbatch or perfusion culture. Visit us on the web at Features/benefits of the WAVE Bioreactors include: Convenience: Presterilized, single-use Cellbag bioreactors protect against the risk of cross-contamination, require no cleaning, involve minimal validation, and are supplied in a ready-to-use format Reliability: Cellbag based bioreactors, including all fittings and filters, are supplied sterile and ready-to-use. They are suitable for cgmp commercial production and a biosafety cabinet is not required for inoculation or sampling. Flexibility: Multiple instrument configurations for suspension, microcarrier, batch, fed-batch, or perfusion culture Versatility: The systems are capable of handling culture volumes from 100 ml to 500 L 38

39 1 Applications Monoclonal antibodies WAVE Bioreactor has been used extensively for monoclonal antibody production. Culture can be started at low volume and then fresh media added whenever the cell count is sufficiently high. This enables inoculum scale-up without transfers. Batches ranging from 100 ml to 500 L have been run with cell densities over cells/ml and productivity and product quality comparable to stirred tank bioreactors. Dissolved oxygen concentrations are not limiting and remain above 50% saturation. Anchorage-dependent cells Agitation in the WAVE Bioreactor is powerful enough to mix and aerate the culture, yet it is gentle enough to cultivate anchorage-dependent cells on various microcarriers. The wave motion prevents settling and provides oxygenation without bubbles. Virus production WAVE Bioreactor provides a closed system that is suitable for virus production. In a gene therapy application, human 293 cells have been grown in suspension and then infected with recombinant adenovirus. Cells grew to cells/ml and virus production was virus particles/cell. WAVE Bioreactor produces viruses under complete containment without the need for a biosafety cabinet. Selection guide Systems Culture volume Cellbag WAVE Bioreactor system 50 to 250 ml Cellbag 500 ml 2/10 50 to 500 ml Cellbag 1 L 2/ to 1000 ml Cellbag 2 L 2/10 20/50 + Kit ml to 5 L Cellbag 10 L 2/10 20/50 + Kit 20 1 to 10 L Cellbag 20 L 20/50 + Kit 20 1 to 10 L Cellbag 22 L 20/50 + Kit 50 5 to 25 L Cellbag 50 L 20/50 + Kit 50 5 to 50 L Cellbag 100 L to 100 L Cellbag 200 L to 250 L Cellbag 500 L 500/ Kit to 500 L Cellbag 1000 L 500/ Kit 1000 For information on using Cellbag with WAVE Bioreactor systems, see page 45. cgmp production WAVE Bioreactor is in use in cgmp applications producing inoculum for large conventional bioreactors, and also for clinical and commercial production of human therapeutics. Reduced cleaning and validation requirements make this an excellent system for cgmp applications. Insect cell/baculovirus The high oxygen supply capability of the WAVE Bioreactor makes it suitable for insect cell culture. Cell densities over cells/ml are routinely achieved. Baculovirus yields are higher than with conventional bioreactors. WAVE Bioreactor is extremely easy to operate and inoculum scale-up and infection can be done inside the bioreactor, reducing the need for transfers. Custom uses WAVE Bioreactor has many other uses, such as keeping in-process inoculum pools agitated and aerated prior to use; bead-to-bead transfer; thawing, and media mixing. Custom Cellbags can be provided for WAVE Bioreactor for any working volume between 100 ml and 500 L. Selection guide Instrumentation options Module 1 CO2 /Air Mix Controller Dissolved Oxygen Optical Monitor O2 /Air Mix Controller ph Controller Loadcell 2 Perfusion Controller 3 Description Infrared CO sensor and aeration system provides a 2 continuous supply of CO 2 conditioned air to the Cellbag Range: 0% to 12% CO 2 Monitor with miniature fiber-optic microprobes enabling real-time measurement of dissolved oxygen High accuracy PMT optical detector with phase shift measurement Range 0% to 50% O 2 Reusable DOOPT-PROBE purchased separately Provides continuous supply of O enriched gas to 2 the Cellbag for insect cell, virus, and high cell density applications. Maintains low-oxygen environment for near-anaerobic applications Range 0% to 50% O 2 Enables continuous ph measurement and control using CO 2 or acid/base addition. Embedded optical ph sensor is single use, and available pre-installed in Cellbags. Enables online measurement of weight. Used for automated fill/harvest and perfusion operations where precise volume control is critical. Perfusion controller with Loadcell 1 Instrument Modules are available in WAVEPOD II for 2/10 and 20/50 system. Fully integrated modules are available for 200 and 500/1000 system. 2 Fully integrated in 20/50 system (option); 200 and 500/1000 system (standard). 3 For 2/10 system instrument only. 2 3 ReadyToProcess 39

40 1 2 Overview Systems Specifications 500/1000 system 2,3 200 system 2 20/50 system 1 2/10 system Working volume range Integral features 50 to 500 L 5 to 100 L 0.1 to 25 L 0.05 to 5 L Speed/angle control Temperature control Aeration Loadcell Speed/angle control Temperature control Aeration Loadcell Speed/angle control Temperature control Aeration Speed/angle control Temperature control Aeration 3 ReadyToProcess Options CO2MIX O2MIX DO ph Weight with Kit 500: 925 kg with Kit 1000: 1020 kg Dimensions cm with Kit 500: cm with Kit 1000: cm CO2MIX O2MIX DO ph Dual air/temperature WAVEPOD II controller CO2MIX O2MIX DO ph Loadcell Dual air/temperature 350 kg 16 kg 4.2 kg cm For installation, if required, unit can be tilted mm with Kit 20: mm with Kit 50: mm CO2MIX O2MIX DO ph Perfusion controller mm Power 200 to 240 VAC 50/60 Hz, 30 A 3-Phase Phase-phase ± 5% NEMA L2130 plug 200 to 240 VAC 50/60 Hz, 15 A 3-phase Phase-phase ± 5% NEMA L2130 plug 100/240 VAC 50/60Hz, 6/3 A 100/240 VAC 50/60Hz, 4 A 1 20/50 system requires selection of Cellbag Holder Kit 20 or Unit provided with casters /1000 system requires selection of Cellbag Holder Kit 500 or All BASE units are CE/CSA certified. 40

41 WAVE Bioreactor 500/1000 system Ordering information Product Quantity SYSTEM1000EH with DO SYSTEM1000EH with CO2, O2, DO, PH, ANALOG SYSTEM1000EH with O2, DO, ANALOG SYSTEM1000EH with CO2, O2, DO, PH SYSTEM1000EH with O2, DO SYSTEM1000EH with CO2, PH KIT500EH for Base 500/1000EH 1 (includes HOLDER500 and HEATERPAD500) KIT1000EH for Base 500/1000EH 2 (includes HOLDER1000 and HEATERPAD1000) WAVE Bioreactor 500/1000 system comprises integral rocking, temperature, weight, and airflow controllers. The self-contained system is designed for use with working culture volumes of between 50 and 500 L in applications such as inoculum scale-up, R&D, process development, GMP production, vaccine production, and antibody manufacture. For additional flexibility, optional modules including DO, CO 2, O 2, weight/perfusion, and ph control can be added while built-in Ethernet and MODBUS data ports allow interfacing with Windows-based PC software for data logging and daisy chaining with other WAVE Bioreactor systems and instrument modules. Features of the system include: Touch panel operator interface Direct drive electronic linear motor Adjustable rocking rate from 4 to 25 rocks/min with acceleration control Adjustable rocking angle from 0.5 to 4 Integral temperature controller with heater Integral weight controller Integral airflow controller Integral PID controller for automatic temperature, O 2, CO 2, and ph adjustment Real-time data monitoring RS-485 MODBUS communications port 10Base-T Ethernet communications port Remote alarm contact and printer interface Stainless-steel containment enclosure CO2 = CO 2 -air gas mix controller, O2 = O 2 -air gas mix controller, DO = Dissolved oxygen monitor (optical), PH = ph controller, ANALOG = Analog output card 1 Accomodates L Cellbag only. 2 Accomodates L Cellbag only. Technical specifications Dimensions (L W H) Base unit: cm ( in) With KIT500EH: cm ( in) With KIT1000EH: cm (89 91 in 63 in) Weight Utilities Environmental Base unit: 700 kg (1500 lb) With KIT500EH: 925 kg (2000 lb) With KIT1000EH: 1020 kg (2250 lb) Voltage: / VAC Frequency: 50/60 Hz Maximum current: 15 A Power: 12 KVA This equipment is designed for use under the following conditions: Indoor use 5 C to 40 C Up to 80% maximum relative humidity (rh) at 31 C decreasing linearly to 50% rh at 40 C For information on using Cellbag with WAVE Bioreactor systems, see page 45. Visit us on the web at ReadyToProcess 41

42 1 2 3 ReadyToProcess WAVE Bioreactor 200 system Ordering information Product Quantity SYSTEM200EHDual with DualTemp, DualAir SYSTEM200EHDual with CO2, ANALOG SYSTEM200EHDual with CO2, O2, DO SYSTEM200EHDual with CO2, O2, ANALOG SYSTEM200EHDual with CO2, O2, DO, ANALOG SYSTEM200EHDual with CO2, phopt, ANALOG SYSTEM200EHDual with CO2, O2, DOOPT, phopt, ANALOG SYSTEM200EH with CO SYSTEM200EH with CO2, O SYSTEM200EH with CO2, O2, ANALOG SYSTEM200EH with CO2, O2, DO, ANALOG SYSTEM200EH with O2, DO, ANALOG SYSTEM200EH with CO2, phopt, ANALOG SYSTEM200EH with CO2, O2, DOOPT, phopt, ANALOG CO2 = CO 2 -air gas mix controller, O2 = O 2 -air gas mix controller, DO = Dissolved oxygen monitor (optical), PH = ph controller, ANALOG = Analog output card, phopt = ph controller, DOOPT = dissolved O 2 controller WAVE Bioreactor 200 system comprises integral rocking, temperature, weight, and airflow controllers. The selfcontained system is designed for use with working culture volumes of between 10 and 100 L in applications such as inoculum scale-up, R&D, GMP production, vaccine production, and antibody manufacture. For additional flexibility, optional modules including DO, CO 2, O 2, weight/ perfusion, and ph control can be added while builtin Ethernet and MODBUS data ports allow interfacing with Windows based PC software for data logging and daisy chaining with other WAVE Bioreactor systems and instrument modules. Features of the system include: Touch panel operator interface Direct drive electronic linear motor Adjustable rocking rate from 4 to 25 rocks/min with acceleration control Adjustable rocking angle from 2 to 9 Integral temperature controller with heater Integral weight controller Integral airflow controller Integral PID controller for automatic temperature, O 2, CO 2, and ph adjustment Real-time data monitoring RS-485 MODBUS communications port 10Base-T Ethernet communications port Remote alarm contact and printer interface Stainless-steel containment enclosure Technical specifications Dimensions (L W H) mm ( in) Weight Utilities Environmental 350 kg (780 lb) Voltage: / VAC Frequency: 50/60 Hz Maximum current: 15 A Power: 12 KVA This equipment is designed for use under the following conditions: Indoor use 5 C to 40 C Up to 80% maximum relative humidity (rh) at 31 C decreasing linearly to 50% rh at 40 C For information on using Cellbag with WAVE Bioreactor systems, see page 45. Visit us on the web at

43 WAVE Bioreactor 20/50 system WAVE Bioreactor 20/50 system is a versatile, modular system designed for R&D and production use. It consists of a base unit with various options suitable for culture of multiple cell lines. WAVE Bioreactor 20/50 system has an extensive line of instrumentation, including weight controllers for perfusion culture, dissolved oxygen amplifiers, and ph controllers for use with working culture volumes between 100 ml and 25 L. WAVE Bioreactor 20/50 system can be used with the WAVEPOD II controller, which provides simplified control of all culture parameters including oxygen, ph, and CO 2 /O 2 gas mixing in a single module. For benchtop operation, covering the Cellbag with a lid is recommended. A filter heater for the exhaust filter is strongly recommended otherwise water will condense in the filter and may lead to clogging and overpressure in the bag. Features of the system include: Adjustable rock rate 2 to 40 rocks/min Adjustable rock angle from 2 to 12 Integral temperature control Integral aeration control Simplified system control when used with WAVEPOD II controller (see page 48) Ordering information Product Quantity BASE20/50EHT V BASE20/50EHT V BASE20/50EHT V with Loadcell BASE20/50EHT V with Loadcell BASE20/50EHT Dual V BASE20/50EHT Dual V BASE20/50EHT Dual V with Loadcell BASE20/50EHT Dual V with Loadcell BASE20/50EHT V with CO BASE20/50EHT V with CO BASE20/50EHT V with CO2, Loadcell BASE20/50EHT V with CO2, Loadcell BASE20/50EHT V with O BASE20/50EHT V with O BASE20/50EHT V with O2, Loadcell BASE20/50EHT V with O2, Loadcell KIT20EHT V KIT20EHT V KIT20EHT Dual V KIT20EHT Dual V KIT50EHT V KIT50EHT V KIT50EHT Dual V KIT50EHT Dual V LID20 - Clear LID20W - White LID50 - Clear LID50W - White CO2 = CO 2 -air gas mix controller, O2 = O 2 -air gas mix controller, Dual = independent control of two individual Cellbag bioreactors, Loadcell = measure Cellbag bioreactor weight during rocking. Technical specifications Dimensions (L W H) Weight Utilities Environmental Base unit: mm ( in) With KIT20EHT: mm ( in) With KIT50EHT: mm ( in) (for Loadcell models, add 32 mm to height dimension) Base unit: 16 kg (35 lb) Voltage: / VAC Frequency: 50/60 Hz Power: 630 VA This equipment is designed for use under the following conditions: Indoor use 4 C to 40 C < 95% rh, non-condensing ReadyToProcess For information on using Cellbag with WAVE Bioreactor systems, see page 45. Visit us on the web at

44 1 2 WAVE Bioreactor 2/10 system Ordering information Product Quantity BASE2/10EH /10 system Perfusion Controller LID2/10W - Opaque Technical specifications 3 Dimensions (L W H) Weight mm ( in) 4.2 kg (9 lb) ReadyToProcess WAVE Bioreactor 2/10 system is a compact unit fitted with integral features such as an air pump with a mass flow meter and a temperature control with a heater and sensor. Options include weight controllers for perfusion culture and dissolved oxygen amplifiers. Multifunction control enables adjustment of rocking angle, speed, and aeration rate. The system is for use with working culture volumes between 100 ml and 5 L. Utilities Environmental Voltage: / VAC Frequency: 50/60 Hz Maximum Current: 4 A Power: 145/210 VA This equipment is designed for use under the following conditions: Indoor use 5 C to 30 C with lid, 15 C to 30 C without lid < 95% rh, non-condensing For information on using Cellbag with WAVE Bioreactor systems, see page 45. Visit us on the web at Features of the system include: Adjustable rock rate 3 to 40 rocks/min Adjustable angle from 2 to 9 Integral air pump with mass flow meter RS-485 communications port LCD display and control interface Temperature control with heater and sensor 44

45 Cellbag bioreactors Reproduced with kind permission of Pacifi cgmp, USA. Designed for use with the WAVE Bioreactor system, Cellbag bioreactors are presterilized, single-use bags for the non-invasive mixing of culture medium and cells during cultivation in research, development, and cgmp manufacturing operations. As part of the ReadyToProcess platform of single use products, Cellbag bioreactors require no sterilization or cleaning steps and provide a suitable environment for cell growth while minimizing the risk of cross-contamination. They are manufactured from multilayered, laminated, clear USP Class VI plastics and are easily coupled to the full suite of ReadyToProcess cell culture, purification, and fluid handling products. Cellbag bioreactors deliver: Ease-of-use: Cellbag bioreactors are presterilized and disposable, requiring neither cleaning nor validation and thus eliminating the risk of cross-contamination Robustness: The bags are manufactured from multilayer laminated, clear plastic films designed to provide mechanical strength and bio-inert fluid contact Biocompatibility: Fluid contact layer is an ethylene vinyl acetate (EVA)/low density polyethylene copolymer and the outer non-contact layer is made of low density polyethylene Customization: Cellbag bioreactors can be readily customized for user-specified connectors, tube sets, and special components All Cellbags have air inlet and outlet filters, a needleless sampling port, an Oxywell2 dissolved oxygen probe insertion port, and a fill/harvest port. However, Cellbags can be customized with optional fittings such as ph probes, dip tubes, screw cap ports, temperature ports, perfusion filters, and special tubing ports. The Cellbag size you need depends on the culture volume to be cultivated. Selection guide Cellbag Cellbag Outlet air filter Inoculation/harvest lines Cellbag rod Culture volume 2/10 system Cellbag 500 ml 50 to 250 ml Cellbag 1 L 50 to 500 ml Cellbag 2 L 100 to 1000 ml Cellbag 10 L 500 ml to 5 L Cellbag 20 L 1 to 10 L 20/50 system Cellbag 22 L 1 to 10 L Cellbag 50 L 5 to 25 L 200 system Cellbag 100 L 5 to 50 L Cellbag 200 L 10 to 100 L Visit us on the web at 500/1000 system Kit 20 Kit 50 Kit 500 Kit 1000 Cellbag 500 L 50 to 250 L Cellbag 1000 L 100 to 500 L Inlet air filter Oxywell2 Needleless sampling port Spare Luer port/ optional ph probe ReadyToProcess 45

46 1 2 3 ReadyToProcess Ordering information Product Quantity Cellbag 500 ml 1 CB500ML10-01 Cellbag 1 L 1 CB0001L10-01 Cellbag 2 L 1 CB0002L10-01 Cellbag 2 L (Oxywell2 version) 1 CB0002L10-02 Cellbag 2 L (screwcap version) 1 CB0002L10-03 Cellbag 2 L (perfusion version) 1 CB0002L10-04 Cellbag 2 L (Fibra-Cel version) 1 CB0002L10-07 Cellbag 2 L (phopt version) 1 CB0002L10-11 Cellbag 2 L (phopt and screwcap version) 1 CB0002L10-13 Cellbag 2 L (phopt and perfusion version) 1 CB0002L10-14 Cellbag 2 L (ReadyMate version) 1 CB0002L10-21 Cellbag 10 L 1 CB0010L10-01 Cellbag 10 L (Oxywell2 version) 1 CB0010L10-02 Cellbag 10 L (screwcap version) 1 CB0010L10-03 Cellbag 10 L (perfusion version) 1 CB0010L10-04 Cellbag 10 L (Fibra-Cel version) 1 CB0010L10-07 Cellbag 10 L (phopt version) 1 CB0010L10-11 Cellbag 10 L (phopt and screwcap version) 1 CB0010L10-13 Cellbag 10 L (phopt and perfusion version) 1 CB0010L10-14 Cellbag 10 L (ReadyMate version) 1 CB0010L10-21 Cellbag 20 L 1 CB0020L10-01 Cellbag 20 L (Oxywell2 version) 1 CB0020L10-02 Cellbag 20 L (screwcap version) 1 CB0020L10-03 Cellbag 20 L (perfusion version) 1 CB0020L10-04 Cellbag 20 L (Fibra-Cel version) 1 CB0020L10-07 Cellbag 20 L (phopt version) 1 CB0020L10-11 Cellbag 20 L (phopt and screwcap version) 1 CB0020L10-13 Cellbag 20 L (phopt and perfusion version) 1 CB0020L10-14 Cellbag 20 L (ReadyMate version) 1 CB0020L10-21 Cellbag 22 L (Oxywell2 version) 1 CB0022L10-02 Cellbag 22 L (Fibra-Cel version) 1 CB0022L10-07 Cellbag 22 L (phopt version) 1 CB0022L10-11 Cellbag 22 L (ReadyMate version) 1 CB0022L10-21 Cellbag 50 L 1 CB0050L10-01 Cellbag 50 L (Oxywell2 version) 1 CB0050L10-02 Cellbag 50 L (perfusion version) 1 CB0050L10-04 Cellbag 50 L (Fibra-Cel version) 1 CB0050L10-07 Cellbag 50 L (phopt version) 1 CB0050L10-11 Cellbag 50 L (phopt and perfusion version) 1 CB0050L10-14 Cellbag 50 L (ReadyMate version) 1 CB0050L10-21 Cellbag 100 L (Oxywell2 version) 1 CB0100L10-02 Cellbag 100 L (phopt version) 1 CB0100L10-11 Cellbag 200 L (Oxywell2 version) 1 CB0200L10-02 Cellbag 200L (phopt version) 1 CB0200L10-11 Cellbag 500 L (ph version) 1 CB0500L10-05 Cellbag 1000 L (ph version) 1 CB1000L10-05 Clave sampling valve on 6.4 mm O.D. C-Flex tubing 1 TK001 PVC tubing with press-in plug 1 TK002 Tube Kit, PVC and silicone tubing with T-connectors 1 TK003 Check valve, 250 L (pack of 25) 1 WV Check valve, 100/200 L (pack of 50) 1 WV Technical specifications Typical connectors Air inlet: 0.2 µm gas filter Air outlet: 0.2 µm gas filter with check valve Sampling: Needleless self-sealing syringe port. No laminar hood required Fill/harvest: C-Flex tubing suitable for sterile fusing terminated with Luer, MPC couplings or ReadyMate connectors Multiuse: Luer port with cap Oxywell2: Silicone sheath for DO probe ph: ph probe port and phopt patch Biocompatability Testing is performed on irradiated film (50 kgy): USP XXII plastic class VI and ISO 10993: ISO Hemolysis study in vivo extraction method ISO Cytotoxicity study using ISO elution method ISO Muscle implantation study in rabbit ISO Acute intracutaneous reactivity study in rabbit ISO Acute systemic toxicity in mouse Sterility and endotoxin Sterilized by gamma radiation at 25 to 40 kgy Lot release requires < EU/mL endotoxin Temperature rating Cellbags may be used from 0 C to 50 C Pressure rating Maximum operating pressure 1.5 psig (0.1 bar) Mechanical strength Film seal strength > 67 N/cm 46

47 UNICORN DAQ 1.0 Ordering information Product Quantity UNICORN DAQ Converter Computer and networking specifications Hardware Recommendations 1 2 PC Memory 2.5 GHz processor For Windows XP: 512 MB RAM For Windows 7: 2 GB RAM 3 Hard disk Monitor Converter 100 Drives Peripherals For Windows XP: 1 GB available hard disk space For Windows 7: 2 GB available hard disk space Double hard disk and RAID controller recommended Color monitor: pixels, small fonts, 64 k colors Requires 10 Mbps network card (not supplied) CD ROM Mouse ReadyToProcess UNICORN DAQ software facilitates online data acquisition for the management and evaluation of results from cell cultures performed in WAVE Bioreactor systems, part of the ReadyToProcess platform. Up to four different WAVE Bioreactor systems can be simultaneously connected to a single PC or networked to the software providing a common platform for acquiring, monitoring, and storing result data. A dynamic graphical user interface informs the user about the real time status of the run being monitored while data are automatically saved to a local hard drive or server in a secure and unalterable result file for added security. A common platform and user interface for all culture volumes simplifies scale up. Modular format for easier navigation UNICORN DAQ software comprises three program modules that automatically open at logon. Data acquisition is set up and started in UNICORN Manager and monitored in the System Control module while result data are managed using the Evaluation module. Software requirements Item Operating system Recommendation Windows XP Professional x32 or Windows 7 Professional x32 Opened result files are displayed in the Evaluation module window. Visit us on the web at

48 1 WAVEPOD II Integrated Controller for WAVE Bioreactor 20/50 system 2 3 ReadyToProcess WAVEPOD II Integrated Controller integrates instrumentation associated with the WAVE Bioreactor 20/50 system for the setup, control, and monitoring of cell culture parameters in Cellbag bioreactors. Multiple configurations of the WAVEPOD II controller are available to meet individual cell culture needs and a large color touchscreen provides easy access to all operations, data, and alarm conditions from the integrated control modules. WAVEPOD II is available with a choice of control modules to meet your specific cell culture needs. By coordinating the functions of individual control modules, you can develop complex schemes for the precise measurement and control of culture conditions. Detailed features include: ph: The ph controller enables online measurement and control of ph using an optical ph sensor preinstalled in Cellbag bioreactors. The ph controller incorporates a set point controller to power PUMP20 units or to switch user-supplied base and acid pumps on and off to maintain and control ph. Alternatively, ph can be maintained by controlling CO 2 concentration. DOOPT: The dissolved oxygen (DO) monitor controller provides amplification, display, and data transmission of DO concentration allowing real-time measurement of DO concentration inside the Cellbag bioreactor. The DO monitor controller was designed for use with miniature fiber-optic dissolved oxygen probes (DOOPTPROBE), and it can increase the rocking rate automatically to maintain online control of DO. O2MIX: The O 2 /air mix controller connects to a supply of oxygen (and low pressure N 2 supply if required) to provide O 2 /air concentrations between 0% and 50% O 2. The instrument controls enriched oxygen levels for insect cell/ baculovirus and high culture density applications and it is also useful for maintaining low-oxygen environments for near-anaerobic applications. CO2MIX: The CO 2 /air mix controller connects to a supply of 100% CO 2 to provide CO 2 /air concentrations between 0% and 15% CO 2. The instrument is useful for ph control of bicarbonate buffered cell culture media. Airflow: The Airflow controller can be used as a standalone module for Cellbag bioreactor aeration or as a conditioned gas supply to a WAVE Bioreactor 20/50EHT system. The flow of ambient or processed air is measured by a thermal mass flow sensor and regulated by a flow control valve operated by an internal controller. Air flow measurement and control When running WAVEPOD II in LOCAL mode Air flow measurement range 0 to 1 L/min Air flow control range Operating pressure, system air inlet Process gas Bag pressure 0.05 to 1.00 L/min Ambient air, no over pressure 10 to 20 kpa (1 to 3 psi) CO 2 measurement and control CO 2 mix, measurement range 0% to 20% CO 2 mix, measurement accuracy controlled by pressure relief valve at bag ± 0.5% CO 2 for 0% to 5% CO 2 ± 10% of reading for 5% to 12% CO 2 (0.5% to 1.2% CO 2 ) Ambient temperature variation dependency: ± 0.05% CO 2 / C temp deviation CO 2 mix, control range 0% to 15% ± 0.5% CO 2 for 0% to 5% CO 2 ± 10% of reading for 5% to 12% CO 2 (0.5% to 1.2% CO 2 ) Ambient temperature variation dependency: ± 0.05% CO 2 / C temp deviation CO 2 inlet specifications 100% CO 2 Inlet pressure to system: 0.7 to 1.0 bar Min flow rate: 0.2 L/min for full CO 2 specification 48

49 O 2 measurement and control O 2 mix, measurement range 0% to 50% Default 21% to 50% Note: N 2 is required for delivery of O 2 < 20.9% O 2 mix, displayed measurement resolution 0.1% O 2 mix, measurement accuracy ± 1.0% O 2 for 21% to 50% O 2 O 2 mix, control range 0% to 50% O 2 mix, control accuracy ± 1.0% O 2 for 21% to 50% O 2 Inlet pressure to system 0.7 to 1.0 bar Min flow rate Temperature measurement and control Liquid temperature control range 0.6 L/min for full O 2 specification. Min: Ambient temperature 5 C Max: 40 C Accuracy at equilibrium conditions ± 0.1 C (exclusive of measurement accuracy) Precision at equilibrium conditions ± 0.2 C (exclusive of measurement accuracy) Readout of process value (PV) from BASE 20/50 unit ph measurement and control ph measurement range ph 4.5 to 8.5 ph control range ph 6 to 8 ph accuracy within control range * Offset calibration to be done at the setpoint ph ± 0.05 ph within 0.25 ph from offset calibration ph*, ± 0.10 ph within 0.25 to 0.5 ph from offset calibration ph* Ordering information Product Quantity WAVEPOD II with CO2, O2, phopt, DOOPT WAVEPOD II with CO2, phopt WAVEPOD II with O2, DOOPT DOOPT-Probe RTD Probe CO2 = CO 2 -air gas mix controller, O2 = O 2 -air gas mix controller, phopt = ph controller, DOOPT = dissolved O 2 controller Technical specifications Dimensions mm Weight 13.6 kg Communications RJ12-6 for connecting WAVE bioreactor base RJ12 Converter 100 RJ45 AUX jack Two DB9 jacks for connecting acid/base pumps DB15 alarm jack Utilities Voltage: / VAC, (auto switching) Frequency: 50/60 Hz Power: 200 VA Environmental Operating conditions: 5 C to 40 C Operating humidity: 10% to 90% noncondensing Storage conditions: -20 C to 60 C Pollution degree rating: 1 Ingress protection (IP) rating: 32 Indoor use only ReadyToProcess Visit us on the web at

50 1 2 3 ReadyToProcess WAVE Mixer WAVE Mixer makes it possible to mix materials contained in bags under sterile conditions. The rocking platform induces a wave motion in the liquid without an impeller or other invasive mixer. WAVE Mixer has been optimized for efficient mixing and dispersion of up to 35 L of liquid, in a choice of 20 or 50 L M*Bags, and 10 L of liquid can be mixed to homogeneity in less than 7 s. WAVE Mixer performs a number of functions including: Thawing Pooling Mixing Media and buffer preparation Ordering information Product Quantity MIXER 20/50EHT V MIXER 20/50EHT V MIXER 20/50EHT V with Loadcell MIXER 20/50EHT V with Loadcell MIXKIT MIXKIT20EH V MIXKIT20EH V MIXKIT MIXKIT50EH V MIXKIT50EH V MIXHOLDER MIXHOLDER MIXLID Technical specifications WAVE Mixer Dimensions (L W H) Weight Utilities Environmental mm (6.8 x 19.8 x 15 in) with MIXKIT50EHT: 355 (incl. M*Bag) mm (14 x 25 x 29.1 in) with MIXKIT20EHT: 295 (incl. M*Bag) mm (11.6 x 17.7 x 25.7 in) 18 kg (36 lb) Storage conditions -40 C to 80 C Voltage: / VAC Frequency: 50/60 Hz Power: 630 VA This equipment is designed for use under the following conditions: Indoor use 15 C to 35 C < 90% rh, non-condensing WAVE Mixer features include: Disposable, single-use system for mixing liquids without the need for a mixing tank or conventional mixer No equipment cleaning, sterilization, validation, or crosscontamination Mixes liquid volumes from 1 to 35 L in 20 and 50 L mixing bags. Larger bag sizes are available on request. All M*Bag Mixing Chambers are provided with a large screw cap port for the easy addition of powders and solids M*Bag Film Biocompatability Fluid contact layer: medical grade low density polyethylene (LDPE) Non-contact outer layer: LPDE + EVA or nylon/evoh copolymer Testing is performed on irradiated film at 50 kgy USP XXII plastic class VI test and ISO Acute intracutaneous reactivity study in rabbit ISO Acute systemic toxicity in mouse ISO Muscle implantation study in rabbit ISO Cytotoxicity study using ISO elution method ISO Hemolysis study in vitro, extraction method ISO M*Bag allows ingredients to be mixed and dissolved using the WAVE Mixer. Made of a multilayer, laminated clear plastic, the outer layer provides high mechanical strength and a gas-impermeable barrier while the fluid contact layer is typically a medical grade, low-density polyethylene. A large screw cap port allows powders or other solids to be easily poured into the bag, and also a probe (to measure ph) to be inserted. A large outlet port allows the M*Bag to be drained completely. Maximum operating pressure 0.1 bar Temperature rating M*Bags may be used from 0 C to 50 C Endotoxin Lot release requires < EU/mL endotoxin 50

51 Application guide WAVE Mixer Mixer 20/50ET In-process blending In-process intermediates can be mixed and various ingredients can be added. In-process pooling In-process samples collected during chromatography or other operations can be pooled together in a single bag and mixed to form a homogeneous intermediate for sampling and further processing. Blending for sampling Mixing stored materials in bags in order to obtain a representative sample for stability and process optimization studies. Mixing prior to fill Mixing stored or collected product prior to dispensing in to final vials, bags, or other containers. Mixing the bag ensures each aliquot is identical. Using the bag as the mixing container ensures sterility and GMP operation. Reconstitution and dissolution Preparation of media from powdered and concentrated components and preparation of sterile buffers. In process reactions Reactions can be carried out in the bag. This may involve adding oxidants or reductants. The headspace in the bag can be controlled to maintain the desired oxygen level. Mixer 20/50EHT Thawing of frozen materials. Warming blood and other biological fluids. Maintaining temperature during pooling operations ReadyToProcess Visit us on the web at

52 1 2 Single-use fluid management and filtration 3 ReadyToProcess ReadyCircuit assemblies simplify and speed up bioprocessing. For biopharmaceutical companies, CMOs, and startups, this enables accelerated development and reduced up-front investment manufacturing agility increases, opening doors to new business opportunities. Benefits of ReadyCircuit bags and tubing assemblies: Quickly configure and assemble a wide range of sterile, fluid-processing circuits Dispose of entire circuit after processing, thereby eliminating cleaning and cleaning validation costs Enables development of products without a large capital investment in manufacturing systems Available in a wide range of capacities and pore selections, ReadyToProcess filters include single-use cartridges for both cross flow filtration (CFF) and normal flow filtration (NFF) operations. Preconditioned, sterile, and ready for immediate use, they cut unnecessary downtime as they minimize preparation steps as well as eliminate associated cleaning protocols and cleaning validation. Applications include aseptic processing; clarification, ultrafiltration, and diafiltration in vaccine and MAb production; media filtration; and NFF prefiltration for bioreactors and columns. ReadyCircuit assembly components and associated equipment are conveniently organized on ReadyKart mobile processing station - a configurable cart that mechanically supports and enhances the use of ReadyToProcess fluid processing products. ReadyKart stations offer versatility, simplification, and efficiency by ergonomically placing ReadyCircuit assemblies and associated equipment within easy reach of the user. Visit us on the web at

53 1 ReadyCircuit assemblies ReadyCircuit assemblies simplify system assembly and reduce cleaning and cleaning validation costs. They also reduce the time span between finishing one batch and starting the next. Versatility Versatility is the hallmark of the ReadyCircuit family, enabling you to design and build almost any fluid processing circuit you can imagine. For example, you can easily assemble fully functional CFF or NFF biofiltration systems including pressure, temperature and conductivity sensors. You can select from over 250 standard bag, tubing, sensor, and filter components: Bag assemblies from 250 ml to 200 L Manifold/tube assemblies Sensor assemblies Cross flow filtration assemblies Normal flow filtration assemblies Advantages for your application ReadyCircuit assemblies offer distinct advantages in many applications: Aseptic clarification and purification of vaccines and monoclonals Antibodies, recombinant proteins, and plasmids Aseptic cell processing Environments where terminal sterilization is not feasible Preclinical through Phase II clinical trials Areas where the risk of cross contamination is high Fast-track drug development processes Small to midsize CMOs, biotech, and biopharmas seeking lean solutions or having concerns about crosscontamination in preclinical, Phase I and Phase II trials 2 3 ReadyToProcess 53

54 1 ReadyCircuit bags Tube assemblies 2 3 ReadyToProcess ReadyCircuit bags offer scale-up capability that simplifies development continuity. Bag types include: Sample bags for small volume applications 50 L horizontal pillow bag 1 to 20 L pillow bags for vertical or horizontal use on mobile carts 100 to 200 L 3D bags for large-scale production ReadyCircuit bags have inlet and outlet ports and are supplied sterile with ReadyMate disposable aseptic connectors. Port configuration varies by bag type. Basic tubing assemblies consist of lengths of tubing with ReadyMate disposable aseptic connectors at each end. Other ReadyCircuit tubing assemblies include tubing or aseptic connectors integrated with components such as tees, pressure sensors, reducers, and so on. A combination of ReadyCircuit tubing assemblies can be ordered to meet specific processing needs. Preconfigured kits consisting of tubing assemblies, bags, and sensors are also available to meet many standard fluid processing objectives. Some circuits and assemblies include TC and Steam-Thru adapters commonly used to connect disposable fluid paths to stainless steel process equipment. Technical specifications Storage of unfilled products: Temperature = -20 C to 45 C Storage of 2D bags filled with process fluids: Temperature = -80 C to 45 C Shelf-life at 1 C to 45 C = 30 d Shelf-life at -80 C to 0 C = 3 y Storage of 3D bags filled with process fluids: Temperature = 2 C to 45 C Shelf-life at 2 C to 45 C = 30 d Technical specifications Pressures tubing in tubing assemblies Maximum working pressures for the three types of tubing found in ReadyCircuit components: C-Flex = 1 bar (15 psi) at 20 C Reinforced (AdvantaPure) = 4 bar (60 psi) at 20 C Pump tubing (PumpSil) 6.3 to 9.1 mm (1/4 to 3/8 in) = 1.7 barg (25 psig) at 20 C Pump tubing (PumpSil) 12.7 to 19 mm (1/2 to 3/4 in) = 1 barg (15 psig) at 20 C For ordering information, contact your local GE Healthcare sales representative 54

55 Sensor assemblies ReadyCircuit sensors are tubing assemblies integrated with temperature, pressure, and conductivity sensors. The sensor assemblies use ReadyMate disposable aseptic connectors. Sensors are compatible with SciLog BioProcessing Systems SciTemp, SciPres, and SciCon monitors. For ordering information, contact your local GE Healthcare sales representative Technical specifications SciTemp Flow-Thru temperature sensor specifications Material, Fluid Contact: medical grade polysulfone meets USP <88> Class VI and FDA 21CFR All Wetted Materials are made of animal-free compounds. Compatible with most sanitizing agents such as NaOH or hypochlorite. Sensors can be repeatedly autoclaved. Sensor type: Thermistor, Epoxy-Coated, 2252 Ω Temperature range: -10 C to 125 C Temperature accuracy: ± 0.10 C in the 4 C to 70 C range Temperature display resolution: two decimal places (0.01 C) Sensor connectors: lockable and waterproof Sensor microchip: EPROM-stored sensor ID and calibration factor SciPres Flow-Thru pressure sensor specifications Material, Fluid Contact: medical grade polysulfone meets USP <88> Class VI and FDA 21CFR All wetted materials are made of animal-free compounds. Compatible with most sanitizing agents such as NaOH and hypochlorite, for flow cell sanitization. Can be sterilized. Autoclavable and gamma stable. Sensor type: medical grade, silicone piezo-resistive sensing element with on-chip temperature compensation Sensor isolation: insoluble silicone dielectric gel isolates sensing element from process solution. The gel is a non-toxic, non-allergenic elastomer system that meets all USP Biological Safety, Class VI plastics requirements. Pressure range: 0.34 to 4.1 barg (-5 to 60 psig) Pressure accuracy: ± 0.02 barg (± 0.30 psig) Pressure resolution: barg (0.01 psig) Temperature range: 0 C to 60 C Sensor microchip: EPROM-stored sensor ID and calibration factor Sensor connector and cables: lockable and waterproof SciCon Flow-thru conductivity sensor specifications Material, Fluid Contact: natural polypropylene (PP) or polysulfone (PS) w/gold electrodes; medical grade meets USP <88> Class VI and FDA 21 CFR All wetted materials are made of animalfree compounds. Compatible with most sanitizing agents such as NaOH and hypochlorite, for flow cell sanitization. Can be sterilized: autoclavable and Gamma stable. Sensor type: 4-electrode conductivity cell, factory calibrated, readyto use Conductivity range: 1 to 200 ms/cm. Resolution: 0.1 S/cm. Accuracy: high range: ± 0.25 ms in the 10 to 200 ms range. Low range: ± 3 μs in the 0 to 100 μs range. Temperature range: 4 C to 50 C Temperature probe: thermistor, factory calibrated Temperature accuracy: ± 0.5 C Sensor microchip: EPROM-stores device ID, cell constant, temp offset and factory calibration data Precalibration: 47 μs at 25 C using standard traceable to NIST Sensor connector and cables: lockable and waterproof ReadyToProcess 55

56 1 2 3 ReadyToProcess Custom ReadyCircuit assemblies GE Healthcare s ReadyToProcess standard product platform consists of over 240 bag, tubing, filter, and sensor assemblies. Complementing this, GE Healthcare ReadyToProcess specialists can assemble these components, or components of your choosing, into a customized, presterilized, single-use fluid management solution. Customized assemblies can also be configured using our online configurator tool. Custom ReadyCircuit assemblies incorporate all of the design control and quality management systems as incorporated in our standard products. The flexibility of single use products and the flexibility of the GE Healthcare team, allow for an optimized fluid management solution for specific requirements. Custom ReadyCircuit assembly components Custom ReadyCircuit assemblies can be configured from standard components. Bags: sizes available from 250 ml to 1000 L Tubing: C-Flex, Pumpsil and reinforced Silicone. Virtually any tubing length or dimensions can be specified, as well as alternative tubing types. Connectors, disconnects and tubing accessories: ReadyMate genderless DAC is available in six different configurations for maximum tubing flexibility. Aseptic disconnectors are available to meet tubing size requirements of 1/8 to 3/4 in. A full variety of tubing reducers, Ts and Ys are available Sensors: Flowthrough temperature, pressure, and conductivity sensors compatible with SciLog BioProcessing Systems can be configured into ReadyCircuit systems. Filters: A wide variety of normal flow and cross flow hollow fiber filters can be used to configure a custom ReadyCircuit solution. Additional components such as pumps and valves can be designed into a system. The fully assembled custom ReadyCircuit solution can be designed to fit onto ReadyKart for full mobile processing and ease of use. Applications for custom ReadyCircuit assemblies Cell harvest Ultrafiltration/ diafiltration Media preparation and storage Buffer preparation and storage Transfer systems for cell culture inoculation, media addition, ph adjust, or any transfer requiring assurance of aseptic delivery Chromatography buffer supply Bulk drug filling and storage Sampling Protein concentration Virus concentration Bulk drug substance formulation Speed, robustness, reliability Custom ReadyCircuit assemblies are reviewed by our product specialists to meet our design specifications. All custom ReadyCircuit assemblies are manufactured in an ISO Class 7 environment and with an ISO 9001:2008 compliant certified quality management system. Assemblies can normally be constructed and delivered within 4 6 weeks. Ordering information Description Sensor Assembly, Pendo Tech, 1/2 in PendoTech RM to RM Jumper 3/4 in Pendo Tech RM to RM Jumper 1/4 in L Cell Harvest Assembly L Cell Harvest Assembly L Cell Harvest Assembly /4 in Y Adapter, MPC and RM /4 in Y RM Adapter Visit us on the web at readytoprocess 56

57 ReadyToProcess hollow fiber cartridges Typical applications of ReadyToProcess hollow fiber cartridges include: Aseptic clarification and purification of vaccines, monoclonal antibodies, recombinant proteins, and plasmids Aseptic cell processing Environments where terminal sterilization is not feasible Preclinical through Phase II clinical trials Areas where the risk of cross-contamination is high Fast-Trak drug development processes ReadyToProcess hollow fiber cartridges enable simpler, safer, and faster drug development by minimizing device preparations steps such as wetting and sterilizing. The cartridges are designed to wet the membrane, lower total organic carbon (TOC) and conductivity, and minimize endotoxin and bioburden levels. The single-use nature of the columns eliminates the need for cleaning protocols and cleaning validation, as well as eliminating crosscontamination between runs. ReadyToProcess hollow fiber cartridges are packaged in high-purity water and sterilized via exposure to gamma radiation. Operating specifications Ultrafiltration Microfiltration Temperature range Up to 80 C 0.1 and 0.2 μm: up to 80 C 0.45 and 0.65 μm: up to 50 C Maximum feed < 10 C: 5.2 barg (75 psig) At 25 C: pressure 10 C 25 C: 4.5 barg (65 psig) 0.1 μm: 2.1 barg (30 psig) 25 C 80 C: 3.4 barg (50 psig) 0.2 μm: 1.7 barg (25 psig) 0.45 μm: 1 barg (15 psig) 0.65 μm: 1 barg (15 psig) Maximum transmembrane pressure kd: < 10 C: 4.1 barg (60 psig) 10 C 25 C: 3.4 barg (50 psig) 25 C 50 C: 3.1 barg (45 psig) 50 C 80 C: 2.4 barg (35 psig) kd: < 10 C: 3.4 barg (50 psig) 10 C 25 C: 3.1 barg (45 psig) 25 C 50 C: 2.4 barg (35 psig) 50 C 80 C: 1.7 barg (25 psig) At 25 C: 0.1 μm: 1.4 barg (20 psig) 0.2 μm: 1 barg (15 psig) 0.45 μm: 0.7 barg (10 psig) 0.65 μm: 0.7 barg (10 psig) ReadyToProcess hollow fiber cartridges are available in a wide variety of ultrafiltration molecular weight cut-offs and microfiltration pore sizes, from lab to pilot scale. Technical specifications Model Cartridge diameter 3M, 3X2M 0.9 cm (0.375 in) 4M, 4X2M 1.9 cm (0.75 in) 5, cm (1.25 in) 8, cm (2 in) 35, cm (3 in) Model 3M 3X2M 4M 4X2M Cartridge length 41.7 cm (16.4 in) 73.5 cm (28.9 in) 44.5 cm (17.5 cm) 76 cm (29.9 in) cm (16.5 in) cm (28.9 in) cm (17.7 in) cm (28.9 in) cm (18 in) cm (30.4 in) Model Path length 3M, 4M, 5, 8, cm (12 in) 3X2M, 4X2M, 6, 9, 55 Fluid connections Feed/retentate Permeate Materials of construction Cartridge housing, fittings, fiber Cartridge sleeve Fiber net Fiber potting Permeate tubing ReadyMate Gaskets Regulatory conformance EMEA/410/01 Biological Reactivity Test, In Vivo per USP <88> Class VI 21CFR177 Indirect Food Additives L929 MEM Elution Test ISO (Cytotoxicity) 60 cm (24 in) ReadyMate connectors ReadyMate connectors Polysulfone Polypropylene Polyethylene Epoxy C-Flex (3M, 3X2M) AdvantaPure (4M, 4X2M, 5, 6, 8, 9, 35, 55) Polycarbonate, silicone Silicone Compliant Compliant Compliant (except Size 3M and 3X2M) Compliant Hemolysis Rabbit Blood (direct contact) ISO Compliant ReadyToProcess 57

58 1 2 3 ReadyToProcess Ordering information ReadyToProcess hollow fiber cartridges - Ultrafiltration Model number Pore size Fiber ID Membrane surface area Nominal flowpath (NMWC) (mm) (m 2 ) (ft 2 ) length (cm) RTPUFP-10-C-3X2MS RTPUFP-30-C-3X2MS RTPUFP-50-C-3X2MS RTPUFP-100-C-3X2MS RTPUFP-300-C-3X2MS RTPUFP-500-C-3X2MS RTPUFP-750-E-3X2MS RTPUFP-10-C-4MS RTPUFP-30-C-4MS RTPUFP-50-C-4MS RTPUFP-100-C-4MS RTPUFP-300-C-4MS RTPUFP-500-C-4MS RTPUFP-750-E-4MS RTPUFP-10-C-4X2MS RTPUFP-30-C-4X2MS RTPUFP-50-C-4X2MS RTPUFP-100-C-4X2MS RTPUFP-300-C-4X2MS RTPUFP-500-C-4X2MS RTPUFP-750-E-4X2MS RTPUFP-10-C-5S RTPUFP-30-C-5S RTPUFP-50-C-5S RTPUFP-100-C-5S RTPUFP-300-C-5S RTPUFP-500-C-5S RTPUFP-750-E-5S RTPUFP-10-C-6S RTPUFP-30-C-6S RTPUFP-50-C-6S RTPUFP-100-C-6S RTPUFP-300-C-6S RTPUFP-500-C-6S RTPUFP-750-E-6S RTPUFP-10-C-8S RTPUFP-30-C-8S RTPUFP-50-C-8S RTPUFP-100-C-8S RTPUFP-300-C-8S RTPUFP-500-C-8S RTPUFP-750-E-8S RTPUFP-10-C-9S RTPUFP-30-C-9S RTPUFP-50-C-9S RTPUFP-100-C-9S RTPUFP-300-C-9S RTPUFP-500-C-9S RTPUFP-750-E-9S RTPUFP-500-C-35S RTPUFP-500-C-55S

59 Ordering information ReadyToProcess hollow fiber cartridges Microfiltration Model number Pore size Fiber ID Membrane surface area Nominal flowpath (NMWC) (mm) (m 2 ) (ft 2 ) length (cm) RTPCFP-1-E-3MS RTPCFP-2-E-3MS RTPCFP-4-E-3MS RTPCFP-6-D-3MS RTPCFP-1-E-3X2MS RTPCFP-2-E-3X2MS RTPCFP-4-E-3X2MS RTPCFP-6-D-3X2MS RTPCFP-1-E-4MS RTPCFP-2-E-4MS RTPCFP-4-E-4MS RTPCFP-6-D-4MS RTPCFP-1-E-4X2MS RTPCFP-2-E-4X2MS RTPCFP-4-E-4X2MS RTPCFP-6-D-4X2MS RTPCFP-1-E-5S RTPCFP-2-E-5S RTPCFP-4-E-5S RTPCFP-6-D-5S RTPCFP-1-E-6S RTPCFP-2-E-6S RTPCFP-4-E-6S RTPCFP-6-D-6S RTPCFP-1-E-8S RTPCFP-2-E-8S RTPCFP-4-E-8S RTPCFP-6-D-8S RTPCFP-1-E-9S RTPCFP-2-E-9S RTPCFP-4-E-9S RTPCFP-6-D-9S RTPCFP-6-D-35S RTPCFP-6-D-55S ReadyToProcess 59

60 1 ReadyToProcess ULTA normal flow filter capsules 2 3 ReadyToProcess ReadyToProcess ULTA normal flow filter capsules are single-use filters designed for laboratory through process scale applications. Volumes range from a few milliliters to thousands of liters of solution. The filters provide prefiltration and sterilizing grade filtration for a wide range of biopharmaceutical solutions. ULTA normal flow filter capsules are available in four assemblies: ReadyCircuit ULTA SG capsule assembly: for sterile filtration of biopharmaceutical solutions ReadyCircuit ULTA HC capsule assembly: for effective sterile filtration of difficult-to-filter biopharmaceutical and diagnostic solutions ReadyCircuit ULTA CG capsule assembly: for controlling bioburden and particle retention in a wide variety of ph ranges and feed streams ReadyCircuit ULTA GF capsule assembly: for effective prefiltration/clarification of biopharmaceutical solutions Maximum recommended operating conditions Large capsule assemblies with Readymate (5 in, 10 in, 20 in, 30 in capsules) Small capsule assemblies with C-Flex tubing and ReadyMate (2 in, 4 in, 6 in capsules) 5.5 barg (79 psi) at 25 C (77 F) 1 barg (14.5psi) at 25 C (77 F) ULTA filters - Integrity test parameters for sterile filters and bioburden reduction filters Pore size IT ΔP Diffusional Flow Specification (sccm) Bubble Point (microns) (barg) 2 in 4 in 6 in 5 in 10 in 20 in 30 in (barg) ULTA Prime CG 0.6/ ULTA Pure SG ULTA Pure HC 0.6/ Area specifications/integrity specifications. ULTA filters - effective filtration area. All values are in square meters (m 2 ). Pore size Mean Surface Area (microns) 2 in 4 in 6 in 5 in 10 in 20 in 30 in ULTA Prime GF ULTA Prime CG 0.6/ ULTA Pure SG ULTA Pure HC 0.6/

61 Ordering information ULTA normal flow filter capsule assemblies Description Expanded description XCG9202 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime CG 0.2 µm 2 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors XCG9204 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime CG 0.2 µm 4 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors XCG92H1 2X RM A ReadyCircuit assembly comprised of an ULTA Prime CG 0.2 µm 5 in capsule filter terminating with ReadyMate connectors XCG9206 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime CG 0.2 µm 6 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors XCG9210 2X RM A ReadyCircuit assembly comprised of an ULTA Prime CG 0.2 µm 10 in capsule filter terminating with ReadyMate connectors XCG9220 2X RM A ReadyCircuit assembly comprised of an ULTA Prime CG 0.2 µm 20 in capsule filter terminating with ReadyMate connectors xCG9230 2x RM A ReadyCircuit assembly comprised of an ULTA Prime CG 0.2 µm 30 in capsule filter terminating with ReadyMate connectors XGF9602 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 0.6 µm 2 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors XGF9604 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 0.6 µm 4 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors XGF96H1 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 0.6 µm 5 in capsule filter terminating with ReadyMate connectors XGF9606 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 0.6 µm 6 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors. ReadyToProcess XGF9610 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 0.6 µm 10 in capsule filter terminating with ReadyMate connectors XGF9620 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 0.6 µm 20 in capsule filter terminating with ReadyMate connectors XGF9630 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 0.6 µm 30 in capsule filter terminating with ReadyMate connectors XGF0102 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 1 µm 2 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors XGF0104 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 1 µm 4 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors XGF0106 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 1 µm 5 in capsule filter and of tubing terminating with ReadyMate connectors XGF01H1 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 1 µm 6 in capsule filter terminating with ReadyMate connectors XGF0110 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 1 µm 10 in capsule filter terminating with ReadyMate connectors XGF0120 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 1 µm 20 in capsule filter terminating with ReadyMate connectors XGF0130 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 1 µm 30 in capsule filter terminating with ReadyMate connectors XGF0202 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 2 µm 2 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors XGF0204 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 2 µm 4 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors XGF0206 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 2 µm 5 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors XGF02H1 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 2 µm 6 in capsule filter terminating with ReadyMate connectors XGF0210 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 2 µm 10 in capsule filter terminating with ReadyMate connectors XGF0220 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 2 µm 20 in capsule filter terminating with ReadyMate connectors xGF0230 2x RM A ReadyCircuit assembly comprised of an ULTA Prime GF 2 µm 30 in capsule filter terminating with ReadyMate connectors XGF0502 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 2 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors XGF0504 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 4 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors. 61

62 1 Ordering information ULTA normal flow filter capsule assemblies Description Expanded description XGF05H1 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 5 in capsule filter terminating with ReadyMate connectors XGF0506 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 6 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors XGF0510 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 10 in capsule filter terminating with ReadyMate connectors XGF0520 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 20 in capsule filter terminating with ReadyMate connectors XGF0530 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 30 in capsule filter terminating with ReadyMate connectors XHC9202 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime HC 0.6 / 0.2 µm 2 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors XHC9204 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime HC 0.6 / 0.2 µm 4 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors. ReadyToProcess XHC92H1 2X RM A ReadyCircuit assembly comprised of an ULTA Prime HC 0.6 / 0.2 µm 5 in capsule filter terminating with ReadyMate connectors XHC9206 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime HC 0.6 / 0.2 µm 6 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors XHC9210 2X RM A ReadyCircuit assembly comprised of an ULTA Prime HC 0.6 / 0.2 µm 10 in capsule filter terminating with ReadyMate connectors XHC9220 2X RM A ReadyCircuit assembly comprised of an ULTA Prime HC 0.6 / 0.2 µm 20 in capsule filter terminating with ReadyMate connectors XHC9230 2X RM A ReadyCircuit assembly comprised of an ULTA Prime HC 0.6 / 0.2 µm 30 in capsule filter terminating with ReadyMate connectors XSG9202 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime SG 0.2 µm 2 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors XSG9204 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime SG 0.2 µm 4 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors SG92H1 2X RM A ReadyCircuit assembly comprised of an ULTA Prime SG 0.2 µm 5 in capsule filter terminating with ReadyMate connectors XSG9206 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime SG 0.2 µm 6 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors XSG9210 2X RM A ReadyCircuit assembly comprised of an ULTA Prime SG 0.2 µm 10 in capsule filter terminating with ReadyMate connectors XSG9220 2X RM A ReadyCircuit assembly comprised of an ULTA Prime SG 0.2 µm 20 in capsule filter terminating with ReadyMate connectors XSG9230 2X RM A ReadyCircuit assembly comprised of an ULTA Prime SG 0.2 µm 30 in capsule filter terminating with ReadyMate connectors. Ordering information ULTA normal flow filter capsule assemblies - cell harvest filter trains Description Expanded description xGF0502 1xCG9202 2x0.5ft C RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 2 in capsule filter and ULTA Prime CG 0.2 µm 2 in capsule filter with 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors xGF05H1 1xCG9206 1x0.5ft C RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 5 in capsule filter and ULTA Prime CG 0.2 µm 6 in capsule filter with 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors xGF0510 1xCG92H1 2xRM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 10 in capsule filter and ULTA Prime CG 0.2 µm 5 in capsule filter terminating with ReadyMate connectors xGF0520 1xCG9210 2xRM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 20 in capsule filter and ULTA Prime CG 0.2 µm 10 in capsule filter terminating with ReadyMate connectors xGF0502 1xHC9202 2x0.5ft C RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 2 in capsule filter and ULTA Prime HC 0.6 / 0.2 µm 2 in capsule filter with 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors xGF05H1 1xHC9206 1x0.5ft C RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 5 in capsule filter and ULTA Prime HC 0.6 / 0.2 µm 6 in capsule filter with 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors xGF0510 1xHC92H1 2xRM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 10 in capsule filter and ULTA Prime HC 0.6 / 0.2 µm 5 in capsule filter terminating with ReadyMate connectors. 62

63 ReadyKart mobile processing station 1 ReadyKart mobile processing station delivers: Quick and convenient setup of fluid processing equipment saves time and allows users to do their best work Nesting capabilities with hose/tubing routing enables integration of multi-step processes A wide range of fluid processing setups ReadyKart Mobile Processing Station is a configurable cart that mechanically supports and enhances the use of GE Healthcare ReadyToProcess fluid processing products. 2 3 ReadyKart mobile processing stations fit well with the goals of scientists, process engineers, and laboratory technicians who must configure fluid processing systems for product and process development or pilot manufacturing. When used with GE Healthcare s family of ReadyToProcess components, users can quickly configure a wide range of sterile and disposable fluid processing systems. Since ReadyKart enables the ergonomic placement of equipment, users perform their tasks faster and better. Versatile approach to fluid processing Similar to other ReadyToProcess equipment, ReadyKart offers versatility, simplification, and efficiency. ReadyKart accommodates and organizes the following fluid processing components: Configurable and stackable shelves support pumps, process sensor monitors, and trays and bins that hold processing bags Trays and bins tilting trays hold and tilt pillow bags horizontally, while bins hold large 3-D bags. Both allow convenient routing of inlet and outlet port tubing. Holders for bags and filters adjustable-height bag holders hold pillow bag vertically. Filter holders support normal- and cross-flow filters attached with laboratory clamps. Bags and filters are held at convenient heights for easy setup and monitoring. ReadyToProcess Ordering information ReadyKart full size accessories and replacement parts Description Usage guide ReadyKart with 3 shelves Basic full size cart pre-configured with a bottom stainless steel shelf and 2 solid shelves, 2 arm clamp assemblies to hang bags, 2 hanging bag protectors and 1 filter holder rod and clamp assembly and 1 end panel ReadyKart frame for 3 shelves Basic full size cart frame with a stainless steel bottom shelf will accept up to 2 removable shelves to be accessorized as required ReadyKart shelf no tank hole Replacement part Accessory for full cart frame, up to 2 required depending on desired configuration ReadyKart t-shelf with tank hole Accessory, 2 required if using 200 L tank, 1 required if using 100 L tank ReadyKart top shelf assembly Accessory for full size cart added 2-shelf capability (transport to freezing, storage, cascading process train). When installed, unable to use filter holder rods. Ordering information ReadyKart mini accessories and replacement parts Description Usage guide ReadyKart mini with 3 shelves Basic half size cart pre-configured with a bottom stainless steel shelf and 2 solid shelves, 1 arm clamp assemblies to hang bags, 1 hanging bag protectors and 1 filter holder rod and clamp assembly ReadyKart mini frame for 3 shelves Basic half size cart frame with a stainless steel bottom shelf will accept up to 2 removable shelves to be accessorized as required ReadyKart mini shelf no tank hole Replacement par Accessory for minicart frame, up to 2 required depending on desiredconfiguration ReadyKart mini shelf with tank hole Accessory, 2 required if using 200 L tank, 1 required if using 100 L tank ReadyKart mini top shelf assembly Accessory for half size cart added 2-shelf capability (transport to freezing, storage, cascading process train). When installed, unable to use filter holder rods. 63

64 1 Ordering information ReadyKart accessories that fit the full and mini sizes Description Usage guide ReadyKart 200 L tank Requires 2 shelves with tank holes. Catalog number on full size cart or catalog number on the mini cart 2 3 ReadyToProcess ReadyKart 100 L tank Requires 1 shelf with tank hole in the upper shelf of the cart. Catalog number on full size cart or catalog number on the mini cart ReadyKart 1 and 5L tray Accessory support, recommended for pillow bags and hanging bags used as pillow bags ReadyKart 10, and 20 L tray Accessory support, recommended for pillow bags and hanging bags used as pillow bags, can be mounted across width of carts ReadyKart 50 L tray Accessory support, recommended for 50 L pillow bags ReadyKart filter holder rod Accessory required to hold filters vertical at cart corners, requires filter holder clamp or customer supplied equal. Cannot use if top shelf assembly in place ReadyKart filter holder clamp Accessory required to hold filters vertical at cart corners, requires filter holder rod (should this be part of an assembly with the rod and also as a replacement part ReadyKart arm clamp assembly Accessory required to hold hanging boat fitment bags, recommend hanging bag plate for added bag protection ReadyKart hanging bag plate Accessory recommended for protection of hanging bag that would rest against the arm clamp assembly Ordering information ReadyKart replacement parts Description Usage guide ReadyKart tray lift assembly Replacement part ReadyKart arm clamp Replacement part ReadyKart arm glide insert Replacement part ReadyKart arm gas spring Replacement part ReadyKart arm glide locator Replacement part ReadyKart swivel lock caster Replacement part ReadyKart fixed caster Replacement part ReadyKart end panel Replacement part Visit us on the web at readytoprocess 64

65 1 2 3 ReadyToProcess 65

66 1 2 3 ReadyToProcess ReadyToProcess connectivity GE Healthcare s line of ReadyToProcess systems and accessories are supported by integrated devices that help maintain secure connectivity throughout the manufacturing process. Simple, sterile connections between media bags, as well as leak proof seals of thermoplastic tubing are examples of ReadyToProcess connectivity solutions. ReadyToProcess connectivity products provide the links between our systems and components, allowing rapid, secure workflows and maintaining sterile integrity. Visit us on the web at readytoprocess 66

67 ReadyMate Disposable Aseptic Connectors 1 1/4 in 3/8 in TC 1/2 in 3/4 in Mini TC The ReadyMate Disposable Aseptic Connector (DAC) provides secure connections for high-fluid throughput and offers a simple and economical connection for upstream and downstream applications. ReadyMate DAC is autoclave and gamma compatible, and can be part of a sterile circuit. It can be used to connect unit operations and assemblies, upstream and downstream. ReadyMate DAC is manufactured in compliance with the current Good Manufacturing Practices of the FDA and ISO Strap clamps are disposable and easy to use clamps ensuring leak-proof, traceable connections and meet ISO standard ReadyMate connectors provide: Secure, single-use connections made quickly and easily in any environment Genderless design with cross-size connectivity reduces inventory and increases flexibility Large inner diameter for high throughput TC, Mini-TC, and standard hose barb sizes Secure closure mechanism using standard sanitary clamps (ISO 2852) or a disposable clamp to make a tamper-proof, lightweight connection Ordering information Product Quantity ReadyMate DAC 250 with 1/4 in barb 50* ReadyMate DAC 250 with 1/4 in barb ReadyMate DAC 375 with 3/8 in barb 50* ReadyMate DAC 375 with 3/8 in barb ReadyMate DAC 500 with 1/2 in barb 50* ReadyMate DAC 500 with 1/2 in barb ReadyMate DAC 750 with 3/4 in barb 50* ReadyMate DAC 750 with 3/4 in barb ReadyMate DAC 750 Mini TC 50* ReadyMate DAC 750 Mini TC ReadyMate DAC 1500 TC 50* ReadyMate DAC 1500 TC ReadyClamp * five bags of 10 one bag of 10 Technical specifications Sizes 1/4 in (6.4 mm OD) 3/8 in (9.5 mm OD) 1/2 in (12.7 mm OD) 3/4 in (19.1 mm OD) Standard Mini-TC (ID 15.7 mm) Standard TC 1½ in (ID 19.7 mm) Outside clamp profile 50 mm (1½ in) ISO standard 2852 Wetted materials Polycarbonate Silicone rubber Material compliance USP Class VI 21 CFR 177 Animal-free origin or compliance to EMEA/410/01 Maximum Pressure* 5 bar (4 C to 40 C) Sterilization method Gamma irradiation (25 50 kgy) Autoclaving (125 C, min) One sterilization cycle Not intented for Steam-in-Place (SIP) Shelf life 3 yrs Storage temperature 4 C to 30 C * Depends on strapping and assembly components. Visit us on the web at ReadyToProcess Standard clamp ReadyClamp 67

68 1 2 3 ReadyToProcess Sterile Tube Fuser The Sterile Tube Fuser is a fully automated device for welding together dry or fluid-filled thermoplastic tubing in a sterile operation without the need for a laminar flow cabinet or similar environmental control device. The instrument is useful for connecting tubing between sterile containers, bioreactor bags, and process equipment. The unit can connect large diameter (up to 22.2 mm OD; dry only) tubing for the rapid and secure transfer of large volumes of inoculum, media buffers, process intermediates, and other products. Applications include: Sterile media transfer Vaccine manufacture Filling and formulation Bioreactors feed and harvest Pharmaceutical process fluid transfer High containment operations In-process pooling Transferring buffers Sterile Tube Fuser features include: Tubing diameters from mm (1/4 7/8 in) using interchangeable tubing holders Typical welding cycle takes 2 3 min Secure and rapid fluid transfer Infrared blade temperature sensor PC interface for data printing and parameter download PTFE-coated blades for strong welds Can be used to weld most thermoplastic tubing Ordering information Product Quantity Sterile Tube Fuser Dry Tube Holder Set for 15.5 mm (5/8 in) OD tubing Tube Holder Set for 15.5 mm (5/8 in) OD tubing(clamped tube holder set for wet welding;for use with STF-IRcWW) Tube Holder Set for 19.1 mm (3/4 in) OD tubing Tube Holder Set for 11.2 mm (7/16 in) OD tubing Tube Holder Set for 11.2 mm (7/16 in) OD tubing (clamped tube holder set for wet welding; for use with STF-IRcWW) Tube Pinch Holder Set for 6.4 mm (1/4 in) OD tubing Tube Holder Set for 6.4 mm (1/4 in) OD tubing (clamped tube holder set for wet welding; for use with STF-IRcWW) Tube Holder Set for 8.0 mm (5/16 in) OD tubing Tube Holder Set for 9.6 mm (3/8 in) OD tubing Tube Holder Set for 12.5 mm (1/2 in) OD tubing Tube Holder Set for 12.5 mm (1/2 in) OD tubing (clamped tube holder set for wet welding; for use with STF-IRcWW) Tube Holder Set for 22.2 mm (7/8 in) OD tubing Tube Holder Set for 14.3 mm (9/16 in) OD tubing Single-use stainless steel cutting blades with PTFE coating. Non-sterile (50 blades/package) Blade removal tool STF Tube Data Management Tool (GUI) Temperature Verification Kit Programming Lock Key 1 WV Technical specifications Cutting Blades (BLADES-IR/50) Dimensions (L W H) Weight Utilities Environmental Tube types vs. tube sizes 1/8 1/4 in 3/16 5/16 in 3/16 3/8 in 1/4 3/8 in Single-use, 50 per pack mm ( in) 16 kg (35 lb) Voltage: / VAC Frequency: 50/60 Hz This equipment is designed for use under the following conditions: Indoor use 0 C to 30 C 2% to 80% rh, non-condensing Bioprene C-Flex 082* C-Flex 374* PHARMED BPT* SANIPURE 60 SANIPURE BDF* TYGON/PVC Visit us on the web at 1/4 7/16 in * Denotes the factory loaded tubing types All compatible tube sizes ReadyToProcess tube sizes 5/16 7/16 in 1/4 1/2 in 3/8 1/2 in 7/16 9/16 in 3/8 5/8 in 1/2 3/4 in 5/8 7/8 in 68

69 Tube Sealer Ordering information Product Quantity Tube Sealer (preprogrammed to thermally seal C-Flex, Sanipure, PVC, Tygon, and PharMed thermoplastic tubing from 6.4 to 31.8 mm OD) Tube Data Management Tool (GUI) Functional Verification Gauge Quick Change Tube Restrictor Kit 1 WV Programming Lock Key 1 WV Technical specifications Dimensions (L W H) Weight Utilities Environmental mm ( in) 8 kg (18 lb) Voltage: / VAC Frequency: 50/60 Hz Power: 350 VA This equipment is designed for use under the following conditions: Indoor use 2 C to 32 C 2% to 80% rh, non-condensing ReadyToProcess Tube Sealer is a portable device that can heat-seal thermoplastic tubing from 6.4 to 31.8 mm OD. The seal forms a tamperproof and leakproof closure for securing tubes from bags, bottles, and other vessels. Tube Sealer is preprogrammed for many brands of tubing, is fully automated for validatable operation, and prevents fluids such as inoculum, products, media, and buffers from leaking through tubing, clamps, and plugs. Tube types vs. tube sizes 1/8 1/4 in 3/16 5/16 in 3/16 3/8 in 1/4 3/8 in 1/4 7/16 in 5/16 7/16 in 1/4 1/2 in 3/8 1/2 in 3/8 5/8 in 1/2 3/4 in Bioprene C-Flex 082 C-Flex 374 5/8 7/8 in 3/4 1 1/8 in 3/4 1 1/4 in Tube Sealer has a range of applications including: Sealing tubing attached to bags Tamperproof sealing Sampling Shipping/storage PHARMED BPT SANIPURE 60 SANIPURE BDF TYGON/PVC All compatible tube sizes ReadyToProcess tube sizes Sealing transfer/sampling lines Key features of Tube Sealer include: Keypad-selectable programs for virtually all types and sizes of thermoplastic tubing up to 31.8 mm OD Typical sealing cycle takes 2 3 min No adapters required over the entire size range Lightweight unit can be used anywhere in the plant or laboratory Microprocessor controlled motor ensures reproducible and validatable performance No accessories, compressed air or cooling water needed Factory settings for sealing most thermoplastic tubing Visit us on the web at

70 1 ReadyToProcess chromatography 2 3 ReadyToProcess ÄKTA ready and ReadyToProcess columns are part of the ReadyToProcess platform, consisting of plug-and-play, ready-touse solutions for entire chromatography processes. ÄKTA ready is a fully automated liquid chromatography system for process scale-up and production of materials for clinical trials. The system operates with ready to-use, disposable flow paths that are available in High and Low Flow Kits. The need for cleaning between products/batches is eliminated and no development or validation of cleaning procedures is required. Highlights of ÄKTA ready systems include: Simple exchange of the complete flow path removes the need for system cleaning Improved economy and productivity due to simpler procedures Single-use eliminates risk of crosscontamination between products/ batches Scalable processes using UNICORN ReadyToProcess columns are designed for seamless scalability, delivering the same performance level as available in conventional processing columns such as AxiChrom and BPG. ReadyToProcess columns are designed for purification of biopharmaceuticals for clinical phase I and II studies. Depending on the scale of operations, they can also be used for full-scale manufacturing, as well as for preclinical studies. ReadyToProcess columns provide a range of benefits including: Time savings by eliminating several time-consuming steps Cost savings by lowering buffer consumption and reducing cleaning validation demands Process security robust column construction and performance Scalability by facilitating conventional approaches in larger scales Reduced cross-contamination Visit us on the web at

71 ÄKTA ready system Ordering information Product ÄKTA ready system including column trolley and UNICORN Accessories High Flow Kit, ÄKTA ready Low Flow Kit, ÄKTA ready Low flow test kit ÄKTA ready UV Cond test tools ÄKTA ready Pressure calib tool ÄKTA ready ReadyToProcess columns see page ÄKTA ready is a fully automated liquid chromatography system for process scale-up and production of materials for clinical trials. After the completion of a purification task, the columns and the flow path (i.e., the Flow Kits) can be either disposed of or exchanged for reuse. The ReadyToProcess concept can speed up processes considerably due to fewer operations: there is no need to establish and validate cleaning procedures, and no complex setup. The flow path can be changed quickly, with a downtime of less than 1 h. This saves time, capital investment, start-up cost, and costs of labor and consumables. Technical specifications General specifications Dimensions (W D H) mm Weight 230 kg Control system UNICORN v5.20 or higher Instrument input voltage AC Voltage, 1 100/120/ / /240 V, ± 10%, 50/60 Hz Max. power consumption 1 kva Ingress protection IP45 Compressed air interface bar, 50 Nl/min, oil- and particle-free Operating conditions Surrounding temperature 2 C to 30 C Fluid temperature 2 C to 40 C Fluid density kg/m 3 Fluid viscosity water viscosity at actual temperature, max. 2.5 cp System capacity Volumetric flow rates L/h High Flow Kit L/h Low Flow Kit Pump speed 340 rpm (100%) High Flow Kit 225 rpm (100%) Low Flow Kit Max. pressure, peristaltic pump 4.0 bar System pressure rating 5.0 bar (high-pressure flow path, upstream column) 2.0 bar (high-pressure flow path, downstream column) 0.95 bar (low-pressure outlet manifold) 0.6 bar (low-pressure inlet manifold) ReadyToProcess Validation with UNICORN software UNICORN software has an installation wizard that checks the setup and the installation and functionality of the Flow Kit and sensors. A report is generated with completed installation procedures including instructions from the wizard, traceability to Flow Kit, process information, and results from the component test. The installation wizard also contains instructions and reports for column installation. UNICORN has undergone an independent audit and is designed as a control package in FDA 21 CFR part 11 and GMP compliant environments. The record system uses a document locking scheme and traceable audit log. For integration purposes, UNICORN communicates with control systems within the plant via OLE for Process Control (OPC). OPC supports application areas such as data access for real time values and security control to protect sensitive information. Sensor specifications Sensor Acceptance range Measurement error 1 Pressure 0 5 bar g ± 0.20 bar g Flow (high flow kit) L/h ± 5% actual value at flow 3 40 L/h 3 ± 10% actual value at flow < 40 L/h 3 Flow (low flow kit) L/h ± 5% actual value at flow3 20 L/h 3 Conductivity ms/cm ± 5% full scale 5 ± 10% actual value at flow < 20 L/h 3 ph 6 ph 2 12 ± 0.2 ph at calibration temperature Drift: ± ph units/h (20 C, ph 4) Flow rate sensitivity: ± 0.1 ph unit UV AU Deviation from linearity ± 5% 3, 7 Temperature 2 C 40 C ± 3 C 3 1 max. error, valid within acceptance range under operation conditions 2 flow meter cells for high flow and low flow kits are designed with different flow path geometries 3 valid for liquid with density of water and the viscosity of water at the actual liquid temperature; and max. temperature difference of 10 C between liquid and ambient temperature 4 temperature compensation optional 5 valid at actual temperature (no temperature compensation) 6 temperature compensation not available 7 cell length 1.8 mm ± 0.2 mm 71

72 1 2 3 ReadyToProcess ReadyToProcess columns ReadyToProcess columns are prepacked, prequalified, and presanitized process chromatography columns available with a range of BioProcess media in four different sizes: 1, 2.5, 10, and 20 L. The columns can be used in a wide range of chromatographic applications for separation of various compounds such as proteins, endotoxins, DNA, plasmids, vaccines, and viruses. ReadyToProcess chromatography columns offer the possibility to work in a fully flexible mode in early clinical phases while keeping a conventional re-use option for large-scale manufacturing open. The chromatography media used in ReadyToProcess columns have a long track-record of use in full-scale manufacturing using conventional, large-scale chromatography, where columns can be used for tens or hundreds of cycles. The transition from ReadyToProcess format to full-scale manufacturing is therefore straightforward. Custom ReadyToProcess columns GE Healthcare can provide custom-built ReadyToProcess columns built to user specifications and including a wide range of prepacked BioProcess media. For further information, contact your GE Healthcare sales representative. Technical specifications 1 L 2.5 L 10 L 20 L Inner diameter (mm) Inner cross section (cm 2 ) Column volume (L) Packed bed height (mm) Net mesh (μm) Mechanical compression factor (%)* Outer height (mm) Outer diameter incl. lid (mm) Weight (kg) ~ 3 ~ 6 ~ 25 ~ 55 Inlet TC25 connectors, tubing i.d. 4.8 mm (0.19 in) 6.3 mm (0.25 in) 9.5 mm (0.375 in) 12.7 mm (0.5 in) Outlet TC25 connectors, tubing i.d. Ordering information 4.8 mm (0.19 in) 6.3 mm (0.25 in) 9.5 mm (0.375 in) 12.7 mm (0.5 in) Ambient temperature ( C) Liquid temperature ( C) Maximum liquid pressure, bar Estimated shelf life (months) * The mechanical compression factor varies depending on the medium. The temperature difference between the fluid running through the column and the ambient temperature in the room should never be greater than 20 C. While the maximum liquid pressure stated depends on the pressure rating of the column, restrictions for the maximum pressure drop over the column depend on the packed chromatography medium, in order to ensure bed stability. See User Manual for details. Product Column size ReadyToProcess Capto Q 1 1 L ReadyToProcess Capto Q L ReadyToProcess Capto Q L ReadyToProcess Capto Q L ReadyToProcess Capto S 1 1 L ReadyToProcess Capto S L ReadyToProcess Capto S L ReadyToProcess Capto S L ReadyToProcess Capto adhere 1 1 L ReadyToProcess Capto adhere L ReadyToProcess Capto adhere L ReadyToProcess Capto adhere L ReadyToProcess MabSelect SuRe 1 1 L ReadyToProcess MabSelect SuRe L ReadyToProcess MabSelect SuRe L ReadyToProcess MabSelect SuRe L ReadyToProcess Phenyl Sepharose 6 FF (low sub) 1 1 L ReadyToProcess Phenyl Sepharose 6 FF (low sub) L ReadyToProcess Phenyl Sepharose 6 FF (low sub) L ReadyToProcess Phenyl Sepharose 6 FF (low sub) L ReadyToProcess Capto MMC 1 1 L ReadyToProcess Capto MMC L ReadyToProcess Capto MMC L ReadyToProcess Capto MMC L ReadyToProcess Q Sepharose FF 1 1 L ReadyToProcess Q Sepharose FF L ReadyToProcess Q Sepharose FF L ReadyToProcess Q Sepharose FF L ReadyToProcess SP Sepharose FF 1 1 L ReadyToProcess SP Sepharose FF L ReadyToProcess SP Sepharose FF L ReadyToProcess SP Sepharose FF L ReadyToProcess DEAE Sepharose FF 1 1 L ReadyToProcess DEAE Sepharose FF L ReadyToProcess DEAE Sepharose FF L ReadyToProcess DEAE Sepharose FF L

73 1 2 3 ReadyToProcess 73

74 4 Chromatography media Ion exchange 77 Affinity 82 Hydrophobic interaction 87 Multimodal 90 Reversed phase 94 Gel filtration 96 Custom Designed Media

75

76 Media selection our strategy At GE Healthcare we are committed to supplying you with media that pass the rigorous selection requirements demanded for the downstream processing of biopharmaceuticals. Consider three issues: 4 Chromatography media Performance The different stages in downstream processing from Capture to Polishing demand media with different characteristics. Scalability Is the medium produced at a large enough scale? Can it be packed into large production columns with retained performance? Security of supply How is quality assurance? Is the producer geared up to long-term industrial supply issues? B A Sanitization CIP C Media / Systems / Columns BioProcess media made for bioprocessing Media selection filter D Regulatory Support E F V endor Certification T echnical Support Secure Supply G H Capture I J Intermediate Purification K Scalability L Polishing Compatibility with production and regulatory requirements. Use only media that pass through this filter. This label designates our media that have been specifically designed to meet the demands of industrial biotechnology: Secure supply Large capacity production integrated with clear ordering and delivery routines mean BioProcess media are available in the right quantity, at the right place, at the right time. Future supplies of BioProcess media are assured, making them a secure investment for your long-term production. Safety stock Our media safety stock agreements offer the right quantity of media, manufactured to specified quality levels, and delivered at the right time. For more information on Safety Stock agreements contact your local GE Healthcare office. Validated manufacture Produced following validated methods and tested under strict quality control, BioProcess media fulfill performance specifications. A certificate of analysis is available with each order. Regulatory support Regulatory Support Files contain details of performance, stability, extractable compounds and analytical methods available. The essential information in these files is an invaluable starting point for process validation, as well as support for clinical and marketing applications submitted to regulatory authorities. From capture to polishing Specific BioProcess media have been designed for each chromatographic stage in a process from capture to polishing. Using BioProcess media for every stage results in a systematic approach to method development. High productivity High flow rates, high capacity and high recovery contribute to the overall economy of an industrial process. Sanitization/CIP All BioProcess media can be cleaned- and sanitized-in-place. Scalability Packing methods are established for a wide range of scales. You can use the same BioProcess media for development work, pilot studies, and routine production. 76

77 Ion exchange chromatography Technique description Separation in ion exchange chromatography (IEX) is based upon the selective, reversible adsorption of charged molecules to an immobilized ion exchange group of opposite charge. An ion exchanger consists of an insoluble porous matrix to which charged groups have been covalently bound. IEX is the most frequently used method for the purification of biological substances. Biomolecules with even small differences in surface charge can be separated using IEX. Both high binding capacities and very high resolution can be obtained by choosing the optimal ion exchanger and the optimal separation conditions. Anion exchanger groups ANX: -CH 2 CHOHCH 2 NH + (CH 2 CH 3 ) 2 C 2 H 5 DEAE: Diethylaminoethyl O C 2 H 4 N + H C 2 H 5 C 2 H 5 QAE: Quatenary aminoethyl O C 2 H 4 N + CH 2 CH(OH)CH 3 C 2 H 5 CH 3 Q: Quatenary ammonium O-CH 2 CHOHCH 2 OCH 2 CHOHCH 2 N + CH 3 CH 3 Cation exchanger groups CM: Carboxymethyl O CH 2 COO S: Sulphoethyl O CH 2 CH 2 SO 3 SP: Sulphopropyl O CH 2 CHOHCH 2 OCH 2 CH 2 CH 2 SO 3 4 Chromatography media Q, S and SP are strong ion exchange groups that maintain charge capacity over a very wide ph range. The other groups are weak ion exchangers, and their charge capacity varies with ph. 77

78 4 Chromatography media New and established media GE Healthcare ion exchangers are well-established in industry. A wide range of base matrices has been developed to address most customer requirements. Capto is a product line, based on high flow agarose, designed to meet large-scale biopharma manufacturers' demands for fast, efficient and costeffective capture and intermediate purification. The rigidity of Capto media allows for longer bed heights in smaller diameter columns, thereby simplifying column handling as well as reducing investment in largescale equipment. Capto ImpRes is an extension of the Capto line and is designed for intermediate purification and polishing steps. The Capto ion exchanger line is composed of strong anion exchangers Capto Q and Capto Q ImpRes, strong cation exchangers Capto S and Capto SP ImpRes, and Capto DEAE, a weak anion exchanger. The flexibility and high flow rates offered by Capto media open new possibilities in large-scale protein purification. MacroCap SP and MacroCap Q are macroporous ion exchangers designed for the purification of PEGylated and other large biomolecules. They allow separation of mono- from oligo- and non-pegylated proteins with high selectivity, even under high load conditions. Sepharose Big Beads, Sepharose Fast Flow, Sepharose XL and Sepharose High Performance are other products based on cross-linked agarose. These media are designed for robust, high capacity, high resolution ion exchange chromatography at various stages of process-scale purification. For many years, they have been the industry standard for ion exchange of biomolecules. Sephadex: Other key products include Sephadex ion exchangers, based on cross-linked dextran beads and offering high capacities for batch or column mode. SOURCE media for late-intermediate purification and polishing also belong to a long line of ion exchangers specifically designed to meet the processing needs of the biopharmaceutical manufacturer. The handbook Ion Exchange Chromatography and Chromatofocusing Principles and Methods can be obtained through your local GE Healthcare office or downloaded from our website

79 Selection guide Capture Polishing Sephadex Capto Sepharose High Performance Capto ImpRes Sepharose Fast Flow / Sepharose XL Sepharose Big Beads SOURCE 4 Getting started Intermediate purification Testing the performance of chromatography media at the laboratory bench helps you select the most appropriate one for process-scale use. PreDictor 96-well filter plates (prefilled with IEX media) and PreDictor RoboColumn units (mini columns prepacked with IEX media) support high-throughput process development (HTPD) workflows by allowing for parallel screening of media and process conditions. Another advantage of PreDictor plates and RoboColumn units is that screening can be carried out with minimal sample consumption. HiTrap prepacked columns (1 and 5 ml) are a particularly fast, simple, and reproducible way of testing different ion exchange media. They can be operated with a syringe, a peristaltic pump or a chromatography system. HiTrap Capto IEX Selection Kit provides three different ion exchange ligands and two different multimodal ligands based on Capto. The HiTrap IEX Selection Kit contains seven ion exchangers based on Sepharose Fast Flow and Sepharose XL. Capto Q, Capto S, Capto DEAE, Capto SP ImpRes, Capto Q ImpRes, as well as Q and SP Sepharose High Performance, Sepharose Fast Flow and XL are also available in prepacked HiTrap 1 ml and 5 ml columns. For method development, the HiScreen prepacked column range is recommended due to the 10 cm bed length and small bed volume. They are convenient to use and give reproducible results. If a 20 cm bed length is preferred, two HiScreen columns can easily be connected in series. HiScreen columns are cm (4.6 ml) prepacked columns with Capto Q, Capto S, Capto DEAE, Capto SP ImpRes, and Capto Q ImpRes designed for process development. A convenient way of assessing SOURCE 15Q and SOURCE 15S media is to use an ÄKTA system and RESOURCE or 4.6/100 PE prepacked columns. In addition to prepacked columns, many of the media described in this section can be ordered as laboratory-sized packs. See A Z of media and chemicals. Chromatography media 79

80 4 Chromatography media Capto For high productivity capture and intermediate purification Capto is a product line designed to meet large-scale biopharma manufacturers demands for fast, efficient and cost-effective capture and intermediate purification. It is based on a highly-rigid agarose matrix produced with a manufacturing process that gives significantly improved pressure/flow properties with maintained control over pore structure. The rigid matrix enables high bed heights and purification of viscous samples at high flow rates. Capto Q and Capto S are strong anion and cation exchangers, and Capto DEAE is a weak anion exchanger all maximize productivity due to fast mass transfer plus high dynamic binding capacity. Typical flow velocities are over 700 cm/h. Capto ImpRes For high productivity intermediate purification and polishing Capto SP ImpRes and Capto Q ImpRes are strong cation and strong anion exchange media, respectively, for high-throughput intermediate purification and polishing of a wide range of biomolecules. The combination of the high flow agarose technique used for all Capto products and the small particle size of Capto ImpRes results in good pressure-flow properties as well as high resolution. Flow velocities are over 220 cm/h. MacroCap For purification of large biomolecules MacroCap is a product line designed to purify PEGylated and other large biomolecules. MacroCap SP and MacroCap Q are cation and anion exchangers that deliver high product purity and yield at high sample loads. Mono-PEGylated proteins are separable from oligo-pegylated and native protein in a single run. The MacroCap base matrix is hydrophilic and chemically stable, thereby increasing media lifetime. PEGylation is typically performed after purification of the target protein. Sephadex High binding capacities for column or batch modes Sephadex ion exchangers are very well established and have been used in industry for many years. Their binding capacities and reliability make them both simple and economical to use. Due to their stability and ease of packing, Sephadex A-25 and C-25 are popular choices for column techniques. Sephadex A-50 and C-50 are also widely used for batch applications, especially processing crude feedstocks, and in plasma fractionation. Sepharose Big Beads For capture steps handling very large volumes of feed or viscous feedstocks Sepharose Big Beads is the natural choice for the capture step in a process where high throughput and capacity are essential in packed column mode. Typical flow velocities for dilute samples are > 1000 cm/h. The large particle size combined with high physical stability ensures rapid processing of viscous samples. These media should be chosen for clarified feedstocks when high throughput is required and resolution is of less importance. Capto DEAE Capto Q Capto S Capto SP ImpRes Capto Q ImpRes MacroCap SP CDM MacroCap Q DEAE Sephadex A-25 QAE Sephadex A-25 CM Sephadex C-25 DEAE Sephadex A-50 QAE Sephadex A-50 CM Sephadex C-50 SP Sepharose Big Beads Q Sepharose Big Beads = BioProcess media CDM = Custom Designed Media produced on receipt of order. 80

81 Sepharose XL High loading capacities for more productive capture from clarified feedstocks Q Sepharose XL and SP Sepharose XL have high loading capacities compared with Sepharose Fast Flow ion exchangers. Combined with high throughput, this helps improve the production economy of manufacturing processes. Both adsorbents are based on the well-established Sepharose Fast Flow media. Sepharose Fast Flow Well-established in large-scale production of biopharmaceuticals These media are well-suited for separating crude mixtures early in purification schemes, where a combination of good resolution and high flow rate is essential. Typical flow velocities for these media are 100 to 400 cm/h. Sepharose High Performance Where high resolution is essential for intermediate purification and polishing These media are well-suited for intermediate purification and polishing. Use them when resolution and capacity have priority. Typical flow velocities are 100 cm/h. Q Sepharose XL SP Sepharose XL DEAE Sepharose Fast Flow CM Sepharose Fast Flow Q Sepharose Fast Flow SP Sepharose Fast Flow ANX Sepharose 4 Fast Flow (high sub) SP Sepharose High Performance Q Sepharose High Performance CM Sepharose High Performance 4 SOURCE For rapid, high-resolution, preparative separations at low or high pressure SOURCE ion exchangers are monosized, rigid, polystyrene/divinyl benzene matrices for chromatography of proteins, peptides and oligonucleotides. SOURCE 15Q and 15S media are well-suited for complex separations during polishing. SOURCE 30Q and 30S are for intermediate purification and large-scale polishing. Typical flow velocities are up to 1000 cm/h at large-scale, and even higher on the laboratory bench. SOURCE 15S SOURCE 15Q SOURCE 30S SOURCE 30Q Chromatography media HiTrap Capto IEX Selection Kit ( ) This kit provides three different ion exchange ligands and two different multimodal ligands based on Capto, enabling convenient and easy screening. Contains five 1 ml HiTrap columns prepacked with Capto Q, Capto S, Capto DEAE, Capto MMC, Capto adhere, as well as connectors and detailed instructions. HiTrap IEX Selection Kit ( ) This kit allows fast and easy screening of seven different ion exchange ligands based on Sepharose Fast Flow and Sepharose XL, which is excellent for laboratory studies with small sample quantities before scaling up. Contains SP, Q, CM, ANX (high sub) and DEAE Sepharose Fast Flow and Q and SP Sepharose XL in 1 ml HiTrap columns. The kit contains connectors and detailed instructions. For further information, please contact your local GE Healthcare office. 81

82 Affinity chromatography 4 Chromatography media Technique description The inherent high specificity of ligand target interactions makes affinity chromatography particularly suitable for the capture stage of downstream processing. One of the typical advantages of using affinity techniques is that the capacity of the media is usually not affected by the presence of contaminants since they have no affinity for the coupled ligand. The result is reliable product purity, often with purification factors well over 1000, and effective concentration, achieved in a single step. Affinity chromatography may also be suitable for the Intermediate or polishing stages, to remove small amounts of specific contaminants. In affinity chromatography, the product to be purified adsorbs to an affinity ligand that is coupled to a matrix. The ligand is specific for a single type of protein/ peptide molecule, or group of such molecules. The targeted product often binds to the ligand under specific conditions of ionic strength and ph. After unbound impurities are washed away, the product can be eluted by using a step gradient of increasing or decreasing ionic strength and/ or by changing the ph, or by a more selective elution technique. Affinity chromatography The most widely used affinity chromatography purification step in industry today is the capture of antibodies using the Protein A ligand. As an alternative to tradtional Protein A purification methods, Capto L utilizes the kappa light chain to purify a broad range of antibodies. Protein A media The MabSelect family for the capture of monoclonal antibodies (MAbs) has been developed with industrial needs in mind. The expanded product range focuses on improved overall process economy and reduced time for optimization. Capto L Capto L captures antibody fragments of different sizes and species. Due to the binding of protein L to the variable region of the kappa light chain, Capto L is particularly suitable for capturing a wide range of different-sized antibody fragments such as Fabs (fragment antibodies), single-chain variable fragments (scfv) and domain antibodies (dabs). Group-specific media Heparin Sepharose 6 Fast Flow, Capto Blue, and Blue Sepharose 6 Fast Flow are examples of media with affinity for a group of related molecules. IMAC media Immobilized Metal Ion Chromatography (IMAC) is a versatile purification technique for proteins, including histidinetagged proteins, with an affinity for metal ions. Examples of IMAC media include Ni Sepharose 6 Fast Flow, IMAC Sepharose 6 Fast Flow and Chelating Sepharose Fast Flow. Pre-activated media Pre-activated media allow you to couple a ligand appropriate to your application. The choice of medium depends on several factors, for example the groups in the ligand molecule that are suitable for coupling and the chemical stability demands on the resulting affinity medium. CNBr-activated Sepharose 4 Fast Flow and NHSactivated Sepharose 4 Fast Flow are examples of modern pre-activated media suitable for attaching various ligands. 82

83 MabSelect media The successful production and application of new therapeutic antibodies has accelerated the demand to develop the next generation of MAbs. Satisfying this demand requires excellence in both process development and full-scale production The high titers of modern expression systems require chromatography media with high capacity, high rigidity and chemical stability to obtain high yields, and ensure long media lifetime. Protein A chromatography media are considered the most efficient and robust tool for the capture of a variety of antibodies. Improvements to the chemical stability and binding capacity of Protein A have resulted in greater durability, increased throughput, and a reduction in the costs for large-scale production. Benefits of Protein A-based chromatography media High selectivity reduces the number and size of subsequent unit operations through high purities and yields Insensitivity to variations in additives, ph and conductivity facilitates the use of generic protocols Usually validated for both viral clearance and subsequent inactivation MabSelect family overview MabSelect is the common name for a range of process development to production-scale chromatography media for monoclonal antibody purification. All MabSelect media feature: A base matrix of high-flow agarose High chemical stability: compatible with all aqueous buffers commonly used in Protein A chromatography Mammalian product-free: no animal-derived components involved in the fermentation or purification of the recombinant Protein A ligand Epoxy as coupling chemistry Recommended storage reagents: 20% ethanol, 2% benzyl alcohol Temperature stability: 2 C to 40 C Regulatory Support File Shelf life: 5 yr Simple scale-up to production-sized columns Available in HiTrap and HiScreen formats for convenient media screening Like all our BioProcess media, MabSelect meets every requirement for process design and scale-up. Prepacked columns and bulk quantities are available. For largescale packing, we recommend AxiChrom, Chromaflow or BPG columns. MabSelect SuRe Withstands rigorous and cost-effective CIP protocols, (e.g., 0.1 to 0.5 M NaOH) Alkali-stabilized rprotein A ligand Generic and economic CIP/sanitization Product safety and process robustness MabSelect SuRe LX For high binding capacity at long residence time Efficient processing of large volumes of high-titer bioreactor feeds Higher density eluates increase operating flexibility Effective CIP improves process economy MabSelect For high purity and throughput at production scale Prioritized volume throughput Optimized matrix and ligand coupling The antibody purification standard MabSelect Xtra For capturing high-titer antibody feedstocks and reducing processing costs Outstanding dynamic binding capacity Improved process economics and reduced raw material costs High-purity capture due to minimal non-specific binding The handbooks Affinity Chromatography Principles and Methods ( ) and Antibody Purification Handbook ( ) can be obtained through your local GE Healthcare office or downloaded from our website. 4 Chromatography media 83

84 Capto L 4 Chromatography media Capto L is an affinity chromatography medium designed to capture a broad range of antibodies and antibody fragments. It combines a rigid, high-flow agarose matrix with the immunoglobulin-binding protein L ligand. In addition to binding all classes of Ig (IgG, IgM, IgA, IgE and IgD), protein L also binds differentsized antibody fragments such as Fabs, single-chain variable fragments (scfv) and domain antibodies, as long as they have the kappa light chain. Key performance characteristics of Capto L include: High selectivity for kappa light chain allows efficient capture of a broad selection of antibodies and antibody fragments High dynamic binding capacity reduces process time and amount of chromatography medium used Allows platform approach to the purification of antibody fragments containing the kappa light chain High-flow agarose matrix increases productivity, economy, and process design flexibility Low ligand leakage increases antibody fragment purity and productivity Flexible formats (e.g., PreDictor plates and prepacked columns) speed the screening and optimization of binding/elution conditions. Purification conditions are broadly similar for many antibody fragments containing the kappa light chain, and can easily be modified to match the specific properties of individual target molecules. This will result in significant savings in costs, effort and time during process development. Gains can also be won in manufacturing since the high selectivity of affinity capture will help reduce number of subsequent polishing steps as compared to other, less selective purification media. Protein L binding affinities Species Antibody class Affinity* General Kappa light chain (subtypes 1,3,4) Lambda light chain Heavy chain Strong No binding No binding Human IgG1 Strong IgG2 Strong IgG3 Strong IgG4 Strong IgA Strong IgD Strong IgE Strong IgM Strong Fab Strong ScFv Strong Dabs Strong Mouse IgG1 Strong IgG2a Strong IgG2b Strong IgG3 Strong IgM Strong Rat IgG1 Strong IgG2a Strong IgG2b Strong IgG2c Strong Pig Total IgG Strong Dog Total IgG Weak Binding sites for Capto L Cow IgG1 No Binding IgG2 No Binding Goat IgG1 No Binding Kappa or Lambda IgG2 No Binding Sheep IgG1 No Binding IgG2 No Binding Chicken Total IgG No Binding Fv Light chain Heavy chain Capto L * Binding to protein L occurs only if the immunoglobulin has the appropriate kappa light chains. Stated binding affinity refers only to species and subtypes with appropriate kappa light chains. Lambda light chains and some kappa light chains will not bind. Variable region Constant region Fab Fab scfv V L domain Fc Fab IgG 84

85 Capture toolkit for antibody fragments Antibody fragments are set to become the next important class of protein-based biotherapeutics after monoclonal antibodies (MAbs). One of the advantages that MAbs offer is the possibility to use a platform approach to purification, where capture by Protein A affinity chromatography has become the industry standard. Affinity capture allows very robust and generic processes and requires minimal optimization and high purity in one separation step. A similar approach for antibody fragments is now taking shape. Antibody fragments pose a different challenge due to their diversity and lack of common binding site (such as the Fc region in full length antibodies). In humans approximately 60% of antibodies consist of the kappa light chain and approximately 40% of the lambda light chain. Furthermore, approximately 10% of the antibodies have the V H3 heavy chain for which MabSelect has an affinity. These approximations may differ for recombinant antibody fragments. With the introduction of Capto L, with its protein L ligand, a platform purification approach to capture for this class of biomolecules is now emerging. Complementing Capto L in the toolbox are other chromatography media with affinity for the different antibody fragment sizes and light/ heavy chain subtypes. These affinity media have complementing binding specificities and will capture the majority of antibody fragments. Details of the different media can be found in their respective data files (see page 234 for the A-Z media section). 4 Chromatography media Guide to capture of antibody fragments Fab ScFv Domain antibody Kappa light chain Lambda light chain Kappa light chain Kappa light chain VH 3 Heavy chain Capto L Lambda FabSelect Capto L Capto L MabSelect KappaSelect 85

86 Product application guide 4 Chromatography media Getting started Testing the performance of chromatography media at the laboratory bench will help you select the most appropriate one for process scale use. All of the media described in this section can be ordered as laboratory-sized packs and many are also available in small, prepacked HiTrap and HiScreen columns. Turn to page 234 for the A Z of media and chemicals. This table is only a brief guide to application areas for our affinity media. For further information on these applications, please contact your local GE Healthcare office. = BioProcess media CDM = Custom Designed Media produced on receipt of order. Target molecules Affinity media Applications -NH 2 NHS-activated Sepharose 4 Fast Flow Ligand immobilization -NH 2 CNBr-activated Sepharose 4 Fast Flow Ligand immobilization -NH 2 CDM 6-AKS Sepharose 4 Fast Flow Ligand immobilization -NH 2 -OH, -SH Epoxy-activated Sepharose 6B Ligand immobilization -COOH, -CHO CDM Amino Sepharose 6 Fast Flow Ligand immobilization Immunoglobulins Capto L IgG, IgM, IgA, IgE, IgD and antibody fragments CDM IgSelect Human IgG all subclasses MabSelect SuRe IgG, some IgM and IgA MabSelect SuRe LX IgG, some IgM and IgA MabSelect IgG, some IgM and IgA MabSelect Xtra IgG, some IgM and IgA rmp Protein A Sepharose Fast Flow IgG, some IgM and IgA rprotein A Sepharose 4 Fast Flow IgG, some IgM and IgA nprotein A Sepharose 4 Fast Flow IgG, some IgM and IgA Protein G Sepharose 4 Fast Flow IgG Histidine-tagged Ni Sepharose 6 Fast Flow Polyhistidine tagged proteins proteins IMAC Sepharose 6 Fast Flow Polyhistidine tagged proteins GST-tagged proteins Glutathione Sepharose 4 Fast Flow Glutathione S-transferase (GST), tagged proteins, other glutathione S-transferases and glutathione-binding proteins Growth factors Heparin Sepharose 6 Fast Flow Fibroblast growth factor (FGF), Blue Sepharose 6 Fast Flow Capto Blue endothelial cell growth factor (ECGF) Protein synthesis factors Heparin Sepharose 6 Fast Flow Initiation factors, elongation factors (EF-1) Hormones and Con A Sepharose 4B Follicle-stimulating hormone receptors Heparin Sepharose 6 Fast Flow Oestrogen and androgen receptors Coagulation proteins Heparin Sepharose 6 Fast Flow Antithrombin III, Heparin Sepharose 6 Fast Flow Factors IX, X, XI, XII, XIIa, prothrombin, thrombin Chelating Sepharose Fast Flow Factor IX Nucleic acids ECH-Lysine Sepharose 4 Fast Flow Ribosomal RNA, double stranded DNA Polysaccharides and Con A Sepharose 4B a-d-glucosyl, a-d-mannosyl glycoproteins Lentil Lectin Sepharose 4B a-d-glucosyl, a-d-mannosyl Membrane proteins Lentil Lectin Sepharose 4B a-d-glucosyl, a-d-mannosyl Con A Sepharose 4B a-d-glucosyl, a-d-mannosyl Lipoproteins Heparin Sepharose 6 Fast Flow a-lipoprotein Con A Sepharose 4B Low density lipoprotein Enzymes Heparin Sepharose 6 Fast Flow Restriction endonucleases, DNA ligase, DNA and RNA polymerases, nucleic acid binding Blue Sepharose 6 Fast Flow Broad range of nucleotide-requiring Capto Blue enzymes Protease binding Benzamidine Sepharose 4 Fast Flow Trypsin, urokinase, prekallikrein, kallikrein (high sub) Other Con A Sepharose 4B a 1 -antitrypsin Capto Blue a 2 -macroglobulin Blue Sepharose 6 Fast Flow a 2 -macroglobulin Chelating Sepharose Fast Flow a 2 -macroglobulin Gelatin Sepharose 4 Fast Flow Fibronectin Heparin Sepharose 6 Fast Flow Fibronectin ECH-Lysine Sepharose 4 Fast Flow Plasminogen and plasminogen activator Capto Blue Albumin Blue Sepharose 6 Fast Flow Albumin Capto Blue Interferon Blue Sepharose 6 Fast Flow Interferon Heparin Sepharose 6 Fast Flow Interferon Chelating Sepharose Fast Flow Interferon AVB Sepharose High Performance Adeno-associated viruses CDM Procainamide Sepharose 4 Fast Flow Butyrylcholinesterase CDM VIIISelect Beta-domain depleted FVIII CDM Plasminogen Removal Gel Plasminogen 86

87 Hydrophobic interaction chromatography Technique description Proteins and peptides differ from one another in their surface hydrophobicity and this difference forms the basis of a HIC separation. Salt solutions are used to mediate the binding of sample molecules to a hydrophilic matrix substituted with a hydrophobic ligand. Widespread application Hydrophobic interaction chromatography (HIC) is well-established within protein purification today and has evolved into one of the most powerful methods in preparative biochemistry. By combining versatility with high selectivity, it is employed in capture, intermediate, or final purification stages of a wide variety of substances. The speed and resolution of HIC rival ion exchange chromatography; its selectivity is complementary to ion exchange and size exclusion chromatography; and its ability to clear endotoxins, nucleic acids, and viruses makes it an indispensable tool for the purification of therapeutic proteins. Choice of adsorbent Developing an efficient HIC method involves steps similar to these of other techniques scouting for potentially suitable adsorbents, optimization and scale-up. Adsorbents differ in the type of ligand, degree of substitution and base matrix. The correct choice is made after experiments to determine the best selectivity and strength of binding. Choice also depends upon the scale of operation and position in the purification scheme. PreDictor 96-well filter plates, prefilled with HIC media, and PreDictor RoboColumn units, minicolumns prepacked with HIC media, support high-throughput process development (HTPD) workflows by allowing for parallel screening of media and conditions, with minimal sample consumption. Capto Phenyl (high sub), Capto Butyl, and Capto Octyl are HIC media used in the capture and intermediate stages of protein purification. Their combination of high capacity, narrow specification range, high flow rate and low backpressure consistently reduces process cycle times and increases productivity. 4 Chromatography media Help with experimental design The theory of HIC, experimental design and process considerations are comprehensively described and discussed in the HIC/ RPC handbook. Please contact your local GE Healthcare office to obtain your copy or downloaded from our website

88 Selection guide Capture Polishing Sepharose Fast Flow Capto 4 Sepharose High Performance Chromatography media Getting started Unlike other chromatographic techniques where standard proteins may provide useful guidelines for predicting performance, HIC-based purifications require the experimental determination and optimization of a number of parameters. Many of the media described in this section can be ordered as laboratory-sized packs, as easy-to-use prepacked columns, or as PreDictor HIC screening plates. The small HiTrap columns, operated with a syringe, a peristaltic pump or a chromatography system, allow a particularly fast and simple way of screening key HIC media. They are available as a Selection kit. HiScreen (4.7 ml) prepacked columns are convenient and give reproducible results, making them well-suited for method development. In addition, 20 ml HiPrep columns are easy to use for initial scaling up. PreDictor plates can be used to rapidly determine optimal conditions and Intermediate purification to compare media performance. The method wizard in UNICORN controlled ÄKTA systems supports the most common scouting procedures, such as automatic media screening. A tool for screening different HIC media The HiTrap HIC Selection Kit consists of seven ready to use 1 ml prepacked columns for screening different types of ligands and for method development work at small scale. Phenyl Sepharose High Performance Phenyl Sepharose 6 Fast Flow (low sub) Phenyl Sepharose 6 Fast Flow (high sub) Butyl-S Sepharose 6 Fast Flow Butyl Sepharose 4 Fast Flow Butyl Sepharose High Performance Octyl Sepharose 4 Fast Flow 88

89 Hydrophobicity map of HIC media Butyl-S Sepharose 6 Fast Flow Octyl Sepharose 4 Fast Flow Butyl Sepharose 4 Fast Flow Phenyl Sepharose 6 Fast Flow (low sub) Butyl Sepharose High Performance Capto Octyl Capto Butyl Phenyl Sepharose High Performance Phenyl Sepharose 6 Fast Flow (high sub) Capto Phenyl (high sub) Increasing hydrophobicity 4 Sepharose Fast Flow Media for capture and intermediate purification in largescale production of biopharmaceuticals. These media are designed for robust, high capacity, high resolution, hydrophobic interaction chromatography at various stages of process-scale purification. The range of Fast Flow HIC media covers different selectivities. The appropriate choice for each application is difficult to predict and therefore several different media need to be tested. Butyl Sepharose 4 Fast Flow HIC medium with aliphatic ligand. The ligand gives different selectivity compared with phenyl media. Butyl-S Sepharose 6 Fast Flow A low-hydrohobicity HIC medium for capturing recombinant HBsAg and removing hydrophobic contaminants. Octyl Sepharose 4 Fast Flow Gives different and complementary selectivity compared with phenyl and butyl media. Phenyl Sepharose 6 Fast Flow (high sub) A high capacity HIC medium with a binding capacity for IgG and HSA up to 30 mg/ml at flow velocities of 100 cm/h. Has proven to be a very efficient capture medium. Phenyl Sepharose 6 Fast Flow (low sub) HIC medium with aromatic phenyl ligand. Sepharose High Performance Media for intermediate purification and polishing when high resolution is needed. Butyl Sepharose High Performance and Phenyl Sepharose High Performance Robust media for difficult purification problems when high resolution is the main objective. Is also very efficient for polishing monoclonal antibodies. Capto HIC media Capto Phenyl (high sub), Capto Butyl, and Capto Octyl are hydrophobic interaction chromatography (HIC) media used in the capture and intermediate stages of protein purification. These media are based on a highly-rigid agarose matrix that gives significantly improved pressure/flow properties to ensure high productivity. Capto Phenyl (high sub) and Capto Butyl Capto Phenyl (high sub) and Capto Butyl combine high capacity, narrow specification range, high flow rate, and low backpressure consistently reducing process cycle times and increasing productivity. Capto Octyl Capto Octyl is a high capacity medium available via the Custom Designed Media line in 25 ml, 1 L, and 5 L packs, as well as in PreDictor 96-well plate formats. Chromatography media = BioProcess media CDM = Custom Designed Media produced on receipt of order. 89

90 Multimodal chromatography 4 Chromatography media Technique description Multimodal separation is based on different types of interaction, depending on the nature of the multimodal ligand and overall process conditions. The most common interaction for GE Healthcare s line of multimodal ion exchangers is based upon the selective reversible adsorption of charged molecules to an immobilized multimodal ion exchange group of opposite charge with hydrophobic character. For other multimodal media, such as PlasmidSelect Xtra, the predominate interactions are of aromatic and thiophilic nature. Both types of media consist of an insoluble porous matrix to which the multimodal ligands have been covalently bound. In multimodal chromatography it is important to screen the overall process conditions (e.g. ph and conductivity) in order to evaluate the full potential of the media both for binding and elution mode. In many cases, the specific interaction between the multimodal ligand and the target molecules is a complex mixture of different interactions which is also very dependant of the overall process conditions. Media containing multimodal ligands are characterized by interactions that are different from those of traditional ligands and have in many cases been designed for a specific purpose. GE Healthcare s multimodal ligands also offers new selectivities that may be beneficial in other types of purification challenges where more traditional ligands do not offer the required selectivity. A range of Data files covering our Multimodal Chromatography media is available. Please contact your local GE Healthcare office to obtain your copy. Capto Core 700, Capto MMC, Capto adhere, PlasmidSelect Xtra,

91 Capto Core 700 OH OH O O N + The multimodal ligand of Capto Core 700, designed for robust binding of proteins and cell-debris -to be used with the layered beads technology for purification of large proteins or viruses. Capto MMC OH OH O O S NH The multimodal ligand of Capto MMC, designed for protein binding at high feed conductivities. O O O Capto Core 700 is a multimodal chromatography medium designed for purification of large proteins or viruses in vaccine processes. Capto Core 700 provides a multimodal alternative to size-exclusion chromatography and centrifugation that are typically employed in the polishing steps of such targets. Capto Core 700 beads consist of a ligand-activated core and inert shell. The pore size of the beads gives a restricted access to the ligandactivated core and provides a cut-off for molecules larger than M r Relative to size-exclusion chromatography, Capto Core 700 provides the advantages of high Capto MMC is a weak, multimodal cation exchanger belonging to the Capto family of BioProcess media for fast and cost efficient protein purification. Capto MMC allows for increased productivity and reduced cost with: High capacity at high conductivity High productivity New selectivity Capto MMC combines recent base matrix developments with an innovative ligand chemistry. Capto MMC is salt tolerant meaning that binding of proteins can be performed at the conductivity of the feed material, thus avoiding costly and time consuming dilutions of large volumes of water for injection in order to lower the conductivity prior to binding the protein to the column. Capto MMC has a multimodal ligand that may interact with the target molecule in multiple ways. It contains a carboxylic group and thus has purity, improved process economy, and increased productivity by: Enabling significantly higher sample load Enabling higher flow rates Ensuring straightforward optimization and scale-up The core of each bead is functionalized with ligands that are both hydrophobic and positively charged, resulting in a highly efficient multimodal binding of the various contaminants small enough to enter into the core. The multimodal property of the ligands in the core ensures strong binding with most impurities over a wide range of ph and salt concentrations. features that resemble those of a weak cation exchanger. However, in addition to the ionic interactions several other types of interactions are involved including hydrophobic bonding and aromatic interactions. High salt tolerance and new selectivity Capto MMC has the ability to bind proteins at high conductivities, as demonstrated by dynamic binding capacities of three different proteins under different conductivities. Dynamic binding capacity (mg/ml) Lysozyme ß-Lactoglobulin BSA Conductivity (ms/cm) Dynamic binding capacities of Capto MMC at 1 minute residence time for three different proteins ranging from low to high conductivities. 4 Chromatography media 91

92 4 Chromatography media Capto adhere O OH O OH Capto SP ImpRes or Capto S Capto adhere N + OH The multimodal ligand of Capto adhere designed for selective removal of contaminants after a Protein A capture step. Cell culture Cell removal MabSelect SuRe or MabSelect SuRe LX Virus inactivation and filtration Capto adhere Final UF/DF and sterile filtration Capto adhere is a strong multimodal anion exchanger belonging to the Capto family of BioProcess media. Capto adhere allows for increased productivity and reduced cost with: High capacity and productivity Removal of contaminants after a Protein A capture step Allowing for a two-step purification process of monoclonal antibodies New selectivity Capto adhere combines recent base matrix developments with an innovative ligand chemistry. Capto ahere is designed as a scavenger medium with the ability to selectively remove contaminants such as dimer/aggregates, host Capto Q Capto adhere Toolbox concept in the downstream purification of monoclonal antibodies using Capto adhere to reduce the total number of unit operations. cell proteins, and leaked protein A after a Protein A capture step of monoclonal antibodies. Capto adhere has a multimodal ligand that may interact with the target molecule in many different ways. It contains a quaternary ammonium group and thus has features similar to those of a strong anion exchanger. However, in addition to the ionic interactions, several other types of interactions are involved including hydrophobic bonding and aromatic interactions. Two-step process for MAb purification The multimodal functionality of Capto adhere offers features different from more traditional ion exchangers in terms of both the ability to selectively remove contaminants such as host cell proteins, leaked Protein A, aggregates and viruses after a Protein A capture step of monoclonal antibodies. In addition, the ligand of Capto adhere may also offer new selectivities for other types of purification challenges where more traditional ligands have not been successful. The downstream purification of monoclonal antibodies has traditionally been performed in three-step processes comprising Protein A as a capture step followed by anion exchange, cation exchange, and HIC steps in different combinations. Capto adhere offers the option to reduce the overall number of chromatographic steps in the purification of monoclonal antibodies by combining a highly efficient Protein A step based on MabSelect SuRe with a second step based on Capto adhere. 92

93 PlasmidSelect Xtra S N The multimodal ligand of PlasmidSelect Xtra showing a high selectivity between supercoiled and open circular plasmid DNA. Purified plasmid DNA is required in increasingly larger quantities to meet the emerging requirements for gene therapy and DNA vaccination. As both human and veterinary applications are in focus, plasmid DNA purity, quantity, and cost-per-dose requirements vary greatly. Process development to purify plasmid DNA at large scale must thus be: Flexible Easily scalable Robust Cost efficient PlasmidSelect Xtra combines agarose base matrix technology allowing for low, non-specific interactions with a multimodal ligand designed for selective separation between supercoiled plasmid DNA and open circular plasmid DNA. PlasmidSelect Xtra has a ligand that may interact with the target molecule in many different ways. It contains both a thioether and a pyridyl functional group and its features partly resemble those of a phenyl-based HIC medium. However, in addition to the hydrophobic interactions, several other types of interactions are involved including thiophilic bonding and aromatic interactions. PlasmidSelect Xtra platform Generic process for purification of supercoiled plasmid DNA. Screening Kit: Quick and easy analysis with an ÄKTA system Starter Kit: Prepacked columns for convenient process development Bulk media: PlasmidSelect Xtra, Sepharose 6 Fast Flow, and SOURCE 30Q are BioProcess media available in large quantities for scale-up and manufacturing. See A-Z of media and chemicals section of this catalog. 4 Chromatography media Fermentation Cell harvesting Lysis Clarification Concentration SOURCE 30Q Sepharose 6 Fast Flow Formulation Concentration Polishing Supercoiled plasmid DNA capture RNA removal The PlasmidSelect Xtra process, designed for the purification of high-quality, supercoiled plasmid DNA. 93

94 Reversed phase chromatography 4 Chromatography media Technique description Reversed phase chromatography (RPC) is in theory closely related to hydrophobic interaction chromatography. Both techniques are based on the interaction between hydrophobic patches on the surface of biomolecules and the hydrophobic groups covalently attached to the surface of the matrix. In practice, however, they are different. Media for RPC are typically highly substituted with hydrophobic ligands and the binding of substances to RPC media is usually stronger. Organic solvents are often required for elution. The technique is mainly applicable for peptides, proteins up to M r and other low molecular weight biomolecules that are stable in aqueous-organic solvents. Required for polishing RPC is a widely-used analytical technique but it is also employed in preparative applications, up to process scale, for more demanding polishing problems, such as separating microheterogeneities from the native molecule of recombinant peptides. RPC is also a standard technique for purifying synthetic peptides and oligonucleotides. The technique often requires medium to high-pressure columns and systems and explosionproof equipment for handling high concentrations of flammable, volatile organic solvents. RPC media from GE Healthcare are designed for difficult preparative separations at all scales. 94

95 Products SOURCE 15RPC and SOURCE 30RPC, both BioProcess media, are designed for fast, high performance preparative separations of biomolecules such as proteins, peptides and oligonucleotides. The media have matrices based on rigid, highly crosslinked, polystyrene/divinyl benzene, with monosized beads of diameters 15 µm and 30 µm respectively. Pore size distribution is controlled and reproducible. Emphasis during development has been on quality, reproducibility and scalability, features that are particularly important for industrial applications. Their wide ph stability (ph 1 to 14) and high capacity make SOURCE RPC media an interesting alternative 400-fold scale up on SOURCE 30RPC to silica-based media. The high chemical stability of the matrix offers exceptional flexibility when choosing running and cleaning conditions. SOURCE 15RPC is intended for polishing where fast, preparative separations with the highest resolution are required. SOURCE 15RPC is also available in prepacked columns RESOURCE RPC columns and ST 4.6/100 ÄKTA columns which are well-suited for selectivity screening experiments. SOURCE 30RPC is well-suited for the polishing stage of industrial processes where high flow velocities and low back-pressures are needed. 4 Chromatography media Column: Sample: Sample load: Solution A: Solution B: Flow velocity: Gradient: SOURCE 30RPC, 10 mm i.d. 300 mm column (24 ml) 200 mm i.d. 300 mm column (10 L) Mixture of Angiotensin II, Ribonuclease A and Insulin mg/ml media, total load 0.1% TFA/0.05 M NaCl 0.1% TFA/60% n-propanol 150 cm/h 20% to 70% B, 5 column volumes (cv) 2.0 A 280 nm 24 ml column 2.0 A 280 nm FineLINE 200L column (cv) (cv) A 400-fold scale up of a model sample mix on SOURCE 30 RPC. Going from a 24 ml laboratory-scale column to a 9.4 liter production-scale column in one step gives what is essentially identical results at both scales. 95

96 Gel filtration 4 Chromatography media Technique description Gel filtration separates biomolecules according to size. Large molecules elute either in the void volume or early in a chromatographic separation. Smaller molecules, depending on their degree of penetration of the pores of the matrix, elute later. Gel filtration is a simple technique which complements ion exchange, hydrophobic interaction, reversed phase, and affinity. In process chromatography, gel filtration is used principally for desalting the product, for buffer exchange, or for specific removal of contaminants with molecular weights above or below the desired product s molecular weight. Typically, molecules must differ in size by two-fold to yield a good separation, although other adsorptive effects can augment some separations where molecules are similar in size. Excellent range Gel filtration is useful at polishing or final purification stages where volumes are much lower than at the capture or intermediate stages and there is a need to remove dimers or aggregates. GE Healthcare has an excellent range of gel filtration media ranging from Sephadex G-types and different Sephacryl selectivities, to the Superdex family. GE Healthcare The handbook Gel Filtration Principles and Methods can be obtained through your local GE Healthcare office or downloaded from our website Gel Filtration Principles and Methods 96

97 Selection guide Capture Polishing Sephacryl Sepharose Fast Flow Superdex 4 Sephadex G-25 Intermediate purification Chromatography media Important characteristics of media for gel filtration include particle size, pore volume, adsorptive properties and matrix rigidity. The Sephacryl range of gel filtration products is available in five different selectivities covering a wide molecular weight range. All Sephacryl High Resolution media are available in convenient prepacked HiPrep 120 ml and 320 ml columns. Sepharose Fast Flow and Sephadex G-25 are chromatography media suitable for group separation such as desalting and buffer exchange. Sephadex G-25 media are available in prepacked HiPrep (53 ml) and HiTrap (5 ml) columns. The Superdex range of gel filtration media has been specifically designed to solve particular purification problems. The fractionation ranges are narrow and selectivity curves are steep compared with other gel filtration media. Additionally, Superdex media are available in prepacked HiLoad 120 ml and 320 ml columns, which are a convenient way of obtaining reproducible results at lab-scale. 97

98 4 Superdex prep grade High productivity gel filtration for Polishing Superdex prep grade is a high resolving gel filtration medium with average particle size of 34 µm. It is a composite of cross-linked agarose and dextran. Superdex 30 prep grade is well-suited for the Polishing and formulation of peptides with molecular weights of less than , Superdex 75 prep grade is designed for the separation of recombinant DNA products, and Superdex 200 prep grade is particularly useful for the separation of monoclonal antibodies from dimers and low molecular weight contaminants (e.g., albumin and transferrin). Typical flow velocity is up to 50 cm/h and back pressure is typically below 3 bar with a 60 cm bed height. All of the Superdex prep grade media are available in prepacked high performance HiLoad 120 ml (16/60) and 320 ml (26/60) columns. Superdex 30 prep grade Superdex 75 prep grade Superdex 200 prep grade Chromatography media Sephacryl High Resolution Well established high resolution gel filtration for production Sephacryl High Resolution media give high resolution and are very well established in production process and industrial scale applications. They are a cost effective alternative to Superdex prep grade media. All Sephacryl High Resolution media are available in convenient, prepacked HiPrep 120 ml (16/60) and 320 ml (26/60) columns. Sepharose Fast Flow Industrial scale separations of very large molecules and virus particles The properties of Sepharose 4 and 6 Fast Flow media make them suitable for industrial scale gel filtration and are often used for group separations. Sepharose 6 Fast Flow is part of the Plasmid Select Xtra process used for RNA removal. Sephacryl S-100 High Resolution Sephacryl S-200 High Resolution Sephacryl S-300 High Resolution Sephacryl S-400 High Resolution Sephacryl S-500 High Resolution Sepharose 4 Fast Flow Sepharose 6 Fast Flow Sephadex G-25 Well established for desalting and buffer exchange Sephadex G-25 media are well established for desalting and buffer exchange in industrial applications. These media have a low exclusion limit and separate macromolecules from salts and buffer substances with a minimum of sample dilution. Prepacked HiPrep 26/10 Desalting columns (53 ml) and HiTrap Desalting 1 ml and 5 ml columns are available for fast and convenient desalting. Note that several columns can be coupled in series to increase sample volume to be buffer exchanged (desalted). Sephadex LH-20 Gel filtration in organic solvents This medium is for use with organic solvents when separating small molecules, lipids, steroids, fatty acids, hormones, etc. Sephadex G-25 Coarse Sephadex G-25 Medium Sephadex G-25 Fine Sephadex G-25 Superfine Sephadex LH-20 = BioProcess media 98

99 Application guide For very small molecules For peptides and globular proteins Superdex 30 prep grade Superdex 75 prep grade Superdex 200 prep grade For larger molecules or particles Sephacryl S-100 High Resolution Sephacryl S-200 High Resolution Sephacryl S-300 High Resolution Sephacryl S-400 High Resolution Sephacryl S-500 High Resolution Sepharose 6 Fast Flow Sepharose 4 Fast Flow Sepharose CL-2B 4 Sephadex G-25 C Sephadex G-25 M Sephadex G-25 F Sephadex G-25 SF C=Coarse M=Medium F=Fine SF=Superfine Chromatography media Getting started Testing the performance of chromatography media at the laboratory bench will help you select the most appropriate for processscale use. Prepacked HiLoad, HiPrep, and HiTrap columns are convenient and give reproducible results. 99

100 Custom Designed Media 4 Chromatography media The Custom Design Media (CDM) group provides large scale operators with chromatography media designed for their specific purification tasks. By tailoring a chromatography medium for your specific problem a CDM project aims to give you a more robust process and improved process economy. The Custom Designed Media can be made on an exclusive basis, but are often launched as a generally available product. Currently available CDM media are listed on the opposite page. Note: Many CDM media have become standard products and are classed as BioProcess media. They are supported accordingly. These media are described elsewhere in this catalog in the relevant technique sections. Custom Designed Media projects A CDM project is run according to ISO 9001 routines and in collaboration with the customer, often under a confidentiality agreement. An experienced team works with you from the initial discussions right through to bulk delivery: establishing your needs, sorting through choices, and producing and testing the finished product to meet your delivery schedules. The final product is often a new combination of our existing base matrices and a ligand. The ligand could be one of our own, be available from an external supplier, extracted from a ligand library or discovered by you. Projects are carried out in three stages media definition, media assurance and full-scale production and validation. Media definition The first stage involves discussions about the construction (matrix, ligands and coupling chemistry) required to obtain the desired product function. Alternatives can be suggested and samples prepared for your evaluation. From this evaluation and further discussions, the medium is defined. Media assurance After proof-of-principle has been obtained, a robust and scalable manufacturing process is developed. This includes optimization of the medium design and development of relevant analytical methods to secure functionality. Preliminary specifications are set for the mutually agreed test criteria. Pilot scale volumes can be delivered when needed

101 Full-scale production and validation In the final stage the process is scaled up to a manufacturing scale appropriate for the customer needs. Test methods are validated and final specifications are set. If the product has potential as a widelyused product, it will be launched as a CDM product in the catalog. After delivery of several manufacturing batches to the customer, the process is validated. CDM products are not kept in stock but only manufactured on order. Every CDM product is designed to meet the stringent quality standards for commercial industrial use. Each undergoes full quality control, both during development and at full-scale production. Specific studies, such as stability, can be performed and Regulatory Support Files can be provided. Custom products GE Healthcare offers a large selection of prepacked columns and bulk media encompassing most liquid chromatography techniques. Should you require a special configuration or combination of column and medium not offered in the catalog, just contact your local sales office and ask for Custom Products. For further information about CDM, please contact your local GE Healthcare office. See also process development on page 158 for details. Ordering information Product Pack size 6-AKS Sepharose 4 Fast Flow 1 L Alpha-1 Antitrypsin Select 25 ml ml L L Amino Sepharose 6 Fast Flow 1 L Capto Blue (hs) 25 ml ml L Capto Octyl 25 ml ml Chelating Sepharose Big Beads 1 L L IgSelect 25 ml ml L LambdaFabSelect 25 ml ml L L MacroCap Q 25 ml ml L Plasminogen Removal Gel 1 L Procainamide Sepharose 4 Fast Flow 1 L L VIISelect 25 ml ml L L VIIISelect 25 ml ml Chromatography media 101

102 5 Chromatography columns AxiChrom 106 Chromaflow 110 BPG 114 INdEX 122 FineLINE 126 HiScale 132 Custom-packed laboratory columns 134 Manufacturing Solutions column packing

103

104 Columns for process chromatography 5 When a chromatographic step is developed to be an integral part of a manufacturing process, the choice of column is important to assure consistent performance and reliable operation. With over 30 years experience in process chromatography, GE Healthcare can provide you with a wide range of columns that ensures the highest performance from our separation media and meets the demands of modern biopharmaceutical manufacturing. Know-how in packing methodology is available through our User Manuals. Workshops with lectures and hands-on training can be arranged through our Fast Trak services. Chromatography columns 104

105 Points to consider when selecting your column Dimensions: To determine the appropriate column diameter at fullscale, calculate the column volume (or medium quantity) required based on your current scale, keeping bed height constant (usually 5 to 20 cm for adsorptive techniques and 50 to 70 cm for gel filtration). If the exact diameter is not available, choose a wider diameter column, the advantage being increased capacity. Specifications: Particle size, size distribution, flow rates and the solvent used will affect your choice of column. As particle size decreases, operational pressures increase. Two different media with the same nominal particle size, but with different particle size distributions may have significantly different pressure requirements. Solvent systems may restrict the choice of column materials, for example plastic or rubber components are unsuitable for use with some organic solvents. High salt buffers may dictate the grade or type of metal component, such as stainless steel 316L. Design features: Proven hygienic design and high quality materials are necessary if the column is to be used for biopharmaceutical production. A fixed bed column is easier to clean than the respective variable bed height column, but this must be set against the greater flexibility afforded by the variable height. For media requiring additional bed compression at the end of the packing procedure, a variable bed height column would be needed. In process development, diagnostics, or reagent manufacturing, some design criteria are less critical, and for example the use of threaded or sanitary connections may not be as important. Select only columns with a proven distribution system since performance can be jeopardized with inadequate distribution of sample and buffer. Bed support porosity is dictated by the particle size of the medium used. Regulatory support: Columns used in biopharmaceutical production or other regulated environments are scrutinized by regulatory authorities. Increasingly, documentation on materials compliance and toxicological data are requested. GE Healthcare supports the columns recommended for use in therapeutic manufacturing with hardware product documentation. The information in these files can save you valuable time when submitting clinical and marketing applications to regulatory authorities. In addition, Fast Trak can support installation and operational qualifications. Technical support online: The process chromatography technical support portal provides users with a range of information including column and system recommendations, spare parts and accessories for columns and systems, column packing and testing information, and troubleshooting guides. Refer to Regulatory and Technical Support Services. 5 Chromatography columns For further information on Online regulatory and technical support, see page 226. Visit us on the web at

106 AxiChrom columns 5 Chromatography columns AxiChrom columns simplify column handling at all scales from process development to full-scale production. AxiChrom columns introduce three key features Intelligent Packing, Intuitive handling, and Predictable scale-up that together make process chromatography easier, safer, and more efficient. Intelligent Packing Verified, preprogrammed, axial compression packing methods save time and ensure accurate and reproducible packing results. This built-in experience reduces operatordependence and facilitates faster product change-over. Visit us on the web at Intuitive handling Columns are simple to operate and service. Pivot or swing-out column tubes are safer and easier to handle. AxiChrom Master and UNICORN wizards guide users through key process steps to save time in method creation, set-up and maintenance. Predictable scale-up Straightforward scale-up and techtransfer due to a liquid distribution system designed using the same analytical and computational fluid dynamic modeling tools. Sanitizable columns support cleaning validation. Full technical and regulatory support promote fast, trouble-free start-up. The entire AxiChrom column line, from 50 to 1000 mm, provides exceptional performance with new generation, high-flow Capto and MabSelect media families as well as with other BioProcess media

107 AxiChrom features User-configurable including stainless steel or plastic bed supports, 10 or 20 µm, column material, column tube length; contact local sales representative Small (50 70 mm) columns with two different tube lengths allowing bed volumes between 0.2 to 2 L Available with stainless steel or single-use plastic bed supports Pressure rating at 20 bar g (50 mm), 15 bar g (70 mm), and 4 bar g ( mm) Sanitary design with recommended CIP methods Preprogrammed, verified packing methods for Capto, MabSelect and Sepharose Fast Flow media families through Intelligent Packing cgmp compliant documentation The same level of documentation is available for all column sizes, including traceability to batch level for wetted materials meets the requirements of USP Class VI, 21 CFR Part 177 and animal-free origin Supported with IQ/OQ documentation packages What do I need? Useful accessories Pivot stand needs to be ordered separately for AxiChrom 50. The column is delivered with a foot stand. Tubing kits are available for different set ups depending on column dimension, chromatography medium, and chromatography system. Available toolkits (with optional torque wrench) simplify maintenance and assure column functionality. Useful spare parts to keep on site Bed supports, a complete set of O-rings and scraper sealing. Assembly/disassembly of column The centering plug delivered with the column must be used when assembling the columns. A tool kit with the necessary tools can be ordered separately. 5 Chromatography columns 107

108 Technical specifications AxiChrom 50 AxiChrom 70 AxiChrom 100 AxiChrom 140 AxiChrom 200 Inner column diameter (mm) Column type 50/300 50/500 70/300 70/ / / / / / /500 Bed height 1 (cm) Weight, empty column 2 (kg) Weight, column stand (kg) Max. operating work height (mm) Max. operating pressure (bar g) Max. packing pressure (bar g) Footprint, foot (mm mm) Footprint, stand (mm mm) Operating temperature ( C) Adapter movement Internal hydraulic Internal hydraulic Internal hydraulic Bed support (μm) 10, , , Adapter stroke length for short column tube: Min/max limits 5 35 cm Adapter stroke length for long column tube: Min/max limits cm 2 Weight includes stainless steel bed support 3 20 μm supports are standard; 10 μm can be special ordered 5 Chromatography columns AxiChrom 300 AxiChrom 400 AxiChrom 450 AxiChrom 600 AxiChrom 800 AxiChrom 1000 Inner column diameter (mm) Column type 300/ / / / / / / / / / / /500 Bed height 1 (cm) Weight, empty column 2 (kg) Min height (mm) Max. operating work height (mm) Max. height for maintenance (mm) Footprint, foot (mm mm) Max. operating pressure (bar g) 4 Operating temperature ( C) 2 30 Adapter movement Servo motor Bed support (μm) 10, 20 1 Adapter stroke length for short column tube: Min/max limits 1 57 cm Adapter stroke length for long column tube: Min/max limits 1 83 cm 2 Weights are for PMMA column tube and stainless steel bed support AxiChrom 50 AxiChrom 70 AxiChrom 100 AxiChrom 140 AxiChrom 200 Bed height (cm) Column volume 1 (L) AxiChrom 300 AxiChrom 400 AxiChrom 450 AxiChrom 600 AxiChrom 800 AxiChrom 1000 Bed height (cm) Column volume 1 (L) Column volumes do not take medium compression into consideration For extensive information on spare parts, accessories, and dimensions of AxiChrom columns, visit

109 AxiChrom 140 and AxiChrom 200 Parts/Accessories Quantity Ordering information Product Mechanical locking Mechanical locking Silicone tubing kit AxiChrom 140, i.d. 3.2 (ÄKTAprocess) Silicone tubing kit AxiChrom 140, i.d. 4.8 (ÄKTAprocess) Silicone tubing kit AxiChrom 200, i.d. 6.4 (ÄKTAprocess) TC 25 Clamp SS TC gasket 25/ TC end cap TC Media stirrer (80 mm) Media stirrer (150 mm) User Manual AxiChrom 140 and Tool kit small AxiChrom 50/70/100/140/ Tool kit large AxiChrom 50/70/100/140/ Torque wrench kit AxiChrom Torque driver kit AxiChrom Outlet tubing kit AxiChrom 140, AxiChrom 50/300/Glass/20SS AxiChrom 50/500/Glass/20SS AxiChrom 70/300/Glass/20SS AxiChrom 70/500/Glass/20SS AxiChrom 100/300/Glass/20SS AxiChrom 100/500/Glass/20SS AxiChrom 140/300/Glass/20SS AxiChrom 140/500/Glass/20SS AxiChrom 200/300/Glass/20SS AxiChrom 200/500/Glass/20SS AxiChrom 300, 400, 450, 600, 800, and 1000 Please contact your GE Healthcare representative The AxiChrom names above reflect: inner column diameter/maximum bed height/column material/bed support size and material. Note: AxiChrom columns are available with 10 µm stainless steel bed supports as well as 10 µm and 20 µm plastic bed supports, and can be ordered via a sales configurator. Please see additional information below. AxiChrom 50, AxiChrom 70, and AxiChrom 100 Parts/Accessories Quantity Pivot stand 50/70/ Pivot stand 50/70/ AxiChrom foot Mechanical locking Mechanical locking Mechanical locking Tool kit small AxiChrom 50/70/100/140/ Tool kit complete AxiChrom 50/70/100/140/ Torque wrench kit AxiChrom Torque driver kit Tubing kit AxiChrom 50 ÄKTAexplorer / desk Tubing kit AxiChrom 50 ÄKTAexplorer / floor Tubing kit AxiChrom 50 ÄKTApilot / desk Tubing kit AxiChrom 50 ÄKTApilot / floor Tubing kit AxiChrom 70 ÄKTApilot / floor Media stirrer (40 mm, for AxiChrom 50/70) Media stirrer (80 mm, for AxiChrom 100/140) Literature Data file AxiChrom columns Application note Sanitization of AxiChrom columns High-productivity capture of alpha-chymotrypsin on Capto S ion exhanger Handling of stainless steel column parts in sensitive environments Configurable AxiChrom columns, parts, and accessories Smaller columns without standard code numbers and all larger columns with diameters of 300 mm and larger, are configurable and ordered via a sales configurator. Columns can be tailored to requirements using this configurator. The configurator also creates an extensive documentation package including General Specification, Bill of Materials, Assembly Drawing, Spare Parts List, Site Preparation Guide, as well as a price quotation. Via the sales configurator, dynamic wizards for accessories and spare parts recommend a number of accessories and spare parts exactly matching the column and interface to a chromatography system. This facilitates easy, fast and correct selection, all fulfilling the same standards as the column. Examples of accessories: tubings, T-junctions, reducers, gaskets and clamps, casters, safety valves, manual valves, tool kit, and media stirrer. The sales configurator is also used to recommend upgrade kits for ÄKTAprocess systems that were delivered prior to Intelligent Packing being available. By entering the ÄKTAprocess system serial number, the applicable kit(s) for that system is given. Please contact a GE Healthcare sales representative for assistance in using the AxiChrom configurator. 5 Chromatography columns 109

110 Chromaflow columns 5 Chromatography columns Chromaflow columns represent an innovative development in process scale chromatography resulting in improved process reliability, safety and economics. With Chromaflow columns, packing, operation, unpacking and cleaning can be done without removing the lid or adaptor all due to the design of the nozzle in both the top and bottom end-pieces. With the establishment of packing protocols for individual media, large-scale chromatography is more convenient, scalable and safer for both the operators and the product. Chromaflow columns are intended for GMP production. Materials of manufacture and column design, which are consistent over all scales, meet the demands of regulatory authorities for cgmp facilities producing biopharmaceuticals. For customized Chromaflow columns, please contact your local representative. Chromaflow range Diameters from 300 to 2000 mm Design principle is common to all column dimensions making scale-up a simple operation 3 bar pressure rating as standard and up to 5 bar as custom made Transparent, high quality cast acrylic or electropolished stainless steel tube Hygienic design tested in microbial challenge studies Packing stations simplify packing and unpacking All polymeric materials are approved according to USP Class VI tests for toxicity Full documentation package Validation support documentation available on request Documentation to support validation delivered with the product Available with external hydraulics for adapter movement and maintenance purposes 110

111 Properties of Chromaflow columns Design specifications Design temperature 4 C to 30 C Operating pressure 3 bar CE-directive compliance PED/ATEX100 Design standard GE Healthcare GEP Surface finishes, stainless steel Internal wetted < 0.5 μm Ra EP Non-wetted parts < 3 μm Ra EP Material specifications Tube Acrylic (PMMA), 316L Distributor plates Polypropylene Bed supports Polyethylene or 316L/S32205 Seals FEP encapsulated silicone & EPDM Nozzle body Polypropylene Nozzle tube PEEK, 316L Nozzle tip PEEK Stand 316 For more information contact your GE Healthcare representative. Principle of operation Nozzles sit in both the top and bottom of the column allowing packing in either an upward or downward direction. There are three nozzle positions: mid-position, for priming and packing; retracted, for running; and fully extended into the column for unpacking and cleaning. The nozzle also enables isolation of slurry lines from the mobile phase during operation, allowing removal of residual medium and cleaning of the slurry lines independently of the rest of the column. In the example opposite, packing is via the lower nozzle with upward flow. Packing position The bottom nozzle extends part of the way (mid position) into the column. The top nozzle is fully retracted. Slurry enters the column via the bottom nozzle and excess liquid exits via the top mobile phase outlet. After packing, the slurry lines are isolated from the mobile phase and can be cleaned independently from the rest of the column. Running position The top and bottom nozzles are retracted. Mobile phase enters the column directly into an annulus immediately behind the bed support. The annulus is cut through at an angle to ensure that the linear flow rate is kept constant during distribution of the mobile phase across the bed. Unpacking position In this position, both bottom and top nozzles are fully extended into the column, thereby exposing a third passage through which medium leaves the column. Cleaning solution can be pumped through the nozzles and sprayed into the column. In this way, the column is easily and effectively cleaned without exposing the interior or the medium to the outside, or without dismantling the column. 5 Chromatography columns 111

112 Ordering information Chromaflow columns Bed support Bed support Bed support with acrylic tubes 10 mm SS sinter 20 mm SS sinter 20 mm PE sinter I.d. 400 mm Man. nozzle Stroke length Stroke length Stroke length I.d. 400 mm Auto. nozzle Stroke length Stroke length Stroke length I.d. 400 mm SFP* Man. nozzle Stroke length Stroke length Stroke length I.d. 400 mm SFP Auto. nozzle Stroke length Stroke length Stroke length Chromatography columns I.d. 600 mm Man. nozzle Stroke length Stroke length Stroke length I.d. 600 mm Auto. nozzle Stroke length Stroke length Stroke length I.d. 800 mm Man. nozzle Stroke length Stroke length Stroke length I.d. 800 mm Auto. nozzle Stroke length Stroke length Stroke length I.d mm Man. nozzle Stroke length Stroke length Stroke length I.d mm Auto. nozzle Stroke length Stroke length Stroke length For column specifications other than listed in the table, please contact your local GE Healthcare representative. * SFP = Small Flow Path on mobile phase, only available on 400 mm i.d. columns

113 Options to the standard configuration Details Casters Nozzle pipings Description Chromaflow Packing stations For columns with a maximum diameter up to 1000 mm. Extension pipings for the Mobile phase inlet top and Slurry outlet top (avoids tubing getting bent) Chromaflow Packing station Pack Chromaflow Packing station Pack Chromaflow Packing station Pack 200 Chromaflow Packing station Pack 400 Chromaflow Packing station selection guide Custom order Custom order Packing Station Min L/min Max L/min* Pack Pack Pack Pack Chromaflow MKIII caster kits Casters to mm MKIII columns Casters to mm MKIII columns Chromaflow Nozzle pipings Chromaflow Nozzle piping 400 1/2 in Chromaflow Nozzle piping 400 3/4 in Chromaflow Nozzle piping in Chromaflow Nozzle piping 600 1/2 in Chromaflow Nozzle piping 600 3/4 in Chromaflow Nozzle piping in Chromaflow Nozzle piping 800 1/2 in Chromaflow Nozzle piping 800 3/4 in Chromaflow Nozzle piping in Chromaflow Nozzle piping /2 in Chromaflow Nozzle piping /4 in Chromaflow Nozzle piping in * Packing flow rate depends on back pressure as well as air supply pressure and flow rate. Accessories for Chromaflow columns Accessory Qty/pack Material Valves 4-port 2-way, i.d. 10 mm, 25 mm TC SS 316L/PTFE 4-port 4-way, i.d. 10 mm, 25 mm TC SS 316L/PTFE 3-port 2-way, i.d. 15 mm, 25 mm TC SS 316L/PTFE 4-port 4-way, i.d. 20 mm, 51 mm TC SS 316L/PTFE 3-port 2-way, i.d. 22 mm, 51 mm TC SS 316L/PTFE 3-port 2-way, i.d. 35 mm, 51 mm TC SS 316L/PTFE Valve sealing washer fits 10 mm 2 and 4-way valves PTFE Tubing with sanitary fitting 25 mm TC i.d. 10 mm, 900 mm PVC i.d. 10 mm, 1400 mm PVC i.d. 10 mm, 1700 mm PVC i.d. 10 mm, 2000 mm PVC i.d. 14 mm, 750 mm PVC i.d. 14 mm, 1800 mm PVC Tubing with sanitary fitting 51 mm TC i.d. 19 mm, 900 mm PVC i.d. 19 mm, 1400 mm PVC i.d. 19 mm, 2000 mm PVC i.d. 19 mm, 4000 mm PVC Clamp gasket 25 mm i.d., 10 mm EPDM 25 mm i.d., 12 mm EPDM 51 mm i.d., 22 mm EPDM 51 mm i.d., 38 mm EPDM Clamp 25 mm SS 304 Clamp 51 mm SS 304 Blind flange 25 mm incl. gasket SS 304/EPDM Blind flange 51 mm incl. gasket SS 304/EPDM Safety valve, 3 bar, 51 mm TC SS 316/EPDM T-junction i.d. 10 mm, 2 25 mm, 1 51 mm TC SS 316 T-junction i.d. 22 mm, 3 51 mm TC SS 316 Castors, assembly kit * Castors, assembly kit * Pressure sensor i.d. 10 mm 25 mm TC SS 316 Pressure sensor i.d. 22 mm 51 mm TC SS 316 Connectors i.d. 10, 25 mm TC 3/4 in 20 UNF threaded PP i.d. 10, 25 mm TC-i.d. 14, 51 mm TC PP i.d. 14, 51 mm TC-i.d. 22, 51 mm TC PP i.d. 22, 51 mm TC i.d. 10, 25 mm TC PP i.d. 22, 51 mm TC i.d. 14, 25 mm TC PP * The kit contains a complete set for a column Material abbreviations: EPDM=ethylene propylene diene, PP=polypropylene, PTFE=polytetrafluoroethene, PVC=polyvinyl chloride, SS=stainless steel Literature Data file Chromaflow columns Application note Sanitization of Chromaflow 400 column Documentation to support validation available online at 5 Chromatography columns 113

114 BPG columns BPG columns are glass columns designed for use in the production of biopharmaceuticals or any product made in a regulated or current Good Manufacturing Practice (cgmp) environment. The columns are manufactured with materials carefully selected for their compatibility with the solvents most commonly used in biopharmaceutical manufacture. All polymeric materials are approved according to USP Class VI tests for toxicity. 5 Chromatography columns BPG range Scalable from inner diameters of 100 mm to 450 mm and bed volumes from 2 to 121 L Pressure rating up to 8 bar Proven hygienic design and easy cleaning-in-place For use with a variety of techniques and chromatographic media, especially BioProcess media (Superdex, Sepharose High Performance and Fast Flow, and Sephacryl) Proven distribution system Sanitary TC connections throughout Materials include electropolished stainless steel, calibrated borosilicate glass, EPDM and fluoroplastics all with high chemical resistance All polymeric materials are approved according to USP Class VI tests for toxicity IQ and OQ documentation packages available Validation support documentation available on request Packing devices available for long bed heights 114

115 Overview of BPG columns Column Diameter (mm) Column Area (cm 2 ) Column Height (cm) Min Max 1 Bed height (cm) Packing with extension 2 Running with extension 3 Min Max 1 Volume (L) Packing with extension 2 Running with extension 3 Max. pressure (bar g) 4 Total weight (kg) Adapter weight (kg) Overall dimensions (cm) D W H Bed volumes and bed heights are based on a slurry concentration of 75% and a packing compression of 15%. Where compression is the difference in volume between a sedimented bed and a bed under pressure. 1 Values achievable without a packing extension. 2 Values achievable when a packing extension is used for sedimentation of the bed (75% of the slurry must fit into the column and extension when the adapter is mounted). 3 Values achievable when the packing extension remains attached to the column for the duration of column use. The adapter must seal at least 5 cm into the column tube to avoid high tensions in the glass tube. 4 Use a manometer to monitor the pressure. What do I need? The column BPG 100, 140, and 200; stand kit must be ordered separately. BPG 100 has adjustable feet, wheels with brakes are available. BPG 140 and 200 stands have wheels with brakes as standard. BPG 300 and 450 are supplied with stainless steel stand with wheels and foot-operated brakes. Useful spare parts Nets: The column is delivered with 23 µm (polypropylene) nets. For media with an average particle diameter < 70 µm, change to 10 µm (polyamide) or 12 µm (PEEK) in both adaptors and endpieces. For Sepharose Big Beads use 54 µm nets. Longer bed heights Packing extensions are available for all diameters. Isolating the column after packing We recommend using sanitary stainless steel valves of the appropriate inner diameter to prevent contamination of the packed bed. The 2-way or 4-way valves with a 6 mm i.d. are suitable for BPG 100, 140 and 200 columns. The 10 mm i.d. is suitable for BPG 300 and 450 columns. For storage purposes, the 25 mm blind flange with a clamp and gasket can be used to seal off the column. 5 Chromatography columns O-rings: FEP adaptor and sealing O rings if solvents not compatible with the EPDM O-rings supplied with the column. Gaskets: Use PTFE gaskets if solvent not compatible with EPDM. Spare parts to keep on site All nets, support screens and O-rings. In some cases, a spare tube may be advisable. Standard accessories: packing extension, tubing, valves, safety valves, air trap, T-junction, pressure relief valve, clamps, gaskets, manometer and top-valve

116 5 Connecting the column to your system A clamp and gasket, 6 or 10 mm i.d., are required to connect the 25 mm sanitary flanged inlet/outlet to either valves or tubing of the same type. Preflanged tubing in 6 and 10 mm i.d. is available. Assembly/disassembly of column A torque wrench with an appropriate sized socket is required and can be ordered separately. Useful column accessories Air Traps: BPG Air Trap Complete includes the air trap, mounting bracket, steel valves, clamps and gaskets. For air traps for BPG 100, 140 and 200, tubing is included. Top valve: Manually operated valve recommended at the top of the airtrap as an air outlet control. Manometers: Manometer kits contain a pressure gauge, T-junction, and necessary clamps and gaskets for sanitary connections. Pressure relief valves: Connected between the pump and column inlet permit flow delivery at a constant pressure throughout the packing procedure. Safety valve: Precalibrated valve that releases pressure if the calibrated value is exceeded. Recommended if the column may exceed its maximum pressure limit and no other pressure sensor is included in the chromatographic system. T-junction, clamps and gaskets have to be ordered separately. Earlier design: For ordering accessories and spare parts to the former design of the BPG 100, 200 and 300 columns, design pressure 3 bar, see Instruction Manual, Code number Suitable systems: BPG columns are designed for use with ÄKTAprocess or ÄKTApilot systems and have design pressures of 8 bar (BPG 100), 6 bar (BPG 140 and 200), 4 bar (BPG 300) and 2.5 bar (BPG 450). Please contact your local GE Healthcare representative for details. Chromatography columns Ordering information Column 500 mm 750 mm 950 mm Stand BPG BPG BPG BPG included 1000 mm BPG included Each column includes as standard: 23 µm polypropylene filter bed supports and polypropylene coarse bed supports, 2 clamps, 2 EPDM gaskets, 2 blank caps and O-rings in EPDM. Air trap, top valve, manometer and safety valve. Literature Data files BPG Columns 100, 140, 200, 300, and 450 series Application notes Sanitization of BPG Columns Sanitization of BPG 450 Column Documentation to support validation available on request. Contact your local GE Healthcare office. Column with packing extension

117 Accessories for BPG 100, 140, and 200 columns Accessory Material Qty/Pk BPG 100 BPG 140 BPG 200 Air trap complete 1 316/glass Top valve 1 316/EPDM T-junction i.d. 6 mm Valve sealing washer 3 PTFE Manometer kit 4 (0-10 bar) 304/316/EPDM Wheel with brake, columns Wheel with brake, columns Adjustable foot Torque wrench point opening socket Allen key Packing device 5,6 glass Grounding kit Media stirrer (80 mm plate diam.) PP Tubing with sanitary fitting 1 (i.d. 6 mm) 30 cm PVC cm PVC cm PVC cm PVC cm PVC Connectors (see p ) TC-6 mm threaded PP TC-25 mm clamp, 6 mm 1/2 in threaded PP TC-M6 threaded PP TC-i.d. 22, 51 mm TC PP Clamps, gaskets Clamp 25 mm Clamp 51 mm TC-Gasket 25 mm i.d 8 mm EPDM TC-Gasket 25 mm i.d. 6.5 mm FPM/FKM Gasket 51 mm i.d. 22 mm EPDM TC-Gasket 5 mm i.d. 22mm FPM/FKM Blind flange 25 mm incl. gasket 304/EPDM Blind flange 51 mm incl. gasket 304/EPDM Valves 4port, 2way i.d. 6mm 1 316L/PTFE port, 4way i.d. 6mm 1 316L/PTFE Pressure relief valve i.d. 6mm 1 316/FPM Safety valve 4, 7 316/PTFE Chromatography columns 1 25 mm TC mm, 1 51 mm TC 3 Fits 6 and 10 mm, 2- and 4-way valves 4 51 mm TC 5 The packing device consists of a 380 mm height glass tube, flanges, rods, O-rings in EPDM, nuts and screws 6 For O-rings as spare parts, see column documentation manuals 7 BPG bar, BPG 140 and bar 117

118 5 Chromatography columns Accessories for BPG 300 and 450 columns Accessory Material Qty/Pk BPG 300 BPG 450 Air trap complete 1 304/316/glass/ EPDM Top valve 1 316/EPDM Torque wrench point opening socket Allen key Packing device 2, 3 glass Packing device 4, T-junction i.d. 10 mm Valve sealing washer 6 PTFE Manometer kit7 (0 6 bar) 316 L Wheel with brake, columns Wheel with brake BPG Media stirrer (150 mm plate diameter) PP Tubing with sanitary fitting 1 length i.d. 30 cm 10 mm PVC cm 10 mm PVC cm 14 mm PVC cm 10 mm PVC cm 10 mm PVC cm 10 mm PVC cm 14 mm PVC cm 10 mm PVC Connectors (see p ) TC 25 mm clamp-10mm 1/2in Th PP TC 25 ID10/TC51 ID14 PP Connector TC50 ID14 / TC50 ID22 PP Clamps, gaskets Clamp 25 mm Clamp 25 mm Clamp 51 mm Gasket 25 mm i.d. 10 mm EPDM TC-Gasket 25/10,5mm FPM/FKM Gasket 25 mm i.d. 12 mm EPDM Gasket 25 mm i.d. 12 mm FPM/FKM Blind flange 25 mm incl. gasket 304/EPDM Gasket 51 mm i.d. 10 mm EPDM Gasket 51 mm i.d. 14 mm EPDM Gasket 51 mm i.d. 22 mm EPDM Gasket 51 mm i.d. 22 mm FPM/FKM Blind flange 51 mm incl. gasket 304/EPDM Valves 4port, 2way i.d. 10 mm 1 316L/PTFE port, 4way i.d. 10 mm 1 316L/PTFE port, 2way i.d. 15 mm 1 316L/PTFE Pressure relief valve i.d. 10 mm 1 316/FPM Safety valve 7 316/EPDM mm TC 2 The packing device consists of a 380 mm height glass tube, flanges, rods, O-rings in EPDM, nuts and screws 3 For O-rings as spare parts, see Flange O-rings for the respective column in Table 1 on page 3 4 The packing device consists of a 300 mm high stainless steel tube, O-rings, nuts and a clamp mm, 1 51 mm TC 6 Fits 6 and 10 mm, 2- and 4-way valves 7 BPG bar, BPG bar 118

119 Spare parts for BPG 100, 140, and 200 columns Description Material In contact with process liquid? Qty/pk BPG 100 BPG 140 BPG 200 Column tube 500 Borosilicate glass Yes Column tube 750 Borosilicate glass Yes Column tube 950 Borosilicate glass Yes Rod for tube Rod for tube Rod for tube Guide ring PTFE Net, 54 μm, end-piece PP Yes Net, 23 μm, end-piece PP Yes Net, 10 μm, end-piece PA Yes Net, 12 μm, end-piece PEEK Yes Support net, end-piece PP Yes Flange O-ring EPDM Yes Flange O-ring FEP Yes Nut, M Nut, M Washer A Washer A Flange End-piece 316L Yes Bolt Washer Stand, complete 316L Clamp, 25 mm Adjusting knob PEEK Domed nut Adjuster nut, body Bushing ring POM Top plate Adjuster nut, insert PEEK Allen screw, M Allen screw, M Stopper Adaptor head screw Sealing unit 316L Adaptor O-ring EPDM Yes Adaptor O-ring FEP Yes Inner adaptor tube Outer adaptor tube Screw, M L/PTFE Spring 316/PTFE Adaptor plate1 S Yes Support net, adaptor PP Yes Net, 54 μm adaptor Net, 23 μm adaptor Net, 10 μm adaptor Net, 12 μm adaptor PP PP PA PEEK Yes Yes Yes Yes TC-gasket 25/8 EPDM EPDM Yes Feet, stand Wheel with brake, Columns Wheel with brake, Columns port, 2-way valve 316L/PTFE Yes Tubing - Yes 1 Washer PP Washer PP Chromatography columns 1 Tube i.d. 4 mm (BPG 100), 6 mm (BPG 140 and 200) 2 Comparable to 316L 119

120 5 Chromatography columns Spare parts for BPG 300 columns Description Material In contact with process liquid? Qty/pk BPG 300 Adaptor top plate- Flange Nut, M Cup spring washer Washer Nut, M Flange O-ring, mm EPDM Yes O-ring, mm FEP Yes Rod for T300/ Rod for T300/ Rod for T300/ Column tube T300/500 Borosilicate glass Yes Column tube T300/750 Borosilicate glass Yes Column tube T300/950 Borosilicate glass Yes Net, 23 μm, endpiece PP Yes Net, 10 μm, endpiece PA Yes Net, 12 μm, endpiece PEEK Yes Net, 54 μm, endpiece PP Yes Support net, endpiece PP Yes Distribution plate PP Yes Endpiece 316L Yes Gasket Kit TC25 i.d. 12mm EPDM Yes TC-Gasket 25/10.5mm FPM/FKM Yes Connector 25 mm/10 mm 3 PP Yes - 4-port, 2-way manual valve 316L/PTFE Yes Stand, complete 316L Washer Bolt, M Wheel with brake, columns Seal adjuster PEEK Adaptor height adjuster Bushing ring POM Adaptor top plate 316L Nut, M Stop screw, complete 316/POM Adjuster nut, insert PEEK Sealing unit 316L Adaptor head screw, M Allen screw, M O-ring, mm EPDM O-ring, mm FEP Inner adaptor tube Outer adaptor tube 316L Screw, M L/PTFE Spring 316/PTFE Adaptor plate 4 S Support net, adaptor PP Yes Net, 23 μm, adaptor PP Net, 10 μm, adaptor PA Yes Net, 12 μm, adaptor PEEK Net, 54 μm, adaptor PP Tubing 3 - Clamp, 25 mm For columns with adaptor top plate clamp 2 For columns with adaptor plate assembled with screws and nuts 3 See column documentation manuals 4 Tube i.d. 10 mm 5 Comparable to 316L 120

121 Spare parts for BPG 450 columns Description Material In contact with process liquid? Qty/pk BPG 450 Endpiece 316L Yes Support net, endpiece PP Yes Flange PP/316 Yes U-shaped seal EPDM Yes U-shaped seal FPM/FKM Yes Net, 54 μm, endpiece PP Yes Net, 23 μm, endpiece PP Yes Net, 10 μm, endpiece PA Yes Net, 12 μm, endpiece PEEK Yes Flange O-ring EPDM Yes Flange O-ring FEP Yes Allen screw M Rod BPG 450/ Rod BPG 450/ Rod BPG 450/ Sealing unit 316L Pin bolt Stop screw Glass tube BPG 450/500 Borosilicate glass Yes Glass tube 450/750 Borosilicate glass Yes Glass tube 450/1000 Borosilicate glass Yes Revolving stop cap POM Revolving stop 316L Screw M Spacer 316L Lid Bushing ring PP Adaptor height adjuster POM Handle Nut flange PEEK Seal adjuster PEEK Handle Knob PP Screw M Washer Domed nut M10 and washer Adaptor screw 316L Adjustment tube Inlet tube i.d. 12 mm 316L Yes O-ring EPDM Yes O-ring FEP Yes Screw M Spring 316/PTFE Screw M Snap plug PP Yes Adaptor plate S Yes Screw M L/PTFE O-ring EPDM Yes O-ring FEP Yes Distributor plate PP Yes Adaptor support net PP Yes Net 54 μm adaptor PP Yes Net 23 μm adaptor PP Yes Net 10 μm adaptor PA Yes Net 12 μm adaptor PEEK Yes Screw M Screw M Bracket Screw M Bottom inlet tube 316L Allen screw M L Yes Leg Wheel with brake BPG Eye bolt Adaptor stopper Chromatography columns 1 Comparable to 316L 121

122 INdEX columns INdEX are easy-to-use, general purpose, glass columns well-suited for applications such as process development and diagnostics production. These columns are characterized by their simple design and the novel, axial compression packing method that yields a densely packed bed in under 10 minutes. 5 Chromatography columns INdEX range Scalable from inner diameters of 70 to 200 mm and bed volumes from 0.1 to 25 L Pressure rating 3 bar For use with an array of techniques and media, especially Sepharose Fast Flow Proven distribution system Overview of INdEX columns Tube inner diam Tube height Dynamic axial compression yields densely packed, high efficiency beds Materials include electropolished stainless steel, borosilicate glass and polymers Packing devices for longer bed heights Crosssectional area Bed height (cm) Bed volume (l) Max pressure Column (mm) (cm) (cm 2 ) min max 1,2 min max 1,2 (bar) 3 INdEX 70/ (41) (1.6) 3 INdEX 70/ (79) (3.0) 3 INdEX 100/ (41) (3.2) 3 INdEX 100/ (79) (6.2) 3 INdEX 140/ (41) (6.3) 3 INdEX 140/ (79) (12.2) 3 INdEX 200/ (41) (12.9) 3 INdEX 200/ (79) (24.8) 3 1 Maximum bed volumes and bed heights are based on a slurry concentration of 75% and a packing compression of 15%. 2 The figures within brackets are achievable using a packing device. 3 Use a manometer to monitor the pressure

123 What do I need? Stands and wheels INdEX 70 and 100 stands have adjustable feet. Castors with brakes are available. INdEX 140 and 200 stands have castors with brakes as standard. Useful spare parts Nets: The column is delivered with 23 µm (polypropylene) nets. For media with an average particle diameter < 70 µm, change to 10 µm (polyamide) in both adaptors and end-pieces. Seals: Inspect the seals on a regular basis for signs of wear. Spare parts to keep on site All nets, support screens and O-rings. In some cases, a spare tube may be advisable. Longer bed heights Packing extensions are available for all diameters. For packing INdEX columns with the packing device for BPG columns, an extra lid kit has to be ordered. Isolating the column after packing We recommend using 25 mm blind flanges with clamp and gasket to prevent contamination of the packed bed. Connecting the column to your system A clamp and gasket, 6 mm i.d., is required to connect the 25 mm sanitary flanged inlet/outlet to either valves or tubing of the same type. Preflanged tubing in 6 mm i.d. is also available. Assembly/disassembly of column No tools are required as all fittings are finger-tight. Useful column accessories Air Traps: INdEX Air Trap Complete includes the air trap, mounting bracket, steel valves, clamps, gaskets and tubings, 25 mm TC. Top valve: Manually operated valve recommended at the top of the airtrap as an air outlet control. Manometers: Manometer kits contain a pressure gauge, T-junction, necessary clamps and gaskets for sanitary connections. Pressure relief valve: Required for the hydraulic packing procedure. It is connected between the pump and hydraulic inlet to ensure flow delivery at a constant pressure throughout the packing procedure. Safety valve: Precalibrated valve that releases pressure if the calibrated value is exceeded. Recommended if the column may exceed its maximum pressure limit and no other pressure sensor is included in the chromatographic system. T-junction, clamps and gaskets have to be ordered separately. 5 Chromatography columns 123

124 Packing extension. Ordering information Column INdEX 70/ INdEX 70/ INdEX 100/ INdEX 100/ INdEX 140/ INdEX 140/ INdEX 200/ INdEX 200/ Stand INdEX 70 stand INdEX 100 stand INdEX 140 stand INdEX 200 stand Stands must be ordered separately Air trap, top valve, pressure gauge and safety valve. 5 Chromatography columns Accessories for INdEX columns Accessory INdEX 70 INdEX 100 INdEX 140 INdEX 200 Qty/pack Material Air Trap Complete SS 316/Glass Top valve SS 316/EPDM Valves 4-port, 2-way SS 316L/PTFE 4-port, 4-way SS 316L/PTFE Valve sealing, washer PTFE T-junction SS 316 Safety valve SS 316/EPDM Pressure relief valve SS 316/FPM Manometer SS 316 Manometer kit Castor Adjustable foot Tubing with sanitary fitting i.d. 6 mm 3 30 cm PVC 75 cm PVC 125 cm PVC 150 cm PVC 200 cm PVC Connectors (see p ) i.d. 6 mm. 25 mm TC 6 mm threaded PP UNF threaded PP 25 mm TC-M6 threaded PP 25 mm TC-i.d. 22 mm, 51 mm TC PP Clamp 25 mm SS 304 Clamp 51 mm SS 304 Gasket 25 mm EPDM Gasket 51 mm EPDM Blind flange, 25 mm incl. gasket SS 304/EPDM Blind flange 51 mm incl. gasket SS 304/EPDM Packing device with PP lid Glass Lid kit 2 for packing device The packing device consists of PP lid, a 380 mm glass tube, flanged, rods, O-rings in EPDM, bed support, adaptor bed support, screws and nuts. 2 The lid kit consists of PP lid, O-rings in EPDM, bed support, adaptor bed support, screws and nuts. The lid kit can be used together with the packing devices for BPG 100, 140 and 200 columns on INdEX columns of the same size mm TC mm TC mm, 1 51 mm TC. 6 Fits 2-way and 4-way valves

125 Spare parts for INdEX columns INdEX 70 INdEX 100 INdEX 140 INdEX 200 Qty/pack Material Column tube Borosilicate glass Column tube Borosilicate glass Bed support, adaptor PP Bed support 23 µm, adaptor PP Bed support 10 µm, adaptor PA Bed support, end-piece PP Bed support 23 µm, end-piece PP Bed support 10 µm, end-piece PA Material abbreviations: EPDM=ethylene propylene diene, FPM=fluorocarbon rubber, PA=polyamide, PP=polypropylene, PTFE=polytetrafluoroethene, PVC=polyvinyl chloride, SS=stainless steel. Literature Data file INdEX Columns series Chromatography columns 125

126 FineLINE columns The FineLINE range of columns has been developed for use with all SOURCE media. The novel, hydraulic packing method packs SOURCE in a matter of minutes, giving densely packed beds and very high packing efficiencies: more than plates/m with SOURCE 15 and more than plates/m with SOURCE 30. FineLINE Pilot 35 is well-suited for both downscaling from the larger FineLINE columns and upscaling from laboratory RESOURCE and ÄKTAdesign columns. This 35 mm inner diameter column has a tube manufactured from calibrated borosilicate glass. FineLINE Pilot 35 can also be run on ÄKTAexplorer. 5 Chromatography columns The larger FineLINE 70, 100P, 200P and 350P columns are intended for scale-up work and small-scale production. Column tubes are manufactured in electropolished stainless steel and are available in two tube lengths: 350 and 700 mm. FineLINE range Standard inner diameters of 35, 70, 100, 200 mm and 350P Optimized for use with all SOURCE media Proven single inlet/outlet distribution with special multilayer bed supports for uniform flow at low back pressures Very easy and fast to pack Materials include electropolished stainless steel, calibrated borosilicate glass and EPDM All polymeric materials are approved according to USP Class VI tests for toxicity Documentation to support validation delivered with the product Overview of FineLINE columns Tube Cross Bed Bed Bed Bed inner Tube sectional height height vol vol Design diam height area min max min max pressure Column (mm) (mm) (cm 2 ) (mm) (mm) (ml) (ml) (bar) FineLINE Pilot FineLINE FineLINE 70L FineLINE 100P FineLINE 100LP FineLINE 200P FineLINE 200LP FineLINE 350P FineLINE 350LP

127 What do I need? The stand for FineLINE 70/70L and FineLine 100P/100LP has adjustable feet. Wheels with brakes are available as an accessory. The stand for FineLINE 200P/200LP has wheels with brakes as standard. Note: For FineLINE 70, 100, and 200 columns, the stand must be ordered as an optional component. Useful spare parts Bed supports Columns are delivered with 2 µm nets; 10 µm nets are also available. Seals Order solvent-resistant seals (O-ring kit PFR) if the EPDM O-rings supplied with the columns are not compatible with the solvent to be used. Spare parts to keep on site A complete set of O-rings. FineLINE Pilot 35 Complete set of O-rings, flanging start-up, extra tubing and connectors. Isolating the column after packing We recommend using stainless steel valves 2- or 4-way with i.d. 6 mm to close off the top and bottom of the column and prevent contamination of the bed. For storage purposes, the 25 mm blind flanges with clamps and gaskets can be used to seal off the column. For FineLINE Pilot 35, an extra SRV-1 valve is inserted to close of the bottom of the column. The stop plug for the upper column inlet is supplied with the column. Connecting the column to your system Clamps and gaskets with i.d. 6 mm are required to connect the 25 mm sanitary flanged inlet/outlet to either valves or tubing of the same type. Preflanged tubing with i.d. 6 mm is available from GE Healthcare. FineLINE Pilot 35 is delivered with flanged 1.2 mm i.d. propylene tubing and M6 connectors. A separate tubing kit is needed to connect the column to ÄKTAdesign systems. Assembly/disassembly of column Standard wrenches are recommended in a non-explosive environment. In potentially explosive atmospheres, only tools and protective equipment specially adapted to that environment should be used for operation and maintenance. Note: Standard wrenches are not supplied with the column, except for FineLINE Pilot 35. Useful column accessories Pressure gauge We recommend fitting a pressure gauge capable of measuring a negative pressure of 1 bar at the top mobile phase connection to indicate the pressure in the column. This monitors the operating pressure and ensures that the correct axial compression packing pressure is set when packing the column. Pressure relief valve Required for the packing procedure. It is connected between the pump and the hydraulic inlet to ensure flow delivery at constant pressure. A suitable pressure relief valve designated RL4 is available. Note: The valve is not supplied with the column and should therefore be ordered separately. As the pressure relief valve is just required when packing the column, only one valve will generally be needed irrespective of the number of columns in use. (A manometer is seldom needed for FineLINE Pilot 35 since the pressurerelief valve is preset to 10 bar). Ordering information Column FineLINE Pilot Pressure Relief Valve FineLINE FineLINE 70L FineLINE 100P FineLINE 100LP Stand FineLINE 200P FineLINE 200LP Stand Pressure Relief Valve FineLINE 350P EPDM 2 µm FineLINE 350P EPDM 10 µm FineLINE 350P PFR 2 µm FineLINE 350P PFR 10 µm FineLINE 350P PFR 2 µm Oligo FineLINE 350P PFR 10 µm Oligo FineLINE 350LP EPDM 2 µm FineLINE 350LP EPDM 10 µm FineLINE 350LP PFR 2 µm FineLINE 350LP PFR 10 µm FineLINE 350LP PFR 2 µm Oligo FineLINE 350LP PFR 10 µm Oligo Chromatography columns 127

128 Accessories for FineLINE Pilot 35 column Designation Material Qty/pack Tubing Kit for ÄKTAexplorer Tubing Connector, SRTC2 PEEK Tubing Connector PP Tubing D-flanged i.d. 1.2 mm, 420 mm ETFE/PEEK/PP Tubing D-flanged i.d. 1.2 mm, 750 mm ETFE/PEEK/PP Tubing i.d 1.2 mm, 2000 mm ETFE Stop Plug Domed Nut M6 PP Flanging/Start up Kit 120 V Flanging/Start up Kit 220 V Flanging Tip Kit i.d. 1.2 mm Pressure Relief Valve SS 316/ETFE/ PEEK/PP Spare parts for FineLINE Pilot 35 column Designation Material Qty/pack Glass tube Borosilicate glass Adaptor bed support 2 µm PP/SS 316L Bottom bed support 2 µm PP/SS 316L *Sealing Kit comprising: EPDM O-ring O-ring O-ring O-ring O-ring * includes all O-rings for FineLINE Pilot 35 column. On/Off Valve i.d. 1.5 SRV-1 FP Valve SRV-3 FP Mechanical locking O-rings mm* PFR *Adaptor filter rings in PFR. 5 Chromatography columns Accessories for FineLINE 70/70L, 100P/100LP, 200P/200LP, and 350P/350LP columns Description For columns Material Qty per pack Note O-ring Kit PFR 70 1 PFR Includes: PFR PFR PFR Grounding kit All Wheel set (4 pcs included) 70/ Valves - 25 mm TC 4-port, 2-way, i.d. 6 mm 70/100/ L/PTFE port, 4-way, i.d. 6 mm 70/100/ L/PTFE port, 2-way, i.d. 10 mm L/PTFE port, 4-way, i.d. 10 mm L/PTFE Sealings washer 5 Salvi valves All PTFE Ball valve, 12 mm All 316L/PTFE Pressure relief valve 70/100/200 (RL3, i.d. 6 mm) 316L/PTFE (RL4, i.d. 10 mm) 316L/PTFE Gasket kit, pressure relief valve 70/100/200 (RL3) 316L/Viton (RL4) 316L/Viton Safety valve All Tubing with sanitary fitting, i.d. 6 mm, 25 mm TC 0.30 m 70/100/200 PVC m 70/100/200 PVC m 70/100/200 PVC m 70/100/200 PVC m 70/100/200 PVC Tubing with sanitary fitting, i.d. 10 mm, 25 mm TC 0.3 m All PVC m All PVC ,0 m All PVC m All PVC m All PVC m All PVC m All PVC Connectors TC gasket 25/6 mm 70/100/200 PFR /100/200 EPDM TC gasket 25/8 mm 70/100/200 PFR /100/200 EPDM TC gasket 25/12 mm All PFR All EPDM TC gasket 50/22 mm All PFR All EPDM Clamp 25 mm All All Clamp 51 mm All PFR Blind flange 25 mm including gasket All 304/EPDM O-ring, , PFR, O-ring, , PFR, O-ring, , PFR, Includes: O-ring, , PFR, O-ring, , PFR, O-ring, , PFR, Includes: O-ring, , PFR, O-ring, , PFR, O-ring, , PFR, Includes: Two O-rings Two O-rings One O-ring One O-ring Fits , , and

129 Spare parts for FineLINE columns Description 70/70L 100P/100LP 200P/200LP 350P/350LP Quantity Material Bed support, adaptor complete, 2 mm SS 316 L Bed support, adaptor complete, 10 mm SS 316 L Bed support, end piece complete, 2 mm SS 316 L Bed support, end piece complete 10 mm SS 316 L O-ring EPDM O-ring PTFE O-ring EPDM O-ring PFR O-ring EPDM O-ring PFR O-ring EPDM O-ring PFR O-ring EPDM O-ring EPDM O-ring PFR O-ring EPDM O-ring PFR Piston seal * * 1 EPDM Piston seal * 2 EPDM O-ring EPDM O-ring PFR O-ring EPDM O-ring PFR O-ring EPDM O-ring PFR O-ring EPDM O-ring PFR Piston seal EPDM Material abbreviations: EPDM=ethylene propylene diene, ETFE=ethylene tetrafluoroethylene, FP=fluoroplastic, PEEK=polyetheretherketone, PFR=perfluor rubber, PP=polypropylene, PTFE=polytetrafluoroethene, PVC=polyvinyl chloride, SS=stainless steel * When ordering piston seals for pre-2007 FineLINE columns, please contact your GE Healthcare sales representative for the correct code number. 5 Chromatography columns Literature Data file FineLINE Pilot 35 Column FineLINE 70/70L, 100/100L, 200/200L Application note Scaling up high performance chromatography on SOURCE media and FineLINE columns Documentation to support validation available on request. Contact your local GE Healthcare office

130 A guide to plastic connectors for process-scale columns Connector i.d. 25 mm, 50 mm TC- i.d. 36 mm, 50 mm TC, PEEK, USP Class VI, Code no Connector i.d. 6 mm, 25 mm TC- i.d. 14 mm, 25 mm TC, PEEK, USP Class VI, Code no Connector i.d. 6 mm, 25 mm TC- i.d. 10 mm, 25 mm TC, PEEK, USP Class VI, Code no Connector i.d. 14 mm, 25 mm TC- i.d. 22 mm, 50 mm TC, PEEK, USP Class VI, Code no Connector M6 - i.d. 6 mm, 25 mm TC, PEEK, USP Class VI, Code no M Chromatography columns Connector i.d. 10 mm, 25 mm TC- i.d. 22 mm, 50 mm TC, PEEK, USP Class VI, Code no Connector i.d. 6 mm, 25 mm TC- i.d. 22 mm, 50 mm TC, PEEK, USP Class VI, Code no Connector 3/4-20 UNF - i.d. 10 mm, 25 mm TC, PP, Code no /4 20 UNF 14 Connector 3/4-20 UNF - i.d. 6 mm, 25 mm TC, PP, Code no /4 20 UNF Connector i.d. 6 mm, Jaco- i.d. 6 mm, M6, PP, Code no Connector i.d. 10 mm, 25 mm TC- i.d. 14 mm, 25 mm TC, PEEK, USP Class VI, Code no Connector i.d. 6 mm-i.d. 6, 25 mm TC, PP, Code no inch = 25 mm UNF = Standard for finer pitch which fits a lot of female connectors

131 Connector i.d. 2.7 mm M Connector i.d. 3 mm M6 Jaco 6 mm M m Connector i.d. 1.8 mm M Connector SRTC-3 M6-M M6 1.8 M6 5 Connector i.d. 3.8 mm M M6 3.2 Connector SRTC-2 M6-M M6 Chromatography columns 131

132 HiScale columns 5 Chromatography columns HiScale is a family of pressurestable, empty columns based on the well-established XK column line and designed for process development and preparative chromatography. The user-friendly design allows for an optimized process, through simplified and reproducible operation. The range of functional advantages makes HiScale columns well-suited for work that requires ease-of-use, robustness, and process control. Features and benefits of HiScale columns include: Pressure stability up to 20 bar, providing compatibility with modern BioProcess media Axial compression of the gel bed and a plunger mechanism enabling a wide range of packing protocols Column measurement scale and ergonomical design of the end cap, enabling precise packing Adapter QuickLock mechanism, facilitating column handling and cleaning Dual adapters, offering high flexibility and dynamic protocols Compatibility with all methods currently used with GE Healthcare s XK columns HiScale columns are available in a number of sizes. Columns are comprised of an inner glass tube and an outer protective polycarbonate tube. The default filter size is 20 μm, but other sizes are available. Visit us on the web at

133 HiScale column sizes Column Max bed height (cm) Max volume (ml) HiScale 16/ HiScale 16/ HiScale 26/ HiScale 26/ HiScale 50/ HiScale 50/ Ordering information Column* Quantity HiScale 16/ HiScale 16/ HiScale 26/ HiScale 26/ HiScale 50/ HiScale 50/ * Each HiScale column is delivered with two adapters Adustment of the end cap on HiScale columns enables controlled axial compression of the gel bed. Accessories Item HiScale 16 HiScale 26 HiScale 50 No. per pack Spanner wrench Long column holder Short column holder Column holder ÄKTA avant Column clamp ÄKTA avant Column holder, steel Superloop, 1/16 in fittings 10 ml Superloop, 1/16 in fittings 50 ml Superloop, M6 fittings 150 ml Union 5/16 in female - 1/16 in male Fingertight union 1/16 in male/m6 female Connector 1/16 in male/luer female Net ring 10 μm Net ring 80 μm Tubing 1 mm i.d m Tubing 2 mm i.d m Tubing cutter Packing connector O-ring, packing connector Column tube Column tube Packing tube Packing tube O-ring, packing tube Accessory kit* * Each HiScale column is delivered with two adapters 5 Chromatography columns 133

134 Custom-packed laboratory columns 5 GE Healthcare offers a large selection of prepacked columns and bulk media available, encompassing most liquid chromatography techniques. If you require a special configuration, a combination of column and medium not offered in our standard column offerings, contact the Custom Products group through your local GE Healthcare office. Each custom column is packed and tested under ISO 9001 standards. Each columns comes with user instructions and a result of analysis that describes the column performance. Delivery time is between two and four weeks, depending on specific media and column specifications. Chromatography columns HiPrep columns HiLoad columns Custom prepacked columns that meet your exact requirements HiTrap columns HiScreen columns 134

135 Custom Products adapts the exact combination of media and column to solve specific purification problems. With years of experience in chromatography and column packing, you can rely on the Custom Products group to tailor a solution to fit your separation objectives and save you time. The group works with you from the initial discussions right through to delivery, establishing your needs and sorting through the choices. Selection guide Available columns C Column FineLINE Pilot 35 HiPrep Column HiTrap Column HR 16 Column PC Column (Precision Column) MultiTrap 96-well filter plates PE Column (PEEK) SC Column (Precision Column) SR Column (Solvent Resistant) ST Column (Stainless Steel) Tricorn High Performance Column XK Column Selection guide Available affinity media 2 5 ADP Sepharose 4B 7-Methyl-GTP Sepahrose 4B Benzamidine Sepharose 6B Benzamidine Sepharose Fast Flow (high sub) Blue Sepharose 6 Fast Flow Blue Sepharose CL-6B Blue Sepharose High Performance Calmodulin Sepharose 4B Chelating Sepharose Big Beads Chelating Sepharose Fast Flow Chelating Sepharose High Performance Con A Sepharose 4B EAH Sepharose 4B ECH Sepharose 4B GammaBind G Sepharose GammaBind Plus Sepharose Gelatin Sepharose 4B Glutathione Sepharose 4 Fast Flow Glutathione Sepharose 4B Glutathione Sepharose High Performance Heparin Sepharose 6 Fast Flow Heparin Sepharose High Performance IgG Sepharose Fast Flow Lentil Lectin Sepharose 4B Lysine Sepharose 4B MabSelect MabSelect SuRe MabSelect Xtra NHS-activated Sepharose 4 Fast Flow NHS-activated Sepharose High Performance Ni Sepharose 6 Fast Flow Ni Sepharose High Performance nprotein A Sepharose 4 Fast Flow PlasmidSelect Xtra Poly(A) Sepharose 4B Poly(U) Sepharose 4B Protein A Sepharose CL-4B, 6MB Protein G Sepharose 4 Fast Flow Protein G Sepharose High Performance rmpprotein A Sepharose 4 Fast Flow rprotein A Sepharose Fast Flow 5 Selection guide Available gel filtration media Selection guide Available RPC media SOURCE 5RPC SOURCE 15RPC SOURCE 30RPC Sephacryl S-100 HR Sephacryl S-200 HR Sephacryl S-300 HR Sephacryl S-400 HR Sephacryl S-500 HR Sephacryl S-1000 SF Sephadex G-10 Sephadex G-15 Sephadex G-25 Coarse, Medium, Fine, Superfine Sephadex G-50 Coarse, Medium, Fine, Superfine Sephadex G-75 Medium, Superfine Sephadex G-100 Medium, Superfine Sepharose CL-2B, -4B, -6B Sepharose 2B, 4B, 6B Superdex Peptide Superdex 30 prep grade Superdex 75 Superdex 75 prep grade Superdex 200 Superdex 200 prep grade Superose 6 Superose 6 prep grade Superose 12 Superose 12 prep grade Selection guide Available HIC media Butyl Sepharose High Performance Butyl-S Sepharose 6 Fast Flow Butyl Sepharose 4 Fast Flow Butyl Sepharose 4B Octyl Sepharose 4 Fast Flow Octyl Sepharose CL-4B Phenyl Sepharose CL-4B μrpc C2/C18 Phenyl Sepharose Fast Flow (high sub) Phenyl Sepharose Fast Flow (low sub) Phenyl Sepharose High Performance SOURCE 15ETH SOURCE 15ISO SOURCE 15PHE Chromatography columns Selection guide Available ion exchange media Capto MMC Capto Q CM Sephadex C-25, C-50 CM Sepharose Fast Flow DEAE Sephadex A-25, A-50 DEAE Sepharose Fast Flow Mini Q, Mini S Mono Q, Mono S, Mono P PBE 94, 118 Q Sepharose Big Beads Q Sepharose Fast Flow Q Sepharose High Performance Q Sepharose XL QAE Sephadex A-25, A-50 SOURCE 15Q, 15S SOURCE 30Q, 30S SP Sephadex C-25, C-50 SP Sepharose Big Beads SP Sepharose Fast Flow SP Sepharose High Performance SP Sepharose XL Visit us on the web at FineLINE Pilot 35 column 135

136 Manufacturing Solutions column packing Manufacturing Solutions is aimed at developing products and services that simplify the daily work in process development and manufacturing. The products include Media Wand and Media Handling Unit, devices that enable efficient and simple handling of large-scale media volumes, and slurry tanks, which simplify and improve the column packing process. Media Wand Slurry tank AxiChrom ÄKTAprocess Simplifies media handling Saves time and labor Gentle to media Better packing results Closed environment Simplified storage Intelligent packing Intuitive handling Predictable scale-up Configurable UNICORN control Inline Conditioning (optional) 5 Media Wand Chromatography columns Media Wand 50 and Media Wand 100 simplify a number of time-consuming tasks such as: removal of supernatant from the shipping container addition of buffer or WFI (Water-For-Injection) generation of slurry transfer of slurry from the shipping container In addition, Media Wand and Media Handling Unit (MHU) eliminate the need for heavy lifting and shaking, enabling faster handling of media volumes with reduced labor. Decanting Device 50 (for Media Wand 50) and Decanting Device 100 (for Media Wand 100) are shields, connected to the spray nozzle of the Media Wand, which act to prevent loss of media during decanting. The Media Handling Unit CIP-manifold simplifies the cleaning-in-place process of the Media Handling Unit. When working with solvents, PTFE tubing (2 m stainless steel over braid and silicon covered tubing) should be used to connect the Media Wand to the Media Handling Unit. PTFE tubing eliminates any potential differences in static electricity between the Media Wand and the Media Handling Unit. Ordering information Product Quantity Media Wand Media Wand Media Handling Unit Decanting Device Decanting Device CIP-manifold MHU PTFE-tubing Media Wand 50 is designed for use with containers containing 5 to 10 L of media, and Media Wand 100 for the containers with up to 60 L of media. While the Chromaflow Pack Station 100 can also be used with Media Wand, the Media Handling Unit offers more functions and thereby provides easier and safer operations

137 Slurry tanks Advantages of a well-designed slurry tank include: Simplified buffer exchange (from transport liquid to packing buffer and to preservative when storing media) and adjustment of slurry concentration Generation of a homogenous slurry Supports all packing methodologies, including pressure packing of brittle media Simplified, more ergonomic, and safer operator working conditions GE Healthcare provides slurry tanks up to 2000 L and with a range of customizations including weight determination, vacuum functions, air blow/buffer drain, and sample valves. Tank functions are easily controlled from the operator panel. Slurry tanks simplify column packing and provide for safer and more cost-effective process development. By gently generating an even particle size distribution throughout the slurry, slurry tanks can help prevent excessive shear forces that may otherwise lead to media degradation, clogged nets, and increased back pressure. Slurry tanks also support a range of additional process steps when packing and unpacking media. The ability to transfer media/buffer via pressure results in time and material savings as well as improved operating conditions. Technical specifications Operating pressure -1 to 3 bar g Process air consumption 200 NL/min Instrument air consumption 50 NL/min Pressure requirement, process air/instrument air 5-10/6-10 bar g Number of inlets 3 Number of outlets 2 Tank bottom valve 1 Sprayballs 2 Protection class IP55 Tank, piping material 316L Process wetted gaskets and elastomers EPDM Design temperature range 4 C-40 C Power supply VAC, Hz Literature Data file Slurry tanks Chromatography columns For information on ordering slurry tanks, please contact your local GE Healthcare representative or visit:

138 6 Chromatography systems ÄKTA avant 140 ÄKTApilot 141 ÄKTAprocess 142 Inline conditioning 144 Customized BioProcess Solutions 145 UNICORN control

139 6 Chromatography systems 139

140 ÄKTA avant system Security: reliable results with complete sample security and regulatory compliance Ensure sample integrity by contaminant-protected and cooled, integrated fraction collector Work faster while meeting regulatory requirements with 21 CFR part 11 compliant UNICORN 6 software Easily trace column run data history with UniTag scanning Column protection via flow regulation controlled by differential pressure measurement Scalability: achieve direct, dependable scalability while systematically anticipating errors Automatic conversion of UNICORN 6 methods when scaling up and down between the two ÄKTA avant versions Take full advantage of modern high flow rate BioProcess media such as MabSelect and Capto Scale quickly and predictably from screening and method optimization using HiScreen columns, to finetuning and robustness testing on AxiChrom columns 6 Chromatography systems ÄKTA avant is a preparative chromatography system designed for rapid and secure development of scalable chromatographic methods and processes. Available in two versions, ÄKTA avant systems have different flow rates and pressure specifications but share the same hardware setup. With flow rates up to 25 ml/min, ÄKTA avant 25 system is designed for media screening and method optimization. ÄKTA avant 150 system, with flow rates up to 150 ml/min, is designed for scaling up to larger columns, as well as fine-tuning and robustness testing of the optimized process. ÄKTA avant is operated using UNICORN 6 control software, which has been specially developed to increase productivity and efficiency. ÄKTA avant offers a complete solution for rapid, high-quality protein separations while maintaining flexibility and reliability. Speed: Increase productivity Maximal information from a minimal number of experiments with Design of Experiments (DoE) support integrated into UNICORN 6 software BufferPro automated online buffer preparation enables quick and easy preparation of single buffers as well as screening for optimal buffer compositions, including ph scouting Ease-of-use in every detail Ordering information System and software ÄKTA avant ÄKTA avant UNICORN 6.1 local or remote workstation license with DVD UNICORN 6.1 local or remote workstation license without DVD UNICORN 6.1 DVD package Related literature Data file: UNICORN 6 control software Validation Support File: UNICORN software Application note: Rapid process development for purification of a MAb using ÄKTA avant Application note: Rapid method development for native protein purification using ÄKTA avant 25 chromatography system Application note: Fast process development of a single-step purification using ÄKTA avant systems Brochure: ÄKTA avant Selection guide: Prepacked chromatography columns for ÄKTA design systems More information available on

141 ÄKTApilot system ÄKTApilot is a high-performance, automated liquid chromatography system designed for process development, process scale-up, scale-down and smallscale production. The system has the capacity to purify from milligrams to tens of grams of product and is biocompatible, hygienic and sanitizable. Hygienic design enables purification of microbial-free and contaminant-free products High dynamic capacity flow capacity 4 to 400 ml/min with 0 to 100% gradient 4 to 800 ml/min flow with limited gradient possibility to purify 10 g product per cycle Built-in and EVB sanitary fraction collection valves for maximum use of bench space Fast and convenient start with UNICORN Method Wizard for easy programming preprogrammed sanitization method and column lists constant pressure regulation of flow rate during sample application and during column packing Validation support IQ/OQ documentation available UNICORN supports FDA 21 CFR Part 11 for Electronic Signatures and Electronic Records Bench top design fits in small areas All wetted parts are externally mounted and are easily changeable for convenient product change-over when campaigning simplified cleaning validation The sanitary system for rapid process development and small-scale production The system consists of the ÄKTApilot separation unit, a computer including a flat-screen monitor and UNICORN control system. UNICORN ensures quick, simple communication between systems and users and meets the stringent control and data handling procedures of modern production and laboratory facilities. Method wizards provide easy method generation. Optimized methods are transferred easily from laboratory to production scale. In addition to the two outlet fraction valves, you can connect four extra EVB 988 valves (External Valve Block). Two extra EVB 981 inlet valves can also be connected on the outlet valve rack. Trouble-free sanitization ÄKTApilot system is easily sanitized with 1 M sodium hydroxide (NaOH). Microbial challenge tests that subject the system to infection with solutions containing three strains of bacteria recommended by the United States Pharmacopoeia (USP 25), and a strain of yeast commonly found in production environments gave 6 log reduction results that fulfill the USP 25 requirements. Ordering information Product ÄKTApilot Additional items EVB 981 (Inlet) EVB 988 (Outlet) EVB Rack CIP Manifold ÄKTApilot Tubing Kit Column ÄKTApilot Valve Membrane CPL ÄKTApilot Elbow 90 TC25 Short ÄKTApilot TUBE S7 CPL ÄKTApilot TUBE S8 CPL Wetted parts kit O-ring, top air trap Connector M6 fem. 5/16 fem Connector M6 fem. 5/16 male Clamp TC Connector TC 5/16 fem Connector TC 5/16 male TC-gasket 25/4 mm TC-gasket 25/6.5 mm T-connector 5/ Connector 5/16 fem. 5/16 fem Data files ÄKTApilot UNICORN Control System Chromatography systems Visit us on the web at

142 ÄKTAprocess system Versatile user configuration ÄKTAprocess offers a versatile platform providing thousands of configuration possibilities. The system is available in three flow rate ranges that extend up to 2000 l/h for large volume manufacturing. The compact design with a built-in computer allows the system to fit neatly into a plant. ÄKTAprocess can be constructed in either electropolished stainless steel or polypropylene, depending on your process conditions and plant requirements. 6 Chromatography systems ÄKTA platform enters production-scale chromatography ÄKTAprocess is an automated liquid chromatography system built for process scale-up and large-scale biopharmaceutical manufacturing. The proven design has been verified during development and can be user configured to meet specific process demands. It is the obvious choice of system to use when scaling up processes developed on smaller ÄKTAexplorer and ÄKTApilot systems. Versatile user configuration with UNICORN control Post-purchase configuration increasing usability and lifespan Traceable USP Class VI, CFR 177 and animal-free origin materials Regulatory documentation and services One inch tubing size now available The systems can be configured to develop gradients at any flow rate with feedback loop technology. This ensures thorough mixing of liquids/solvents without air bubbles so that even challenging gradients can be created with 2% accuracy. The UNICORN software allows standalone operation or integration into any plant-wide control system. Additional configurations include, for example, the choice of extra inlets and outlets, the type and quantity of selected monitors, and isocratic versus gradient functionality. Sanitary design ÄKTAprocess has a number of features that make sanitization with 1 M sodium hydroxide simple and effective. UNICORN allows automated cleaning-in-place (CIP) and the air trap makes CIP more efficient. All wetted parts can be changed to prevent cross-contamination when the system is used for campaigning. In a sanitization study, the system was subjected to high level of microbial challenge organisms ( Colony Forming Units CFU/mL). The yeast Pichia pastoris was used for antimicrobial testing. The results show that the system is sanitized effectively and that the numbers of viable organisms are efficiency reduced. For more information, please contact your local GE Healthcare representative. See also chromatography system at

143 Inlets Up to ten inlet valves. Air Air sensor System pump 1 Pumps A second pump is available for gradient formation. C Cond cell Pressure sensor P Air outlet valve, controlled Air sensor Air trap A liquid vortex at high flow rates allows the system to expel air effectively during operation and make CIP more effective. Filter Optional filter housing for particle or sterile filration. Flow meter ph cell Packing/CIP valves Additional valves are available for automation of CIP and intelligent packing of AxiChrom columns. Outlets Up to ten outlet valves. Air F ph Column 1 P C UV Pressure sensor Cond cell UV cell Sample pump A dedicated sample pump is available. Columns An additional branch of valves is available for connection of a second column. UV cell Single or multiple wavelength UV detector. The liquid flow path. Validatable control with UNICORN software UNICORN software is a single familiar interface for both chromatography and membrane separations that provides efficient control of process, flexible method programming, extensive data evaluation, and powerful reporting functionality. Improved and cost-effective process security is now provided as a standard. The system control unit, CU 960, allows process operation even if communication with system computer and UNICORN is lost either physically or due to operating system faults. For integration purposes, UNICORN communicates with control systems within the plant via OLE for Process Control (OPC). OPC supports application area such as data access for real time values and security control to protect sensitive information. Safety stock of spare parts and consumables Securing the supply of spare parts and consumables ensures maximum uptime of your ÄKTAprocess system. Our safety stock agreements for ÄKTAprocess can be tailored to meet your unique availability needs. System specifications System specifications System flow rate 6 mm i.d. PP* L/h 3/8 in o.d. (7.7 mm i.d.) SS L/h 10 mm i.d. PP L/h 1/2 in o.d. (9.4 mm i.d.) SS L/h 1 in o.d. (20.4 mm i.d.) PP L/h 1 in o.d. (22.1 mm i.d.) SS L/h UV wavelength range Single (280 nm) or multiple wavelengths ph range 0 14 (spec. valid between 2 and 12) Conductivity range 1 ms/cm to 200 ms/cm Ingress protection, cabinet electrical NEMA 4X / IP 56 Electrical standards UL 508A, EN Tubing size PP: 6 mm, 10 mm, SS: 3/8 in and 1/2 in Skid size 6 mm, 10 mm, 3/8 in and 1/2 in (W D H): 850 mm 1205 mm 1670 mm (D=750 mm if monitor and keyboard included) 1 in PP and SS (W D H): 1050 mm 1730 mm 1900 mm (D=2275 mm if monitor and keyboard included) * PP = polypropylene, SS = 316 L stainless steel. Operating conditions Operating pressure and temperature PP (6 mm, 10 mm, and 1 in) 6 bar (max 40 C) SS (3/8 in and 1/2 in) 10 bar (max 40 C) SS (1 in) 6 bar (max 40 C) Surrounding temperature: 2 30 C Applied solutions: PP systems: 4 60 C (max 3 bar at C) Applied solutions: SS systems: 4 80 C (max 3 bar at C and max 1 bar at C) 6 Chromatography systems Literature Data file ÄKTAprocess

144 Inline conditioning for process chromatography systems The intelligent control strategy of the inline conditioning/ chromatography system is designed to prepare buffers to be automatically adjusted, thereby improving the quality of the process. Flow Acid/Acid component P1 Flow Cond UV ph Cond UV ph Optional organic solvents on one or several inlets Base/base component Water P2 P3 Flow Flow Prepared buffer to column Salt P4 Flow Optional inlets P5 A flowscheme for a typical system designed for inline conditioning. 6 Chromatography systems Inline conditioning (IC) is a solution for researchers and process engineers who need to formulate buffer solutions precisely at the time of use, using stock solutions of the buffer components. When using inline conditioning, the storage of prepared buffer is eliminated (thus reducing facility space limitations) and time and effort to transport and maintain buffer containers is reduced. Another advantage of Inline conditioning is that by including the buffer preparation within the chromatography run, all relevant data for buffer characteristics and for the run itself are recorded by the control software at the same time, resulting in one batch record for both operations. GE Healtcare s inline conditioning technology provides a number of advantages to biopharmaceutical producers. The primary benefits include: Secured, timely mixing of different solutions by a single system Easy method set-up and IC control with UNICORN Reproducible results Allows for use of smaller tanks or disposable bags PAT-based IC process technology System characteristics and IC accuracy UV wavelength range ph range 0-14 ph accuracy* Conductivity range Conductivity accuracy* Single (280 nm) or multiple wavelengths 0.2 ph units 1 ms/cm to 200 ms/cm ± 2% or 0.5 ms Process temperature 4 C to 80 C (stainless steel systems) 4 C to 60 C (polypropylene systems) Electrical standards UL 508A, EN * Accuracy values are minimum much higher accuracy can be reached under most conditions. Literature Data file Inline conditioning for process chromatography systems For ordering information and further technical details, please contact your regional GE Healthcare sales office

145 Customized BioProcess Solutions For some applications only customized solutions fit the bill. Through its Customized BioProcess Solutions (CBS) group, GE Healthcare can offer a wide range of engineered solutions for chromatography, membrane filtration and oligonucleotide synthesis. The CBS group has more than 20 years experience of engineering systems and columns to meet customer s application needs, specifications, and regulatory requirements. The choice of components, materials, manufacturing methods and system configuration are made by the customer in consultation with our engineers to ensure performance and compatibility. Choice of control software includes DeltaV, UNICORN, PLC or any other requirement. Auxiliary equipment can also be manufactured according to specifications. A key element of GE Healthcare s offering is its service organization. Service agreements ensure rapid service and replacement spare parts delivered within 48 hours minimize expensive downtime. CBS DeltaV Standard Control Platform CBS DeltaV Standard Control Platform is a flexible control software that simplifies process automation of protein purification by industrial-scale chromatography. The control platform employs Emerson DeltaV software, which has a solid track record of providing excellent control capability in the pharmaceutical and biotechnology industries. Benefits of the CBS DeltaV Standard Control Platform include: Efficient and dedicated control solutions for chromatography purification of proteins Flexible operation (recipe) development and assessment Extensive analytical functions for chromatography data with UNICORN Evaluation Full integration with existing DeltaV systems Extensive support (e.g., audit trails) for regulatory support compliance For more information on CBS DeltaV Standard Control Platform, see datafile: Chromatography systems For more information, please contact your local GE Healthcare representative or visit the CBS homepage

146 UNICORN control Among the many features of UNICORN are easy method programming, powerful functions for method assessment, a dynamic display to keep you posted on process status, and the configurable user access profiles to keep your methods secure. In addition, UNICORN can simultaneously supervise up to four liquid handling units from a single work-station, independently or in a pre-programmed sequence. Full validation support for the control system software is available to help speed your product to market. The software consists of separate modules for method programming, system control and data evaluation. 6 Chromatography systems UNICORN is the control system for real-time control of protein purification unit operations (column packing, chromatography and filtration) from laboratory bench, through development, to full-scale production. UNICORN is used world-wide in over a thousand laboratories and controls hundreds of process development and production systems. UNICORN control system meets the needs of full-scale production with manufacturing systems, while maintaining the flexibility needed for method and process development with the range of systems in the ÄKTA family. This flexibility allows quick and simple transition from one stage of a project to the next. Clinical trial equipment can be turned into a final production installation overnight. Documentation and user interface remain consistent from one step to the next and re-investment and validation requirements are reduced to a minimum. UNICORN can also be adapted to control other liquid handling process units, or to connect to other control systems in a plant via the OPC interface. Method text editor. Easy method programming Most complex valving sequences are handled through valve macros. Programming can be done in time, volume or column volume base. Automatic scouting of important separation variables is easily performed. Conditional responses to specific monitor signals (UV, conductivity, ph, pressure and air) are established through simple WATCH commands. Main Menu Method Editor System Control Evaluation System Strategy UNICORN control module. Built-in strategy for all ÄKTAdesign systems UNICORN architecture. Customized strategy for BioProcess Systems and other liquid handling modules Modular hardware Real-time process monitoring As the chromatography run progresses, selected monitor signals are displayed numerically or as trend curves. The process picture with actual flow path and the continuously updated logbook can be displayed

147 Real-time control Up to four systems can be connected to one UNICORN workstation where individual controllers handle the realtime control of each system. Data evaluation or methods programming can be done while the systems are running. The control unit CU 950 (Ethernet and USB) provides a high degree of security for control and data. The unit secures started runs even if the local PC and communication is disrupted. CU 950 Advanced also contains an internal memory that collects data in case of communication failure. Extensive data evaluation All monitor data are stored in a Result File for storage and evaluation. Extensive data processing routines include curve smoothing, differentiation, normalization, baseline calculation, peak integration and height equivalent to a theoretical plate (HETP) calculations. Start protocols are user-defined questions that must be answered before a run can be started. Questions can vary between simple operator prompts to those requiring mandatory answers and authorized approval. Notebooks permit additional text to be included in the process documentation. Separate files are generated for method notes, start notes, run notes, and evaluation notes. These notes can be entered at the designated time and cannot be altered after the run is complete. All programmed and manual events occurring during the run, including alarms and warnings, are documented in the logbook and cannot be altered. Security UNICORN provides a system for password authorization and access control. Operators log in by name and password. The user profile includes an access level that defines system functions available to each operator. Scalability Using UNICORN for method or process development on ÄKTA systems simplifies scale-up to BioProcess system. Personnel retraining is minimized and continuity exists in batch documentation and report generation. 6 UNICORN Method Development Evaluation procedures can be retrieved from a programmed method to process data and generate reports as part of an automated procedure. Batch documentation Along with the chromatographic results of each run, the Result File also includes the programmed method, start protocols, notebooks and the logbook. These files are protected and cannot be manipulated. Processed data generated from an evaluation procedure are stored in the Result File, but separate from the original data. Lab Scale Pilot Scale Manufacturing Scale up/down Scale up/down UNICORN methods can be transferred between systems at different scales. Validation support UNICORN is fully compliant with 21 CFR Part 11 and is extensively documented for validation purposes. A Validation Support File is available describing our software development model including routines and test models. Chromatography systems Installation and Operational Qualification documentation packages consisting of preprinted forms and test methods are also available (see p 224)

148 6 Chromatography systems OPC Connectivity The UNICORN OPC server provides a standardized integration interface to support integration between UNICORN and other software systems such as laboratory information systems (LIMS) and manufacturing execution systems like DCS and MES. OPC enables open connectivity via open standards created in collaboration with a number of worldwide leading automation manufacturers, including Microsoft. UNICORN OPC server supports the following four areas: UNICORN OPC Data Access gives access to all process data (e.g., real time values, valve status, process step information and commands) UNICORN Alarm & Events server informs an OPC client application that a system parameter has exceeded an upper or lower limit value. The UNICORN Alarm & Events server also provides information about the process (LogBook). UNICORN Historical Data Access allows any OPC client application access to the entire batch result generated by UNICORN UNICORN OPC Security controls client access to the UNICORN OPC DA, A&E and HDA to protect sensitive information and to guard against unauthorized modification of process parameters. This is an important security feature. Network support Network support allows control and monitoring of systems from any connected UNICORN workstation, subject to access rights defined by the system administrator. UNICORN is specifically designed for Windows networks operating system control. The figure below illustrates how it can be applied in a fully networked system. This facility gives a larger number of operators access to what is happening. Nevertheless, security is still very controlled and subject to strict user-defined access rights. Network support also enables results to be automatically saved on a server. Evaluation and generation of reports can then be made locally or at a remote PC. Computer and networking specifications System recommendations for UNICORN v Workstation PC Pentium 4, 1.5 GHz or higher 1024 Mb RAM 500 Mb disk space available at all times NTFS file system Controller CU-900 requires 1/2 length PCI slot CU-950 USB requires USB 1.1 Port CU-950 Advanced requires a 10 Mbit network interface card Network server Microsoft Windows 2003 Server, TCP/IP Operating system Microsoft Windows XP Professional (32-bit, with SP3) Microsoft Windows 7 Professional (32-bit) Microsoft Windows 7 Professional (64-bit) System recommendations for UNICORN 6.1 Workstation Dual-Core PC with 3 GB RAM Network 100 Mbit Ethernet LAN Two network cards on Instrument server PC Operating system Microsoft Windows XP Professional SP3 Microsoft Windows Vista Business SP1 Ordering information Please contact your local GE Healthcare sales office. Literature Data file UNICORN control system UNICORN 6 control software Validation support and service Validation Support File UNICORN UNICORN UNICORN network allows sharing of systems and a central location for data storage. Information on OPC-based integration Application note DeltaV* integration ifix integration MS SQL Server integration InTouch integration Data file OPC Manual OPC * DeltaV is a trademark owned by Emerson Process Management, Inc

149 6 Chromatography systems 149

150 7 Products for process development High-throughput process development 153 PreDictor 96-well filter plates 154 PreDictor RoboColumn 156 HiScreen columns 157 Examples of prepacked columns 158 Selection kits 160 Custom-packed columns 161 Systems for method and process development

151 7 Process development 151

152 Products for process development 7 GE Healthcare supports all stages of the drug development process, from early discovery to the development of clinical material and the final transfer to fullscale production. Process development, the design and scale-up of a process for clinical production, is supported by numerous products and services. High-throughput process development (HTPD) is a method that shortens development time and increases the amount of information available during early process development. PreDictor 96-well filter plates, prefilled with GE Healthcare BioProcess chromatography media, support HTPD by allowing parallel screening of chromatographic conditions, either in a manual or in an automated workflow. As a result, a large number of experimental conditions may be evaluated simultaneously, with minimal sample consumption. Assist software supports the PreDictor workflow from set-up of experimental design to data evaluation. PreDictor RoboColumn units are mini columns prepacked with GE Healthcare BioProcess chromatography media. When used together with a robotoic system such as Tecan, PreDictor RoboColumn units perform automated parallel screening of media and process conditions with minimal sample consumption. There are different types of prepacked columns containing various types of BioProcess media. The 10 cm bed height HiScreen columns contain media from the Capto, Capto ImpRes, and MabSelect families, as well as Sepharose Fast Flow and Sepharose High Performance. ÄKTA avant and ÄKTApilot are members of the ÄKTA family of chromatography systems and are well-suited for process development. As well as operating a wide range of prepacked columns, ÄKTA avant can also operate HiScale, FineLINE Pilot 35, and AxiChrom 50 columns. FineLINE 70, AxiChrom 50, 70, and 100, and BPG 100 can be connected to ÄKTApilot. The control software for ÄKTA systems is UNICORN, which can also be used for pilot-scale systems and full production. UNICORN combines the flexibility needed for method and process development with the stringent requirements for commercial manufacture of biopharmaceuticals. ReadyToProcess is our platform of ready-to-use products, engineered for convenience and speed. The product line is designed to meet the biopharmaceutical industry s need for increased flexibility and Lean enabling solutions from cell culture and fermentation to purification and final filling. ReadyToProcess products include WAVE Bioreactors, WAVE Mixer, fluid handling as well as ready-to-use filtration and chromatography solutions. For more information on ReadyToProcess products, see pages Process development Lead identification Research Pre-clinical testing Process Development Clinical phase I Clinical phase II Process Dev Pilot Scale Clinical phase III Marketing approval Market introduction GMP Production PreDictor formats HiTrap/HiScreen HiScale ReadyToProcess AxiChrom GE Healthcare s formats for process development through manufacturing

153 High-throughput process development The challenge of process development Efficient process development is crucial for the overall efficiency of biopharma development. By pushing more projects through the early pipeline and rapidly identifying and discontinuing the unsuccessful ones, resources can be focused on those that are likely to succeed. In addition, purification processes should be well characterized to increase robustness and to minimize the need for additional optimization during further clinical development. Total characterization space Detailed studies to define design space Conceptual visualization of a workflow for process development. Parallel screening using PreDictor plates or PreDictor RoboColumn makes it possible to explore a large experimental space (left). Once optimal conditions have been identified, fine-tuning and verification are carried out on packed columns using ÄKTA systems (middle). The design space, shown in blue (middle), is identified and scaled up to a robust production scale process (right). Area for further optimization Scale-up PreDictor prefilled 96-well filter plates, Assist software, and PreDictor RoboColumns for screening of conditions ÄKTA avant systems, integrated DoE module in UNICORN 6, HiScreen, and HiTrap columns for optimization ReadyToProcess platform and AxiChrom columns for scale-up and production 7 Increased throughput with parallel operation Media in well Wash/ Equilibration Sample addition Wash 1 3 times Elution 1 3 times Incubation Vacuum filtration or centrifugation Process development HTPD is a methodology that shortens development time and increases the amount of information available during early process development, while keeping sample consumption low. Chromatographic conditions are evaluated in parallel using 96well filter plates or miniaturized columns. As a result, a large number of experimental conditions may be evaluated simultaneously. This allows screening of a large experimental space, to identify the subspace that is most favourable with respect to one or several defined responses. Once this subspace has been found, optimization and scale-up may be done on packed columns using ÄKTA systems. A batch uptake experiment occurring in the wells of PreDictor filter plates. The steps in PreDictor plate experiments are the same as in a typical chromatography experiment: equilibration, sample loading, wash, and elution. Vacuum filtration or centrifugation Waste Analysis 153

154 PreDictor 96-well filter plates A) Binding capacity (mg/ml) ph 4.25 ph 4.75 ph Process development PreDictor 96-well filter plates are prefilled with BioProcess chromatography media. They are developed to support HTPD by allowing parallel screening of chromatographic conditions, either in a manual or in an automated workflow. Data generated by using PreDictor plates show good correlation with data obtained in chromatography columns, which makes the plates an excellent tool for initial screening of process conditions. PreDictor plates shorten time-to-clinic and increase productivity in the process development lab by: reducing experimental time: the time-scale for performing screening experiments can be reduced from weeks to hours lowering sample consumption: the amount of sample required for these experiments is significantly lower than for column experiments increasing process understanding: the ability to screen a large experimental space leads to an increase in process understanding and in the potential to design a robust process early in development B) Dynamic binding capacity (mg/ml) Ionic strength (M) ph 4.25 ph 4.75 ph Ionic strength (M) Determination of loading conditions for conalbumin on Capto S. A) binding capacities at 60 minutes in PreDictor Capto S plates (2 µl). Error bars represent one standard deviation, based on triplicates.b) dynamic binding capacities (DBC) at 10% breakthrough for conalbumin on Capto S. Residence time 2 minutes, column Tricorn 5/100 (CV 2 ml). Visit us on the web at

155 Ordering information Single medium plates No. supplied PreDictor Capto Q, 2 µl 4 96-well filter plates PreDictor Capto Q, 20 μl 4 96-well filter plates PreDictor Capto Q, 50 μl 4 96-well filter plates PreDictor Capto S, 2 μl 4 96-well filter plates PreDictor Capto S, 20 μl 4 96-well filter plates PreDictor Capto S, 50 μl 4 96-well filter plates PreDictor Capto DEAE, 2 μl 4 96-well filter plates PreDictor Capto DEAE, 20 μl 4 96-well filter plates PreDictor Capto DEAE, 50 μl 4 96-well filter plates PreDictor Capto L, 6 μl 4 96-well filter plates PreDictor Capto L, 20 μl 4 96-well filter plates PreDictor Capto L, 50 μl 4 96-well filter plates PreDictor Capto MMC, 6 μl 4 96-well filter plates PreDictor Capto MMC, 20 μl 4 96-well filter plates PreDictor Capto MMC, 50 μl 4 96-well filter plates PreDictor Capto adhere, 6 μl 4 96-well filter plates PreDictor Capto adhere, 20 μl 4 96-well filter plates PreDictor Capto adhere, 50 μl 4 96-well filter plates PreDictor Capto SP ImpRes, 6 μl 4 96-well filter plates PreDictor Capto SP ImpRes, 20 μl 4 96-well filter plates PreDictor Capto Q ImpRes, 6 μl 4 96-well filter plates PreDictor Capto Q ImpRes, 20 μl 4 96-well filter plates PreDictor MabSelect, 6 µl 4 96-well filter plates PreDictor MabSelect, 20 μl 4 96-well filter plates PreDictor MabSelect, 50 μl 4 96-well filter plates PreDictor MabSelect SuRe, 6 μl 4 96-well filter plates PreDictor MabSelect SuRe, 20 μl 4 96-well filter plates PreDictor MabSelect SuRe, 50 μl 4 96-well filter plates PreDictor MabSelect SuRe LX, 6 μl 4 96-well filter plates PreDictor MabSelect SuRe LX, 20 μl 4 96-well filter plates PreDictor MabSelect SuRe LX, 50 μl 4 96-well filter plates PreDictor MabSelect Xtra, 6 μl 4 96-well filter plates PreDictor MabSelect Xtra, 20 μl 4 96-well filter plates PreDictor MabSelect Xtra, 50 μl 4 96-well filter plates PreDictor Q Sepharose Fast Flow, 6 μl 4 96-well filter plates PreDictor Q Sepharose Fast Flow, 20 μl 4 96-well filter plates PreDictor Q Sepharose Fast Flow, 50 μl 4 96-well filter plates PreDictor SP Sepharose Fast Flow, 6 μl 4 96-well filter plates PreDictor SP Sepharose Fast Flow, 20 μl 4 96-well filter plates PreDictor SP Sepharose Fast Flow, 50 μl 4 96-well filter plates PreDictor Butyl Sepharose 4 Fast Flow, 6 μl 4 96-well filter plates PreDictor Butyl Sepharose 4 Fast Flow, 50 μl 4 96-well filter plates PreDictor Butyl-S Sepharose 6 Fast Flow, 6 μl 4 96-well filter plates PreDictor Butyl-S Sepharose 6 Fast Flow, 50 μl 4 96-well filter plates Note: For optimal results, different applications will require different amount of chromatography media in the wells. Thus plates with each chromatography medium are available with three different volumes of media. Generally, for binding studies plates with 2 or 6 µl chromatography media should be used. For wash and elution studies larger gel volumes are required and both feed/sample concentration and the actual load (load density) will determine what plate to use. The first option for wash studies is the 50 µl plates. For elution studies the 20 µl plate should be tested first. Ordering information Single medium plates No. supplied PreDictor Capto Butyl, 6 μl 4 96-well filter plates PreDictor Capto Butyl, 50 μl 4 96-well filter plates PreDictor Capto Octyl, 6 μl 4 96-well filter plates PreDictor Capto Octyl, 50 μl 4 96-well filter plates PreDictor Capto Phenyl (high sub), 6 μl 4 96-well filter plates PreDictor Capto Phenyl (high sub), 50 μl 4 96-well filter plates PreDictor Octyl Sepharose 4 Fast Flow, 6 μl 4 96-well filter plates PreDictor Octyl Sepharose 4 Fast Flow, 50 μl 4 96-well filter plates PreDictor Phenyl Sepharose 6 Fast Flow (high sub), 6 μl 4 96-well filter plates PreDictor Phenyl Sepharose 6 Fast Flow (high sub), 50 μl 4 96-well filter plates PreDictor Phenyl Sepharose 6 Fast Flow (low sub), 6 μl 4 96-well filter plates PreDictor Phenyl Sepharose 6 Fast Flow (low sub), 50 μl 4 96-well filter plates PreDictor LambdaFabSelect, 6 µl 4 96-well filter plates PreDictor LambdaFabSelect, 20 µl 4 96-well filter plates PreDictor LambdaFabSelect, 50 µl 4 96-well filter plates Screening plates No. supplied PreDictor AIEX screening 2 μl/6 μl 4 96-well filter plates PreDictor AIEX screening 20 μl 4 96-well filter plates PreDictor CIEX screening 2 μl/6 μl 4 96-well filter plates PreDictor CIEX screening 20 μl 4 96-well filter plates PreDictor HIC screening high hydrophobicity, 6 μl 4 96-well filter plates PreDictor HIC screening high hydrophobicity, 50 μl 4 96-well filter plates PreDictor HIC screening low hydrophobicity, 6 μl 4 96-well filter plates PreDictor HIC screening low hydrophobicity, 50 μl 4 96-well filter plates Adsorption isotherm plates No. supplied PreDictor Capto Q isotherm 4 96-well filter plates PreDictor Capto S isotherm 4 96-well filter plates PreDictor Capto DEAE isotherm 4 96-well filter plates PreDictor Capto MMC isotherm 4 96-well filter plates PreDictor Capto adhere isotherm 4 96-well filter plates PreDictor MabSelect isotherm 4 96-well filter plates PreDictor MabSelect SuRe isotherm 4 96-well filter plates PreDictor MabSelect Xtra isotherm 4 96-well filter plates PreDictor Q Sepharose Fast Flow isotherm 4 96-well filter plates PreDictor SP Sepharose Fast Flow isotherm 4 96-well filter plates Plates are manufactured on request. Additional media are available on request. 7 Process development 155

156 PreDictor RoboColumn 7 Process development PreDictor RoboColumn units are miniaturized chromatographic columns prepacked with BioProcess chromatography media from GE Healthcare. The columns are available for several chromatographic techniques such as ion exchange chromatography, affinity chromatography, multimodal chromatography, and hydrophobic interaction chromatography. These miniaturized columns support HTPD using a robotic liquid handling workstation, such as Freedom EVO from Tecan, for fully automated and parallel chromatographic separations. PreDictor RoboColumn offers: Miniaturized column format: facilitates screening of a wide range of parameters with small sample consumption Reduced experimental time: automation and parallel screening minimizes manual labor and saves time Increased process understanding: high-throughput workflow allows investigation of enlarged experimental space for better process understanding. Visit us on the web at Ordering information Product 1 Ion exchange chromatography (IEX) PreDictor RoboColumn Capto Q, 200 μl PreDictor RoboColumn Capto Q, 600 μl PreDictor RoboColumn Capto S, 200 μl PreDictor RoboColumn Capto S, 600 μl PreDictor RoboColumn Capto DEAE, 200 μl PreDictor RoboColumn Capto DEAE, 600 μl PreDictor RoboColumn Q Sepharose HP, 200 μl PreDictor RoboColumn Q Sepharose HP, 600 μl PreDictor RoboColumn SP Sepharose HP, 200 μl PreDictor RoboColumn SP Sepharose HP, 600 μl PreDictor RoboColumn Q Sepharose FF, 200 μl PreDictor RoboColumn Q Sepharose FF, 600 μl PreDictor RoboColumn SP Sepharose FF, 200 μl PreDictor RoboColumn SP Sepharose FF, 600 μl PreDictor RoboColumn Capto Q ImpRes, 200 μl PreDictor RoboColumn Capto Q ImpRes, 600 μl PreDictor RoboColumn Capto SP ImpRes, 200 μl PreDictor RoboColumn Capto SP ImpRes, 600 μl Multimodal chromatography (MM) PreDictor RoboColumn Capto MMC, 200 μl PreDictor RoboColumn Capto MMC, 600 μl PreDictor RoboColumn Capto adhere, 200 μl PreDictor RoboColumn Capto adhere, 600 μl Affinity chromatography (AC) PreDictor Robocolumn 50 μl PreDictor Robocolumn, 200 μl PreDictor RoboColumn MabSelect, 50 μl PreDictor RoboColumn MabSelect, 200 μl PreDictor RoboColumn MabSelect SuRe, 50 μl PreDictor RoboColumn MabSelect SuRe, 200 μl PreDictor RoboColumn MabSelect Xtra, 50 μl PreDictor RoboColumn MabSelect Xtra, 200 μl PreDictor RoboColumn MabSelect SuRe LX, 200 μl PreDictor RoboColumn MabSelect SuRe LX, 600 μl Hydrophobic interaction chromatography (HIC) PreDictor RoboColumn Capto Phenyl (high sub), 200 μl PreDictor RoboColumn Capto Phenyl (high sub), 600 μl PreDictor RoboColumn Capto Butyl, 200 μl PreDictor RoboColumn Capto Butyl, 600 μl PreDictor RoboColumn Phenyl Sepharose 6FF (high sub), 200 μl PreDictor RoboColumn Phenyl Sepharose 6FF (high sub), 600 μl PreDictor RoboColumn Phenyl Sepharose 6FF (low sub), 200 μl PreDictor RoboColumn Phenyl Sepharose 6FF (low sub), 600 μl PreDictor RoboColumn Butyl Sepharose 4FF, 200 μl PreDictor RoboColumn Butyl Sepharose 4FF, 600 μl PreDictor RoboColumn Butyl-S Sepharose 6FF, 200 μl PreDictor RoboColumn Butyl-S Sepharose 6FF, 600 μl PreDictor RoboColumn Octyl Sepharose 4FF, 200 μl PreDictor RoboColumn Octyl Sepharose 4FF, 600 μl PreDictor RoboColumn Butyl Sepharose HP, 200 μl PreDictor RoboColumn Butyl Sepharose HP, 600 μl PreDictor RoboColumn Phenyl Sepharose HP, 200 μl PreDictor RoboColumn Phenyl Sepharose HP, 600 μl Pack size = One row of eight columns Note: PreDictor RoboColumn units are packed by Atoll GmbH and are identical to Atoll GmbH RoboColumn units

157 HiScreen columns HiScreen columns are prepacked with many different BioProcess media designed for method optimization and parameter screening in process development. The 10 cm bed height makes it possible to perform scalable experiments at relevant fluid velocities. The HiScreen columns are part of the process development platform available from GE Healthcare. All media prepacked in HiScreen columns are available in different formats and bulk packs, for all scales, from development work and pilot studies to routine production. The volume of the HiScreen column is small, 4.7 ml, which reduces costs by decreasing sample and buffer consumption. The 10 cm bed height of these prepacked columns makes them a good choice for method optimization and parameter screening (e.g., selectivity, capacity, binding and elution conditions) and following scale-up. If possible, two columns can be connected in series to give a bed height of 20 cm. Ordering information Product Quantity AC HiScreen Capto L ml HiScreen MabSelect ml HiScreen MabSelect Xtra ml HiScreen MabSelect SuRe ml HiScreen MabSelect SuRe LX ml HiScreen IMAC FF ml HiScreen Ni FF ml HiScreen Capto Blue ml HiScreen Blue FF ml IEX HiScreen Capto Q ImpRes ml HiScreen Capto SP ImpRes ml HiScreen Capto Q ml HiScreen Capto S ml HiScreen Capto DEAE ml HiScreen Q FF ml HiScreen SP FF ml HiScreen Q HP ml HiScreen SP HP ml HiScreen DEAE FF ml Multimodal HiScreen Capto MMC ml HiScreen Capto adhere ml HiScreen Capto Core ml HIC HiScreen Butyl FF ml HiScreen Butyl-S FF ml HiScreen Octyl FF ml HiScreen Phenyl FF (high sub) ml HiScreen Phenyl FF (low sub) ml HiScreen Phenyl HP ml HiScreen Butyl HP ml HiScreen Capto Phenyl (high sub) ml HiScreen Capto Butyl ml Visit us on the web at 7 Process development HiScreen columns benefits: Designed for method optimization and parameter screening Easy connection in series to achieve 20 cm bed height Convenient and time-saving due to prepacked format Small column volume gives fast results and minimal sample/buffer consumption Reproducible results comparable to BioProcess scale columns packed with the same media as the same linear fluid velocity can be used 157

158 Examples of prepacked columns Affinity columns Gel filtration columns 7 Process development Ordering information Product Quantity HiTrap Benzamidine FF (high sub) 2 1 ml HiTrap Benzamidine FF (high sub) 5 1 ml HiTrap Benzamidine FF (high sub) 1 5 ml HiTrap Protein L 5 1 ml HiTrap Protein L 1 5 ml HiTrap Protein L 5 5 ml HiTrap Heparin HP 5 1 ml HiTrap Heparin HP 1 5 ml HiTrap Heparin HP 5 5 ml HiPrep Heparin FF 16/ ml HiPrep IMAC FF 16/ ml HiTrap IMAC FF 5 1 ml HiTrap IMAC FF 5 5 ml HiTrap NHS-activated HP 5 1 ml HiTrap NHS-activated HP 1 5 ml HiTrap MabSelect SuRe 5 1 ml HiTrap MabSelect SuRe 1 5 ml HiTrap MabSelect SuRe 5 5 ml HiTrap MabSelect 5 1 ml HiTrap MabSelect 1 5 ml HiTrap MabSelect 5 5 ml HiTrap MabSelect Xtra 5 1 ml HiTrap MabSelect Xtra 1 5 ml HiTrap MabSelect Xtra 5 5 ml HiTrap rprotein A FF 2 1 ml HiTrap rprotein A FF 5 1 ml HiTrap rprotein A FF 1 5 ml HiTrap rprotein A FF 5 5 ml HisTrap FF crude 5 1 ml HisTrap FF crude 5 5 ml HisPrep FF 16/ ml GSTrap FF 5 1 ml GSTrap FF 2 1 ml GSTrap FF 1 5 ml GSTrap FF 5 5 ml GSTPrep FF 16/ ml Note: For complete HiTrap and HiPrep columns offering visit Order online at Hydrophobic interaction chromatography columns Ordering information Product Quantity HiLoad 16/600 Superdex 30 pg ml HiLoad 26/600 Superdex 30 pg ml HiLoad 16/600 Superdex 75 pg ml HiLoad 26/600 Superdex 75 pg ml HiLoad 16/600 Superdex 200 pg ml HiLoad 26/600 Superdex 200 pg ml HiPrep 16/60 Sephacryl S-100 HR ml HiPrep 26/60 Sephacryl S-100 HR ml HiPrep 16/60 Sephacryl S-200 HR ml HiPrep 26/60 Sephacryl S-200 HR ml HIPrep 16/60 Sephacryl S-300 HR ml HiPrep 26/60 Sephacryl S-300 HR ml HiPrep 16/60 Sephacryl S-400 HR ml HiPrep 26/60 Sephacryl S-400 HR ml HiPrep 16/60 Sephacryl S-500 HR ml HiPrep 26/60 Sephacryl S-500 HR ml Order online at Desalting/Buffer exchange columns Ordering information Product Quantity HiTrap Desalting 5 5 ml HiPrep 26/10 Desalting 1 53 ml HiPrep 26/10 Desalting 4 53 ml Order online at Ordering information Product Quantity HiPrep Phenyl FF (high sub) 16/ ml HiPrep Phenyl FF (low sub) 16/ ml HiPrep Butyl FF 16/ ml HiPrep Octyl FF 16/ ml HiLoad 16/10 Phenyl Sepharose HP 1 20 ml HiLoad 26/10 Phenyl Sepharose HP 1 53 ml HiTrap HIC Selection Kit 7 1 ml HiTrap Butyl HP 5 1 ml HiTrap Butyl HP 5 5 ml HiTrap Butyl-S FF 5 1 ml HiTrap Butyl-S FF 5 5 ml HiTrap Butyl FF 5 1 ml HiTrap Butyl FF 5 5 ml HiTrap Octyl FF 5 1 ml HiTrap Octyl FF 5 5 ml Ordering information Product Quantity HiTrap Phenyl FF (high sub) 5 1 ml HiTrap Phenyl FF (high sub) 5 5 ml HiTrap Phenyl FF (low sub) 5 1 ml HiTrap Phenyl FF (low sub) 5 5 ml HiTrap Phenyl HP 5 1 ml HiTrap Phenyl HP 5 5 ml Order online at Order online at

159 Ion exchange columns Ordering information Product Quantity HiLoad 16/10 Q Sepharose HP 1 20 ml HiLoad 16/10 SP Sepharose HP 1 20 ml HiLoad 26/10 Q Sepharose HP 1 53 ml HiLoad 26/10 SP Sepharose HP 1 53 ml HiPrep Q XL 16/ ml HiPrep SP XL 16/ ml HiPrep DEAE FF 16/ ml HiPrep CM FF 16/ ml HiPrep Q FF 16/ ml HiPrep SP FF 16/ ml HiTrap Capto IEX Selection Kit 5 1 ml HiTrap IEX Selection Kit 7 1 ml HiTrap ANX FF (high sub) 5 1 ml HiTrap ANX FF (high sub) 5 5 ml HiTrap Capto Q ImpRes 5 1 ml HiTrap Capto Q ImpRes 5 5 ml HiTrap Capto SP ImpRes 5 1 ml HiTrap Capto SP ImpRes 5 5 ml HiTrap Capto DEAE 5 1 ml HiTrap Capto DEAE 5 5 ml HiTrap Capto Q 5 1 ml HiTrap Capto Q 5 5 ml HiTrap Capto S 5 1 ml HiTrap Capto S 5 5 ml HiTrap CM FF 5 1 ml HiTrap CM FF 5 5 ml HiTrap DEAE FF 5 1 ml HiTrap DEAE FF 5 5 ml HiTrap Q FF 5 1 ml HiTrap Q FF 5 5 ml HiTrap Q HP 5 1 ml HiTrap Q HP 5 5 ml HiTrap Q XL 5 1 ml HiTrap Q XL 5 5 ml HiTrap SP FF 5 1 ml HiTrap SP FF 5 5 ml HiTrap SP HP 5 1 ml HiTrap SP HP 5 5 ml HiTrap SP XL 5 1 ml HiTrap SP XL 5 5 ml Order online at Reversed phase chromatography column Ordering information Product Quantity SOURCE 15RPC ST 4.6/100* * Column not suitable for use with ÄKTAprime plus chromatography system. Please contact us for assistance with selection of columns for ÄKTAprime plus or check the guide Prepacked chromatography columns for ÄKTA system, Order online at Prepacked columns for purification of high-quality plasmid DNA Ordering information Product Quantity PlasmidSelect Xtra Starter Kit PlasmidSelect Xtra Screening Kit Order online at Multimodal chromatography columns Ordering information Product Quantity HiTrap Capto adhere 5 1 ml HiTrap Capto adhere 5 5 ml HiTrap Capto MMC 5 1 ml HiTrap Capto MMC 5 5 ml HiTrap Capto Core ml Order online at 7 Process development 159

160 Selection kits In addition to the individual columns, there are a number of selection kits available. These kits usually contain three to seven prepacked columns that enable you to quickly screen potential media. IEX Selection Kit Eight different Sepharose media differentiated by process stage For Capture, Q Sepharose Big Beads and SP Sepharose Big Beads in 50 ml packs. For Intermediate Purification, Q Sepharose Fast Flow, SP Sepharose Fast Flow, CM Sepharose Fast Flow, and DEAE Sepharose Fast Flow in 50 ml packs. For Polishing, Q Sepharose High Performance and SP Sepharose High Performance in 1 ml prepacked HiTrap columns. HiTrap Capto IEX Selection Kit ( ) Different ion exchange and multimodal ligands on Capto enable convenient and easy screening Contains three different ion exchange ligands and two different multimodal ligands based on Capto. Prepacked with Capto Q, Capto S, Capto DEAE, Capto MMC, Capto adhere as well as connectors and detailed instructions. 7 HiTrap IEX Selection Kit ( ) Seven different ion exchange ligands on Sepharose Fast Flow and Sepharose XL enable fast and easy screening Contains seven 1 ml HiTrap columns prepacked with SP Sepharose Fast Flow, Q Sepharose Fast Flow, CM Sepharose Fast Flow, DEAE Sepharose Fast Flow, ANX Sepharose 4 Fast Flow (high sub), SP Sepharose XL and Q Sepharose XL as well as connectors and detailed instructions. Process development HiTrap HIC Selection Kit ( ) For screening different HIC media and experimental conditions Contains seven 1 ml HiTrap columns prepacked with Phenyl Sepharose High Performance, Phenyl Sepharose 6 Fast Flow (high sub), Phenyl Sepharose 6 Fast Flow (low sub), Butyl Sepharose High Performance, Butyl Sepharose 4 Fast Flow, Butyl-S Sepharose 6 Fast Flow, Octyl Sepharose 4 Fast Flow, connectors and detailed instructions. PlasmidSelect Xtra platform kits PlasmidSelect Xtra Starter Kit ( ) Fast and convenient process development Contains one HiPrep 26/10 Sepharose 6 FF column (53 ml), one HiTrap PlasmidSelect Xtra column (5 ml) and one HiTrap SOURCE 30Q column (5 ml) plus accessories. Does not include buffers. PlasmidSelect Xtra Screening Kit ( ) Quick and easy analysis with an ÄKTAdesign system Contains five 5 ml HiTrap Sepharose HP and five 1 ml HiTrap PlasmidSelect Xtra columns plus accessories. Does not include buffers

161 Custom-packed columns Custom products adapt the exact combination of media and column to solve specific purification problems. With years of experience in chromatography and column packing, you can rely on the Custom Products group to tailor a solution to fit your separation objectives and save you time. The group works with you from the initial discussions right through to delivery, establishing your needs and sorting through the choices. Each custom column is packed and tested under ISO 9001 standards A result of analysis and user instruction that describe the column performance is supplied with the column Delivery time is between three and five weeks, depending on media and column specifications GE Healthcare offers the largest selection of prepacked columns and bulk media available, encompassing most liquid chromatography techniques. However, should you require a special configuration contact the Custom Products group through your local GE Healthcare office to discuss your ideas and receive a free quotation. 7 Process development 161

162 Systems for method and process development ÄKTA avant system ÄKTA avant is designed for fast and secure development of scalable chromatographic methods and processes. The system is available in two versions: ÄKTA avant 25 is optimized for media screening and method optimization using small columns. ÄKTA avant 150 is designed for scaling up to larger columns, as well as fine-tuning and robustness testing of the optimized process. ÄKTA avant is operated by UNICORN 6 software, which has been developed to increase productivity and efficiency. This version of UNICORN features an intuitive user interface, an improved method editor, and integrated Design of Experiments (DoE) functionality. Using the DoE functionality in ÄKTA avant, it is not only possible to plan an experimental series to maximize the amount of information obtained from a minimum number of experiments; the system can also run it in an automated fashion, saving time and money. For more information on ÄKTA avant, see page Process development ÄKTApilot system ÄKTApilot system is a bench-top process development and production system based on the ÄKTA design platform. The broad dynamic capacity enables easy scale-up/ down. The hygienic design, high level of automation, accuracy, reproducibility, and reliable operation makes this an excellent system for scale-up, process optimization, and production. This design gives a smooth path to cgmp workflow. ÄKTApilot and UNICORN software cut preparation times to a minimum while maintaining accuracy and assuring reproducibility. This allows quick and simple transfer from one stage of a project to the next. The Method Wizard, together with a flexible system configuration, allows fast and easy purification or column packing. The system supports you in process development, scale-up/-down and pharmaceutical production. The Scouting feature gives automatic support in process development and optimization. For more information on ÄKTApilot system, see page

163 7 Process development 163

164 8Filtration products Cross flow filtration 170 Normal flow filtration 189 Filtration hardware

165 8 Filtration products 165

166 Filtration Cross flow filtration (CFF), normal ( dead-end ) flow filtration (NFF), and chromatographic separations are all frequently required in the purification process of biological fluids. CFF and NFF are positive barrier separations and thus complement chromatography. GE Healthcare provides filtration solutions and support for integrated bioprocessing applications at every step and every scale of the drug development, validation and manufacturing process. The following classes of filtration consumables are available: Cassettes Cross flow filtration: hollow fiber cartridges flat sheet cassettes Normal flow filtration: prefiltration final filtration Sterile grade filter For the latest information about our filtration products, visit Scanning electron microscope Optical microscope Visible to naked eye Ionic range Molecular range Macro molecular range Micro particle range Macro particle range Micrometers (Log scale) Angstrom units (Log scale) Approx. molecular wt. (Saccharide type-no scale) ,000 20, , , Relative size of biological Endotoxin/pyrogen Albumin protein materials Rhinovirus HIV Parainfluenza Poxvirus-Variola Yeast cells Red blood cells Pollen Adenovirus Mycobacterium Virus Bacteria Milled flour 8 Relative size of common materials Metal ion Sugar Aqueous salts Gelatin Carbon black Latex/emulsion Paint pigment Pinpoint Beach sand Ion ex. resin bead Filtration products Process for separation Atomic radius Reverse Osmosis (RO) Synthetic dye Cross Flow Filtration (CFF) Nano Filtration (NF) Colloidal silica Ultra Filtration (UF) Note: 1 micron (1x10-6 meters) 4x10-5 inches ( inches); 1 angstrom unit = meters = 10-4 micrometers (microns) Micro Filtration (MF) A.C. fine test dust Human hair Normal Flow Filtration (NFF) Particle Filtration (PF) GE Healthcare s products span a wide range of filtration applications

167 Cross Flow Flow Pressure How cross flow membranes work Permeate Flow How normal or dead-end flow filters work Time Cross Flow Flow Feed Flow Flow Pressure Pressure Permeate Flow Time Filtrate Flow Time The feed stream moves parallel to the membrane surface (cross flow) and purified Feed liquid Flowpasses through the membrane (permeate). Most of the particulates and aggregates are carried Flowaway by the cross flow. Pressure The feed stream moves perpendicular to the membrane and purified liquid passes through the membrane (filtrate). Particulates and aggregates remain behind as filter cake, reducing flow and/or increasing pressure over time. Filtrate Flow Time Filtration how it works Membrane filters retain matter primarily due to size differences between the molecules and the pores in the membrane. The precise nature of GE Healthcare s porous synthetic membranes used in the CFF product range provides a range of benefits for bioprocess purification and recovery. The key advantage of a positive barrier is GE Healthcare s advanced void-free technology, which allows optimal performance with a wide variety of feed stream constituents. Our manufacturing technology provides sharp cut-off to enhance clarification and fractionation applications. Our filters are engineered specifically for accurate linear scale-up, and our family of CFF and NFF devices offers consistent performance, excellent durability, and ease of use. Cross flow filtration vs. normal flow filtration Both technologies purify bioprocess solutions by removing contaminates with a fixed porous medium, yet each format has unique advantages. Generally, normal flow filters (NFF) are used where clarification and/or bio-burden reduction is desired in relatively low-solid streams, for protecting or enhancing downstream operations, or when final polishing is required to achieve sterility. Cross flow filters (CFF) are best suited for higher solids, more viscous feed solutions, and/or where concentration or purification of cells or target species is desired. The guide below provides further information. Where functional needs overlap, a GE Healthcare Filtration Specialist can help you find the optimal configuration for your specific operation. Guide to selecting normal flow or cross flow filtration NFF MF Range UF Range High solids handling Diafiltration Concentration Disposable 1 Recirculation required Clean & reuse Air applications Aseptic environment Sterile applications Integrity-testable Validation guides Self-contained available SIP Autoclavable = suitable for use. 1 some models available; contact GE Healthcare. CFF 8 Filtration products 167

168 8 Filtration products Cross flow filtration GE Healthcare separation cassettes and cartridges are designed for cross flow (tangential flow) operation. Unlike single pass or normal flow (dead end) filtration, cross flow filtration continuously sweeps the membrane surface by circulating the feed stream across it. This circulation minimizes blinding of the membrane pores and promotes consistent, long-term productivity. It also allows units to be cleaned, stored, and re-used as needed. As the feed stream is pumped through the cassette or cartridge, the retentate (the materials excluded by the membrane pores) continues through the recirculation loop, while the permeate, including solvent and solutes, is transported through the membrane pores and collected separately. Cross flow filtration format selection guide Attribute Hollow fiber Cassette Low binding Best Best Aseptic processing Best Good Reliable liner scale up Best Best High solids Best Good Low solids concentration Good Best Perfusion Best NR Cell clarification Best Good Plasma concentration Good Best Diafiltration Best Good Single use Good Good Laboratory scale Best Best Low hold up Good Best UF Best Best MF Best NA Steam-in-Place Best NR Multiple feed channel heights Best Limited Normal flow filtration GE Healthcare provides comprehensive normal flow filtration products designed to maximize process efficiency from early-phase product development through to full bioprocess production. Liquid sterilization Filters incorporating high-flow membrane formats minimize filtration system sizes while meeting full validation and integrity test requirements. Bioburden reduction Extensive range of membrane and depth media products meet individual application requirements. Clarification Range of absolute-rated, prefiltration products providing consistent performance with broad chemical compatibility. Range of Normal flow filtration filters Formats Prefilters Bio-burden reduction* Sterilizing grade Flat disc Capsules 10 in cartridges 20 in cartridges 30 in cartridges Pore sizes * 1 to 5 Logs 168

169 Systems GE Healthcare filtration systems are engineered with consistent flow paths for straightforward scale-up/ scale-down, easing the transition from research to pilot to full production. In addition, GE Healthcare has highly experienced technical resources available for consultation and input into process development. ÄKTAcrossflow The purification of biomolecules normally uses filtration to concentrate and wash feed prior to chromatography. ÄKTAcrossflow is a fully automated system for cross flow filtration (ultrafiltration/diafiltration and cell separation) designed for process development and optimization. ÄKTAcrossflow is suitable for installation in a laboratory environment, which reduces facility and infrastructure expenditure. The benchtop system is compact and has a sanitary design with changeable wetted parts. UniFlux systems UniFlux systems provide a highly flexible means for incorporating filtration solutions into an overall downstream process. Available in 4 sizes (10, 30, 120, and 400 Lpm) for pilot to production scales, UniFlux is a fully automated system with UNICORN control software, now expanded to encompass filtration as well as chromatography. Designed to maximize productivity in cross flow filtration, UniFlux works in concert with other GE Healthcare components to provide consistent, repeatable and validatable results. UniFlux was developed with input from several GE Healthcare customers with needs ranging from research and development to biopharmaceutical manufacturing, thus helping ensure the relevance of each feature. All UniFlux systems are skid-mounted, mobile, and can fit through a standard doorway. The automated systems include the following features: Rotary-lobe pump for reliable, shear-sensitive operation (diaphragm pump for UniFlux 10) Sanitary diaphragm valves Overpressure protection Zero dead-leg piping in stainless steel Product contact material 316L stainless steel Monitoring of all major process parameters Automated systems also include the additional benefit of GE Healthcare UNICORN control system. UNICORN software, a single interface for the control of both filtration and chromatography systems, has become a standard in the industry with over systems in use, many in approved manufacturing operations. The UNICORN operating system is an extremely powerful tool for process development and production control, providing flexibility to control processes with automatic TMP control or regulated flow control. GrandStand pilot/process systems GrandStand pilot/process systems are self-contained and designed for MaxCell Large Process Scale Cartridges up to 13 m 2. Process volumes range from 50 to 1000 L and higher. Kvick cassette systems The Kvick Lab separation system uses up to five Kvick Lab cassettes, and includes a 2.5 L reservoir, rotary-lobe pump, pressure gauges, and necessary valves, piping, connectors, and fittings. The Kvick Flow system can accommodate up to 10 Kvick Flow cassettes. Scale-up In addition to laboratory-scale cross flow devices and systems, GE Healthcare also offers a complete range of products for biopharmaceutical scale-up to pilot and production operations. Hollow fiber ultrafiltration and microfiltration products are supplied as 25 different selfcontained cartridge designs ranging from 16 cm 2 to 28 m 2 of effective membrane area. MidGee, MidGee Hoop and Xampler scale hollow fiber cartridges can be optimized in larger processes by using pilot scale cartridges/process scale cartridges. Steam-inplace hollow fiber cartridge elements for pharmaceutical manufacturing are also available. Like cartridges, Kvick Cassette offerings provide scalability from laboratory through pilot to production scale. Both Kvick Lab System and Kvick Flow System benefit from a design and engineering approach usually reserved for large-scale production equipment. Automated cross flow systems are available for hollow fiber and Kvick cassettes at laboratory-scale as ÄKTAcrossflow and at pilot/production-scale as UniFlux. 8 Filtration products 169

170 Cross flow filtration Kvick Start cassettes Highly selective membranes provide reproducible and precise separations, thus maximizing yields. The cassettes are provided with UNF fittings for use with ÄKTAcrossflow, and with luer lok adapters for use with other systems. Kvick Start cassettes are available with 50 cm 2 of membrane surface area and six molecular weight cut-offs (5 kda, 10 kda select, 10 kda, 30 kda, 50 kda, and 100 kda) to fit a broad range of cross flow applications. 8 Filtration products Kvick Start cassettes are for research, product development, lab scale evaluations and process development where starting material is limited. UNF fittings for use in the ÄKTAcrossflow instrument and Luer-lok adapters for use in virtually all other crossflow instruments Minimal working volume and minimum hold-up volume gives maximum product recovery USP Class VI compliant Low extractables PES (polyethersulfone) membrane resists a wide range of chemicals Precise, reproducibly selective membranes with a macrovoid-free structure for exceptional performance Kvick Start cassettes maximize product recovery by offering a small-area device capable of handling low working volumes with minimal hold-up. The cassettes offer easy setup and linear scalability to facilitate membrane evaluation trials, product screening, process development work and optimization of UF processes in downstream purification. When manifolded together, they allow concentration or diafiltration of product from less than 15 ml to over 2 L. Ordering information Model number Membrane area (cm 2 ) Cassette (NMWC) Quantity UFEST ST UFEST SE * UFEST ST UFEST ST UFEST ST UFEST ST UFESTCPAK045ST 50 per cassette 5, 10, 10*, 30, 50 and 100 kda 6 * 10 kda Select membrane is a tighter 10 kda membrane and is particularly effective for recombinant proteins. Technical specifications Materials of construction Housing Urethane Membrane Polyethersulfone Membrane screen Polypropylene Port Sealer Solvent-free urethane (meth)acrylate blend Inner plates Polyester copolymer Shipping solution N NaOH and 20% to 22% glycerine Retentate hold-up volume 1.4 ml Operating Conditions ph range, long term Storage 2 13 ph range, short term Cleaning 1 14 Maximum operating temperature 50 C Maximum inlet pressure 4 barg (60 psig) Typical operating cross flow ml/min 170

171 Kvick Lab SCU cassette Ordering information Model number Membrane area Cassette Qty (m 2 ) (ft 2 ) (NMWC) UFESC SE UFESC SE * UFESC ST UFESC ST UFESC ST UFESC ST KLSC010ST Kvick Lab SCU holder 1 * 10 kda Select membrane is a tighter 10 kda membrane Kvick SCU cassette specifications Materials of construction Housing Polyethersulfone Membrane Polyethersulfone Screen Polypropylene Encapsulent Silicone Preservative solution N NaOH and 20% to 22% glycerine Hold-up volume 15.5 ml Recommended operating conditions ph range, long-term Storage 2 to 13 ph range, short-term Cleaning 1 to 14 Maximum operating temperature 50 C (122 F) Maximum inlet pressure 3 barg (45 psig) Operating cross flow rate 850 ml/min (1.2 ft 2 ) Easy use with minimum hold-up volume and maximum product recovery. Precise, reproducibly selective membranes Low extractables PES (polyethersulfone) membrane resists a wide range of chemicals Anti-dead space technology 100% integrity tested Macrovoid-free membrane structure for exceptional performance Consistent fluid path for linear scale-up USP Class VI compliant Kvick SCU cassettes give easy set-up, enhanced cleanability, minimum product hold-up volume, and optimum membrane selectivity. They are designed for laboratory work with starting volumes of less than 250 ml to 25 L. The self-contained holder does not require cassette installation, thus promoting easy set-up and use. 8 Filtration products 171

172 Kvick Lab packets and Kvick Lab cassettes Ordering information Model number Membrane area Cassette Quantity (m 2 ) (ft 2 ) (NMWC) UFELA ST UFELA SE * UFELA ST UFELA ST UFELA ST UFELA ST UFELA ST UFELA SE * UFELA ST UFELA ST UFELA ST UFELA ST Filtration products Kvick Lab cassettes are designed for scale-up/scale-down studies with process volumes from 50 ml to 100 L. Kvick Lab packet is the smallest filtration device in the line of Kvick ultrafiltration (UF) cassettes from GE Healthcare. Kvick Lab packets are intended for the concentration and diafiltration of small process volumes ranging from approximately 50 to 2000 ml. Kvick Lab packets are specifically designed for use by process development engineers who are interested in developing process parameters for an ultrafiltration step that will be transitioned to full manufacturing scale. Kvick Lab packets are simple to use and effective for laboratory scientists with a need for rapid ultrafiltration of biomolecules. Kvick Lab packet cassettes fit into the Kvick Lab packet cassette holder, as well as competitive cassette holders. Kvick Lab cassettes are for laboratory work with starting volumes of less than 0.5 L up to 100 L. They fit into the Kvick Lab cassette holder, as well as competitive cassette holders, allowing existing equipment to benefit from high product recovery and better flux gains. The Kvick family of cassettes is designed for easy setup, simple cleaning, minimum product hold-up volume, and optimal membrane selectivity. Kvick cassettes are constructed of identical materials and have identical flow path geometries to ensure performance scalability and reproducibility across the full product range. Precise, reproducibly selective membranes Minimum hold-up volume and maximum product recovery Low extractables PES (polyethersulfone) membrane resists a wide range of chemicals 100% integrity tested Macrovoid-free membrane structure for exceptional performance USP Class VI compliant * 10 kda Select membrane is a tighter 10 kda membrane Technical specifications Fit the following holders Materials of construction: Membrane Screen Encapsulent Preservative solution Hold-up volume Kvick Lab holders, Kvick Lab packet holders, and competitive cassette holders Polyethersulfone Polypropylene Silicone Recommended operating conditions N NaOH and 20% to 22% glycerine 2 ml (Kvick Lab packet) 15.5 ml (Kvick Lab) ph range, long term Storage 2 13 ph range, short term Cleaning 1 14 Maximum operating temperature 50 C Maximum inlet pressure 4 barg (60 psig) Operating cross flow (0.1 ft 2 ) 85 ml/min for each cassette installed Operating cross flow (1.2 ft 2 ) 850 ml/min for each cassette installed 172

173 Kvick Flow cassettes Kvick Flow cassettes are for batch sizes with 5 to 1000 L starting volumes. Precise, reproducibly selective membranes Minimum hold-up volume and maximum product recovery Low extractables PES (polyethersulfone) membrane resists a wide range of chemicals Anti-dead space technology 100% integrity tested Macrovoid-free membrane structure for exceptional performance Consistent fluid path for linear scale-up USP Class VI compliant Kvick Flow cassettes fit into the Kvick Flow cassette holder, and can also be installed in other cassette holders, allowing existing equipment to benefit from high product recovery and better flux gains. Ordering Information Kvick Flow cassettes Model number Membrane area Cassette Qty (m 2 ) (ft 2 ) (NMWC) UFEFL S UFEFL SE * UFEFL ST UFEFL ST UFEFL ST UFEFL ST UFEFL ST UFEFL SE * UFEFL ST UFEFL ST UFEFL ST UFEFL ST * 10 kda Select membrane is a tighter 10 kda membrane Kvick Flow cassette specifications Fits the following holders Materials of construction: Membrane Screen Encapsulant Preservative solution Hold-up volume (5 ft 2 ) Hold-up volume (25 ft 2 ) Recommended operating conditions ph range, long term Storage 2 13 ph range, short term Cleaning 1 14 GE Healthcare Kvick cassette holders, and competitive cassette holders Polyethersulfone Polypropylene Silicone N NaOH and 20% to 22% glycerine 30 ml per cassette 150 ml per cassette Maximum operating temperature 50 C Maximum inlet pressure 4 barg (60 psig) Operating cross flow (5 ft 2 ) 3400 ml/min for each cassette installed Operating cross flow (25 ft 2 ) ml/min for each cassette installed 8 Filtration products 173

174 Kvick Lab packet holder The Packet & Holder combination is designed for: Performing crossflow trials in preparation for scale up Working with filters that have the same flow path lengths and geometries as our larger Kvick cassettes Applications that require a surface area for processing larger volumes than is practical by using Kvick Start cassettes (50 cm 2 ). The holder is designed to also hold one Kvick Lab (0.11 m 2 ) cassette. Many Packet applications will involve 200 to 2000 ml of feed material per Packet (100 cm 2 ). Ordering information Product Model number Qty Packet holder KLPH001SSU 1 Kvick UNF accessory Kit KSP001AKT 1 Kvick Lab packet holder torque wrench KLTW Kvick Lab packet holder The Kvick Lab packet holder is a versatile device that houses Kvick Lab packets and facilitates their use on ÄKTAcrossflow and on other small-scale crossflow systems. The holder will support linear cross flow versus pressure drop (DP) through the range of 0.7 and 4 barg (10 and 60 psig), indicating the structural strength of the unit. The holder is designed with UNF fittings for direct connection to the GE Healthcare ÄKTAcrossflow system. It also comes with an accessory kit for installation onto systems that use luer-style fittings. Technical specifications Materials of construction Holder Luer lock adapters Luer lock adapter gasket UNF block 316L stainless steel with electropolished inner surface with Ra less than 0.63 µm (25 µin) 400 stainless steel threaded posts Polypropylene EPDM PEEK Operating conditions Long-term storage ph 2 13 Cleaning/sanitization 1 14 Maximum inlet pressure 4 barg (60 psig) Operating cross flow rate 60 ml/min per 100 cm 2 filter Literature Data file for Kvick Lab packet and holder User Manual for Kvick Lab packet holder Filtration products 174

175 Kvick Lab cassette holder Ordering information Product Quantity Designed for fast assembly, Kvick Lab cassette holder utilizes sanitary connections. Capacity of 1 to 5 Kvick Lab cassettes Three forward facing ports for convenience Vertical inlet and outlet flow paths for excellent drainage and product recovery, with less than 30 ml hold-up volume Adjustable stand for ease of use on the laboratory bench The Kvick Lab cassette holder is for cross flow membrane separations at volumes from less than 0.5 L to 25 L. The holder is easy to set-up and quick and convenient to use. Its design with fewer parts and connections makes assembly very fast. Drainage and product recovery are excellent with less than 30 ml hold-up volume. Together, this holder and Kvick cassettes enable fast and accurate concentration and diafiltration of biological solutions. Furthermore, trial data can be scaled quickly to larger systems. Product development scale-up is linear from laboratory to production. Kvick Lab Holder (KLHR SS) Accessories Diaphragm Valve, stainless steel, 1/2 in sanitary connections (KFSY01071DV05) /2 in Sanitary Clamp (KFSY0107TCL05 ) /2 in Sanitary Gasket, EPDM (KFSY0107TCG05) Kvick Lab Holder torque wrench (KLTW0001) Kvick Lab Cassette Gasket (KYLAGS001011) Kvick Lab Cassette Gasket (KYLAGS001033) In-line pressure gauge, 0 4 barg (0 60 psig) (KLSY0105PGA60) Kvick Lab Pressure Gauge Kit (KLSY0105PRKIT) /2 in Sanitary to 1/4 in Hose Barb Adaptor (KLSY0105HB4F01) /2 in Sanitary to 3/8 in Hose Barb Adaptor (KLSY0105HBF01) Technical specifications Kvick Lab cassette holders Feed, retentate and permeate port fittings 1/2 in sanitary Dimensions (W L H) cm ( in) Weight 7.7 kg (17 lb) Max. temperature 121 C (250 F) Max. operating pressure 4 bar (60 psi) Installable membrane area m 2 ( ft 2 ) System hold-up volume 30 ml Materials of construction: Wetted parts Polished 316L stainless steel, Ra < 0.8 μm Non-wetted parts Tie rods, washers, stand: Stainless steel Tie rod nuts Bronze 8 Filtration products 175

176 Kvick Flow cassette holder Specifications Feed and retentate port fittings Permeate port fitting Maximum temperature Maximum feed pressure Maximum cassette holding capacity Holdup volume (nominal) Dimensions (W L H) Weight 1 in TC 1 in TC 50 C (122 F) 0 to 4 barg (5 to 60 psig) (15) Kvick Flow 5 or (3) Kvick Flow 25 cassettes 90 ml, feed/retentate side cm ( in) 36 kg (80 lb) 8 Filtration products Designed for flexibility and ease of use, Kvick Flow cassette holders may be used for concentration and diafiltration of biological solutions. With other products in the Kvick family, trial data can be linearly scaled up or down covering a great range of scales from laboratory to pilot to production processes. Benefiting from a design and engineering approach usually reserved for large-scale production systems, Kvick Flow cassette holders provide: Three forward facing ports for the convenience of pipe connection Vertically-oriented cassettes for easy installation Two versions: hydraulic holder for easy operation and manual holder for low cost Materials of construction Wetted parts: Front plate (distribution manifold) Back plate Other parts: Tie rods, washers, stand, and spacers Rail adapter Tie rod nuts Ordering Information Model number Description Polished 316L stainless steel, Ra < 0.65 μm Polished 316L stainless steel, Ra < 0.65 μm 316L stainless steel PTFE Brass KFHR SS Kvick Flow hydraulic holder, US-style power connection KFHR SS20 Kvick Flow hydraulic holder, EU-style power connection KFHR0115TQE Kvick Flow manual holder KFLGS Kvick Flow cassette gasket KFSY0107CPM10 1 in sanitary CPM-style fitting for pressure gauge KFSY0107APGA100 Pressure gauge, barg (0-100 psig), CPM style KFSY0107APSW100 Pressure gauge, barg (0-100 psig), CPM style KFSY0107CPMORI 0.75 in O-ring for CPM fitting KFSY0105TCG in sanitary gasket, EPDM KFSY0107TCG in sanitary gasket, EPDM KFSY0107TCL in sanitary clamp, SS KFST01071DV10 1 in sanitary inline diaphragm valve 176

177 Start AXM/AXH cross flow cartridges Start hollow fiber cartridges are comprised of polysulfone (PS)-based membranes of seven UF molecular weight ratings and four MF micron ratings for processing a wide range of cells, viruses, and biomolecules. These membranes exhibit sharp rejection curves, leading to reproducible, precise separations and maximized protein yield. Each of these membranes is identical to membranes in the GE Healthcare s pilot- and process-scale hollow fiber cartridges to ensure relevance of performance data generated by using hollow fiber Start AXM and Start AXH cross flow cartridges. Hollow fiber Start AXM and Start AXH cross flow cartridges. Rapid concentration and/or diafiltration of biological solutions and suspensions using an open flow path design Integrated UNF fittings for feed, and retentate permeate connections allows direct connection to ÄKTAcrossflow system Membrane area of 40 cm 2 (AXH) or 50 cm 2 (AXM) allows direct performance comparison when evaluating multiple membrane pore sizes Standard path lengths of 30 and 60 cm enables accurate scale-up and scale-down studies Hollow fiber Start AXM and Start AXH cross flow cartridges are self-contained, disposable filtration devices. They enable process development and optimization of ultrafiltration (UF) and microfiltration (MF) operations for cell processing and upstream clarification of biopharmaceutical solutions. The cartridges are designed for small scale processing, rapid laboratory concentration, and/or diafiltration of biological solutions at research-scale volumes with convenience and speed. The cartridges are easy to use and minimize membrane polarization due to the sweeping action generated by a recirculation pump. Typical application areas for Start cross flow cartridges include cell harvesting and washing, clarification of lysates and cell cultures, and concentration, diafiltration, and purification of monoclonal antibodies, plasmids, proteins, viruses, vaccines, colloids, and plasma. Ordering information Product Quantity Start AXM (UFP-3-C-2U) Start AXM (UFP-10-C-2U) Start AXM (UFP-30-C-2U) Start AXM (UFP-100-C-2U) Start AXM (UFP-300-C-2U) Start AXM (UFP-500-C-2U) Start AXM (UFP-500-E-2U) Start AXM (UFP-750-E-2U) Start AXM (CFP-1-E-2U) Start AXM (CFP-2-E-2U) Start AXM (CFP-4-E-2U) Start AXM (CFP-6-D-2U) Start AXH (UFP-3-C-H24U) Start AXH (UFP-10-C-H24U) Start AXH (UFP-30-C-H24U) Start AXH (UFP-100-C-H24U) Start AXH (UFP-300-C-H24U) Start AXH (UFP-500-C-H24U) Technical specifications Start AXM Start AXH Diameter 0.6 cm (0.25 in) 0.3 cm (0.125 in) Path length 30 cm (12 in) 60 cm (24 in) Connections: Feed/retentate UNF fitting UNF fitting Permeate UNF fitting UNF fitting Membrane area (nominal) 50 cm 2 (7.75 in 2 ) 40 cm 2 (6.2 in 2 ) Hold-up volume (nominal): Lumen side ml < 1 ml Shell side 1 ml < 1 ml Materials of Construction: Hollow fibers Polysulfone Polysulfone Housing components Polysulfone Polysulfone Potting Epoxy Epoxy Fitting caps Vinyl Vinyl 8 Filtration products 177

178 MidGee cross flow cartridges Ordering information Product* Quantity MidGee Cartridge,100 kd, 0.5 mm lumen (UFP-100-C-MM01A) MidGee Cartridge, 100 kd, 1.0 mm lumen (UFP-100-E-MM06A) MidGee Cartridge, 10 kd, 1.0 mm lumen (UFP-10-E-MM01A) MidGee Cartridge,30 kd, 0.5 mm lumen (UFP-30-C-MM01A) MidGee Cartridge, 30 kd, 1.0 mm lumen (UFP-30-E-MM06A) MidGee Cartridge, 500 kd, 1.0 mm lumen (UFP-500-E-MM01A) MidGee Cartridge, 750 kd, 1.0 mm lumen (UFP-750-E-MM06A) MidGee cross flow cartridges are for biological solution volumes up to 200 ml. Order online at * This table shows examples of MidGee cartridges currently available. For complete product lists and ordering information, please contact your local GE Healthcare representative. 8 Filtration products Rapid concentration and/or diafiltration of critical biological solutions and suspensions Ultrafiltration pore sizes from 1000 to NMWC, microfiltration pore sizes from 0.1 to 0.65 microns Maximum product recovery due to cross flow design. Sealed system permits convenient, continuous handsfree diafiltration Contaminating proteins and electrolytes can be washed through membrane fibers and reduced to undetectable levels Low hold-up volume for concentration of 2 to 5 ml (cartridge hold-up volume 0.5 ml) Quick, convenient Luer-Lok connections MidGee disposable cross flow cartridges are for smallscale processing, rapid laboratory concentration and/or diafiltration of biological solution volumes up to 200 ml with a convenience and speed impossible to achieve with stirred cells or dialysis tubing. Test data can be used to linearly scale up to larger cartridge and system designs or for scale-down process optimization and trouble-shooting experiments. Technical specifications MidGee cross flow cartridges Diameter 0.3 cm (0.125 in) Length 30.8 cm ( in) Endfitting connections Male Luer-Lok Permeate connections Male Luer-Lok Membrane area (nominal) 16 to 26 cm 2 ( in 2 ) Hold-up volume (nominal): Lumen side 0.25 ml Shell side 0.25 ml Autoclavable All except 1000 NMWC models Materials of construction: Hollow fibers Polysulfone Shell Polysulfone Luer Lok fittings Polycarbonate Potting Epoxy 178

179 MidGee Hoop cross flow cartridges MidGee Hoop cross flow cartridges are well-suited for scaling trials. Rapid concentration and/or diafiltration of critical biological solutions Ultra-compact design Full range of UF/MF pore sizes and lumen diameters 60 and 110 cm path lengths match pilot/production scale designs Autoclavable Require minimal solution volume/pump capacity High product recoveries with minimal shear denaturation No wall effects to distort scale-up projections Throughout the R&D process, access to product is often limited. As a result, investigations into optimization of operating conditions are sometimes postponed or avoided entirely. Now scale-up and scale-down using minimum product volumes is easy with our MidGee Hoop cross flow cartridges. Hoop cartridges provide all the critical features of full production scale in a miniature cross flow device, allowing simulation of process parameters including path length with minimal solution volume and pump capacity. The uniform flow path design from laboratory to production scale makes hollow fibers the most attractive of the various cross flow configurations for linear scale-up. Ordering information Product* Quantity MidGee Hoop Cartridge, 0.1 micron, 1.0 mm lumen, 60 cm (CFP-1-E-H22LA) MidGee Hoop Cartridge, 0.2 micron, 1.0 mm lumen, 60 cm (CFP-2-E-H22LA) MidGee Hoop Cartridge, 0.45 micron, 1.0 mm lumen, 60 cm (CFP-4-E-H22LA) MidGee Hoop Cartridge, 0.65 micron, 0.75 mm lumen, 60 cm (CFP-6-D-H22LA) MidGee Hoop Cartridge, 100kD, 0.5 mm lumen, 60 cm (UFP-100-C-H24LA) MidGee Hoop Cartridge, 100kD, 1.0 mm lumen, 60 cm (UFP-100-E-H22LA) MidGee Hoop Cartridge, 10kD, 0.5 mm lumen, 110 cm (UFP-10-C-H42LA) MidGee Hoop Cartridge, 10kD, 1.0 mm lumen, 110 cm (UFP-10-E-H22LA) MidGee Hoop Cartridge, 300kD, 0.5 mm lumen, 60 cm (UFP-300-C-H42LA) MidGee Hoop Cartridge, 300kD, 1.0 mm lumen, 60 cm (UFP-300-E-H22LA) MidGee Hoop Cartridge, 30kD, 0.5 mm lumen, 110 cm (UFP-30-C-H42LA) MidGee Hoop Cartridge, 30kD, 1.0 mm lumen, 60 cm (UFP-30-E-H22LA) MidGee Hoop Cartridge, 3kD, 0.5 mm lumen, 60 cm (UFP-3-C-H42LA) MidGee Hoop Cartridge, 500kD, 0.5 mm lumen, 110 cm (UFP-500-C-H42LA) MidGee Hoop Cartridge, 50kD, 1.0 mm lumen, 60 cm (UFP-50-E-H22LA) MidGee Hoop Cartridge, 750kD, 1.0 mm lumen, 110 cm (UFP-750-E-H42LA) * This table shows examples of MidGee Hoop cartridges currently available. For complete product lists and ordering information, please contact your local GE Healthcare representative. Technical specifications MidGee Hoop cross flow cartridges Diameter 0.3 cm (0.125 in) Length (nominal) 60 cm (23.6 in) 110 cm (43.3 in) Endfitting connections Male Luer-Lok Permeate connections Male Luer-Lok Membrane area (nominal) cm 2 ( in 2 ) Hold-up volume (nominal): 60 cm model 0.5 to 1.0 ml each (lumen and shell side) 110 cm model 0.6 to 2 ml each (lumen and shell side) Materials of construction: Hollow fibers Polysulfone Shell Polysulfone Luer Lok fittings Polycarbonate Potting Epoxy 8 Filtration products 179

180 Xampler laboratory cartridges 8 Filtration products Xampler cartridges can be manifolded together to achieve a wide range of process requirements. Nominal flow path lengths of 30 and 60 cm allow optimization of process conditions and assist future scale-up Low flow rate requirements allow the use of smaller pumps Polysulfone membrane minimizes non-specific protein binding and provides high product recovery Range of membrane areas suits different processing needs Offered with Tri-Clamp end fittings for quick and easy aseptic connection Autoclavable (with the exception of 1000 NMWC) devices address the need for small-volume sanitary processing Xampler ultrafiltration and microfiltration cartridges are for laboratory scale processing with solution volumes typically ranging from a few hundred milliliters to about five liters. Nominal flow path lengths are 30 and 60 cm and membrane areas range from 0.01 to 0.14 m 2 (0.12 to 1.5 ft 2 ). Moreover, they are directly scalable to pilot and process scale cartridges with equivalent path lengths. Xampler cartridges have self-contained housings that match Kvick Lab benchtop systems. Vertical operation achieves complete process fluid drainage and maximum product recovery. Ordering information Product* Quantity Xampler Cartridge, 0.1 micron, 0.75 mm lumen, size 3M, autoclavable (CFP-1-D-3MA) Xampler Cartridge, 0.2 micron, 1.0 mm lumen, size 3X2M, autoclavable (CFP-2-E-3X2MA) Xampler Cartridge, 0.45 micron, 1.0 mm lumen, size 3M, autoclavable (CFP-4-E-3MA) Xampler Cartridge, 0.65 micron, 0.75 mm lumen, size 3M, autoclavable (CFP-6-D-3MA) Xampler Cartridge, 100kD, 0.5 mm lumen, size 3M, autoclavable (UFP-100-C-3MA) Xampler Cartridge, 10kD, 1.0 mm lumen, size 3M, autoclavable (UFP-10-E-3MA) Xampler Cartridge, 1kD, 0.5 mm lumen, size 3M (UFP-1-C-3M) Xampler Cartridge, 300kD, 0.5 mm lumen, size 3M, autoclavable (UFP-300-C-3MA) Xampler Cartridge, 30kD, 1.0 mm lumen, size 3M, autoclavable (UFP-30-E-3MA) Xampler Cartridge, 3kD, 0.5 mm lumen, size 3M, autoclavable (UFP-3-C-3MA) Xampler Cartridge, 3kD, 0.5 mm lumen, size 3M, autoclavable (UFP-3-C-3X2MA) Xampler Cartridge, 500kD, 0.5 mm lumen, size 3M, autoclavable (UFP-500-C-3MA) Xampler Cartridge, 50kD, 1.0 mm lumen, size 3M, autoclavable (UFP-50-E-3MA) Xampler Cartridge, 5kD, 0.5 mm lumen, size 3M, autoclavable (UFP-5-C-3MA) * This table shows examples of Xampler cartridges currently available. For complete product lists and ordering information, please contact your local GE Healthcare representative. Technical specifications Xampler cross flow cartridges Diameter: 3M, 3X2M 0.9 cm (0.375 in) 4, 4M, 4X2M 1.9 cm (0.75 in) Length: 3M 31.7 cm (12.5 in) 3X2M 63.5 cm (25 in) cm (14.25 in) 4M 34.5 cm (13.6 in) 4X2M 66 cm (26 in) Endfitting connections: 3M, 3X2M, 4M, 4X2M 0.5 in Tri-Clamp in Tubing barb Permeate connections: 3M, 3X2M 0.25 in Tubing nipple 4, 4M, 4X2M in Tubing nipple Membrane area (nominal) cm 2 ( in 2 ) Hold-up volume (nominal): Lumen side 2 30 ml Shell side 5 75 ml Autoclavable All except 1000 NMWC models Materials of construction: Hollow fibers Polysulfone Shell Polysulfone Potting Epoxy Fiber bundle Polypropylene 180

181 Pilot scale hollow fiber cartridges To bridge the several steps between research and production volumes, GE Healthcare offers a full range of pilot scale ultrafiltration and microfiltration hollow fiber membrane cartridges. These cartridges feature industry standard 1.5 in Tri-Clamp sanitary feed and retentate fittings. Both 30 and 60 cm flowpath lengths are offered with cartridges that provide an order-of-magnitude membrane area span from 0.12 to 1.15 m 2 (1.3 to 12.5 ft 2 ). Please feel free to contact our technical support team for guidance with linear scaling parameters for small volume processing. Ordering information for pilot scale microfiltration cartridges Model number Pore size (μm) Fiber ID (mm) Membrane area (m 2 ) (ft 2 ) Nominal flowpath length (cm) CFP-1-D-5A CFP-1-E-5A CFP-2-E-5A CFP-4-E-5A CFP-6-D-5A CFP-1-D-6A CFP-1-E-6A CFP-2-E-6A CFP-2-G-6A CFP-4-E-6A CFP-6-D-6A CFP-1-D-8A CFP-1-E-8A CFP-2-E-8A CFP-4-E-8A CFP-6-D-8A CFP-1-D-9A CFP-1-E-9A CFP-2-E-9A CFP-2-G-9A CFP-4-E-9A CFP-6-D-9A Filtration products Note: All pilot scale cartridges are autoclavable except those with 1000 NMWC ultrafiltration membranes

182 Ordering information for pilot scale ultrafiltration cartridges 8 Filtration products Model number Pore size (NMWC) Fiber ID (mm) Membrane area (m 2 ) (ft 2 ) Nominal flowpath length (cm) UFP-1-C UFP-3-C-5A UFP-5-C-5A UFP-5-E-5A UFP-10-C-5A UFP-10-E-5A UFP-30-C-5A UFP-30-E-5A UFP-50-C-5A UFP-50-E-5A UFP-100-C-5A UFP-100-E-5A UFP-300-C-5A UFP-300-E-5A UFP-500-C-5A UFP-500-E-5A UFP-750-E-5A UFP-1-C UFP-3-C-6A UFP-5-C-6A UFP-5-E-6A UFP-10-C-6A UFP-10-E-6A UFP-30-C-6A UFP-30-E-6A UFP-50-C-6A UFP-50-E-6A UFP-100-C-6A UFP-100-E-6A UFP-300-C-6A UFP-300-E-6A UFP-500-C-6A UFP-500-E-6A UFP-750-E-6A UFP-3-C-8A UFP-10-C-8A UFP-30-C-8A UFP-50-C-8A UFP-100-C-8A UFP-100-E-8A UFP-300-C-8A UFP-300-E-8A UFP-500-C-8A UFP-500-E-8A UFP-750-E-8A UFP-1-C UFP-3-C-9A UFP-5-C-9A UFP-10-C-9A UFP-10-E-9A UFP-30-C-9A UFP-30-E-9A UFP-50-C-9A UFP-50-E-9A UFP-100-C-9A UFP-100-E-9A UFP-300-C-9A UFP-300-E-9A UFP-500-C-9A UFP-500-E-9A UFP-750-E-9A Note: All pilot scale cartridges are autoclavable except those with 1000 NMWC ultrafiltration membranes

183 Process scale hollow fiber cartridges Process scale hollow fiber cartridges offered by GE Healthcare are provided in eight basic configurations covering a membrane area range of 0.92 to 28 m 2 (9.9 to 300 ft 2 ) depending on the fiber internal diameter. All of these process scale cartridges feature sanitary connections for both the feed/retentate and permeate ports. Use of this industry standard makes for easy connections to tanks, pumps, manifolds, and instrumentation. GE Healthcare GrandStand systems are cart-mounted units designed to accommodate the full range of ultrafiltration and microfiltration process scale cartridges offered by the company. The various GrandStand configurations are capable of concentration and/or diafiltration of solution volume ranging from 50 to 1000 L or more. 8 Ordering information for process scale microfiltration cartridges Model number Pore size (μm) Fiber ID (mm) Membrane area (m 2 ) (ft 2 ) Nominal flowpath length (cm) CFP-1-E-35A CFP-2-E-35A CFP-4-E-35A CFP-6-D-35A CFP-1-D-55A CFP-1-E CFP-1-E-55A CFP-2-E CFP-2-E-55A CFP-2-G CFP-4-E CFP-4-E-55A CFP-6-D-55A Filtration products Note: Process scale microfiltration cartridges with model numbers that end in A are autoclavable

184 Ordering information for process scale ultrafiltration cartridges 8 Filtration products Model number Pore size (NMWC) Fiber ID (mm) Membrane area (m 2 ) (ft 2 ) Nominal flowpath length (cm) UFP-3-C UFP-5-C UFP-5-E UFP-10-C UFP-10-E UFP-30-C UFP-30-E UFP-100-C UFP-100-E UFP-300-C UFP-500-E UFP-750-E UFP-3-C UFP-5-C UFP-5-E UFP-10-C UFP-10-E UFP-30-C UFP-30-E UFP-50-C UFP-50-E UFP-100-C UFP-100-E UFP-300-C UFP-300-E UFP-500-C UFP-500-E UFP-750-E UFP-3-C UFP-5-C UFP-10-C UFP-10-E UFP-30-C UFP-30-E UFP-50-E UFP-100-C UFP-100-E UFP-300-E UFP-500-C UFP-500-E UFP-750-E Note: Process scale ultrafiltration cartridges are not autoclavable; however, autoclavable versions of select housing sizes 35 and 55 are available on special order

185 MaxCell process scale hollow fiber cartridges MaxCell cartridges for high-volume, cross flow bioprocessing applications. Exceptional processing economies Streamlined design utilizes space very effectively MaxCell cartridges can be manifolded with spacing as close as 18 cm (7 in) on center for incorporation into a compact membrane separations system. System sizing can be accurately scaled from testing laboratory and pilot scale cartridges, such as MidGee and Xampler cartridges. In addition, MaxCell cartridges can be used in place of other manufacturer s cartridges. Ordering information for MaxCell process scale ultrafiltration cartridges Model number Pore size Fiber ID Membrane area Nominal flowpath (NMWC) (mm) (m 2 ) (ft 2 ) length (cm) UFP-10-C UFP-30-C UFP-3-C UFP-5-C UFP-5-E UFP-10-C UFP-10-E UFP-30-C UFP-30-E UFP-50-E UFP-100-C UFP-100-E UFP-300-C UFP-300-E UFP-500-C UFP-500-E UFP-750-E UFP-3-C UFP-5-E UFP-10-C UFP-10-E UFP-30-C UFP-30-E UFP-50-C UFP-50-E UFP-100-C UFP-100-E UFP-300-E UFP-500-C UFP-500-E UFP-750-E Filtration products 185

186 Ordering information for MaxCell process scale microfiltration cartridges Model number Pore size Fiber ID Membrane area Nominal flowpath (μm) (mm) (m 2 ) (ft 2 ) length (cm) CFP-1-E CFP-2-E CFP-4-E CFP-6-D CFP-1-E CFP-2-E CFP-4-E CFP-6-D CFP-1-E CFP-2-E Accessories for MaxCell process scale cartridges Model number Description RBMX-16PS-ST Straight adaptor for MaxCell cartridge, polysulfone KAMX-16PS Straight adaptor kit for MaxCell cartridge, polysulfone. Kit contains 2 RBMX-16PS-ST polysulfone straight adaptors, 2 polysulfone cartridge end nuts and 2 silicone O-rings KAMX-16EL-PS Elbow adaptor kit for MaxCell cartridge, polysulfone. Kit contains 2 RBMX-16PS-EL polysulfone elbow adaptors, 2 polysulfone cartridge end nuts, and 2 silicone O-rings CL16-LT 2-in TC toggle clamp, 304 SS KG16S 2-in TC silicone gasket, pack of K04ORS MaxCell O-ring set, 2 silicone O-rings SWR-MX01 MaxCell wrench set, standard SWR-MX02 MaxCell wrench set, applied torque MaxCell cartridge physical dimensions Technical specifications Housing Diameter Length Endfitting Permeate size (cm) (in) (cm) (in) connections connections * 15.5* 2 in sanitary 1.5 in sanitary * 24.6* 2 in sanitary 1.5 in sanitary * 47.3* 2 in sanitary 1.5 in sanitary *Add 4.25 in (10.8 cm) for straight adaptors (2) at retentate ends. Filtration products MaxCell cartridge membrane area as a function of housing size and lumen diameter Housing Membrane Fiber Membrane area size inner diameter (mm) (m 2 ) (ft 2 )

187 ProCell hollow fiber cartridges Ordering information ProCell ultrafiltration cartridges Model number Pore size Membrane fiber Membrane area (NMWC) ID (mm) (m 2 ) (ft 2 ) UFP-10-C UFP-500-E UFP-500-E ProCell microfiltration cartridges Model number Pore size Membrane fiber Membrane area (NMWC) ID (mm) (m 2 ) (ft 2 ) CFP-2-E ProCell hollow fiber cartridges of 15 cm (6 in) diameter are for large production scale processes and are installed inside sanitary stainless steel housings. Sanitary design for production scale applications Selection of UF/MF pore sizes and lumen diameters 316 L stainless steel housings Efficient processing of thousands of liters Compact design with low hold-up volume Multiple cartridges can be manifolded into compact production systems ProCell hollow fiber cartridges of 15 cm (6 in) diameter are for large production scale ultrafiltration and microfiltration. Containing up to 28 m 2 (300 ft 2 ) of membrane area in a single, compact module, these cartridges are well suited to a wide range of bioprocessing applications. ProCell cartridges are available in two path lengths and in a selection of ultrafiltration nominal molecular weight cut-offs and microfiltration pore sizes, as well as several membrane fiber inner diameters. ProCell stainless steel housings (one housing required per cartridge) Model number Description SS-152TC Housing assembly for ProCell 152M cartridges 316LSS with 2 each gaskets and 2 each clamps SS-154TC Housing assembly for ProCell 154M cartridges 316LSS with 2 each gaskets and 2 each clamps Accessories for ProCell process scale cartridges Model number Description KG12S 1.5 in TC gasket, silicone, pack of KG16S 2 in TC gasket, silicone, pack of KG48S 6 in TC [schedule 5 pipe] gasket, silicone, pack of CL in TC quick disconnect clamp, 304 SS CL16-LT 2 in TC quick disconnect clamp, 304 SS CL48 6 in TC [schedule 5 pipe] clamp, 304 SS K06ORS ProCell cartridge O-ring set, 2 silicone O-rings Technical specifications ProCell housing physical dimensions* Housing Diameter** Length** Endfitting Permeate size (cm) (in) (cm) (in) connections connections in TC 1.5 in TC in TC 1.5 in TC *Stainless steel housing dimensions. **Nominal, not for design purposes. 8 Filtration products 187

188 Steam-in-place hollow fiber cartridges Steam-in-place hollow fiber cartridges/housings (STM style) Strong polysulfone cartridge elements Leak-proof, sanitary closure Available in UF and MF pore sizes Polysulfone cartridge elements have the strength and integrity to withstand the rigors of steam-in-place operations. Cartridges slip into stainless steel housings for safety and containment. A double O-ring seal at the inlet and outlet of the cartridge element ensures leak-proof, sanitary closure within the housing. The element design allows quick yet thorough steam penetration of the membranes. Furthermore, all cartridge components are USP Class VI tested. Cartridges are available in both ultrafiltration (UF) and microfiltration (MF) pore sizes in a choice of cartridge lengths. STM cartridge ordering information STM ultrafiltration cartridges Model number Pore size Fiber ID Membrane area (NMWC) (mm) (m 2 ) (ft 2 ) UFP-30-E-35STM UFP-100-E-35STM UFP-500-E-55STM UFP-10-C-55STM UFP-30-C-55STM UFP-50-C-55STM UFP-100-C-55STM STM microfiltration cartridges Model number Pore size Fiber ID Membrane area (μm) (mm) (m 2 ) (ft 2 ) CFP-1-E-55STM CFP-2-E-55STM CFP-4-E-55STM Accessories for STM steam-in-place cartridges Model number Description KG4S 0.5 in TC gasket, silicone, pack of KG12S 1.5 in TC gasket, silicone, pack of KG24S 3 in TC [schedule 5 pipe] gasket, silicone, pack of CL4 0.5 in TC quick disconnect clamp, 304 SS CL in TC quick disconnect clamp, 304 SS CL24 3 in TC [schedule 5 pipe] clamp, 304 SS K02ORS STM O-ring set, silicone, pack of VPC4 0.5 in TC permeate-side condensate drain or vent valve, 316L SS 8 Filtration products Technical specifications Cartridge housing assembly All housing assemblies are of 316L stainless steel with sanitary construction. The O-ring material is silicone. The retentate and permeate ports are 1.5-in sanitary clamp configuration allowing for quick and easy connection to steam and process piping. In operation, the housing should be piped in a vertical orientation. It is recommended to steam the complete element and housing assembly for 30 minutes at 121 C to 123 C and at 1 barg (15 psig). Steam should be delivered to both sides of the membrane to ensure full steam penetration and to minimize the delta P across the membrane during the steam sterilization cycle. A 0.5-in sanitary clamp port is positioned on the low point of the housing shell to ensure complete removal of concentrate. GE Healthcare offers a complete SIP protocol. To ensure that the cycle will support the rigors of a full validation and maximize the cartridge lifetime, GE Healthcare strongly suggests that customers adhere to all recommendations of the SIP protocol

189 Normal flow filtration ULTA Pure SG ULTA Pure SG filters have low chemical and protein binding characteristics, which result in minimal levels of material lost to adsorption. They can handle a wide range of liquids across the full ph range including many organic solvents. The filter cartridges have low extractable levels. The membrane is inherently hydrophilic and the filters can be easily and repeatedly integrity tested. ULTA Pure SG filters feature: 0.2 micron polyethersulphone membrane Microbially retentive and conforming to ASTM F methodology High throughputs and flow rates Low adsorption of chemicals and proteins Wide range of chemical compatibility Inherently hydrophilic membrane Technical specifications ULTA Pure SG utilizes the properties of a patented microbially retentive polyethersulphone membrane to provide sterilizing grade filtration to meet the specific needs of the pharmaceutical industry. ULTA Pure SG membranes have an asymmetrical pore structure with a high voids volume, which offers high dirt holding capacity, resulting in higher throughputs and higher flow rates than symmetrical membranes. Filtration area 2 in Capsule 0.05 m 2 (0.6 ft 2 ) Recommended operating conditions 4 in Capsule 0.11 m 2 (1.2 ft 2 ). Capsules may be operated up to a temperature of 40 C (104 F) at line pressures up to 5.0 bar (72 psig) for liquids and 4.0 bar (58 psi) in air/gas. Materials of construction Filtration membrane Polyethersulfone Upstream support Polyester Downstream support Polyester Inner core Polypropylene Sleeve Polypropylene Endcaps (cartridge) Nylon Endcap insert 316 stainless steel Small capsule body (2, 4, 6 in) Nylon Full size capsule body (5, 10, 20, 30 in) Polypropylene Capsule vent seals Silicone Cartridge o-rings (full size) Silicone or EPDM Literature ULTA Pure SG, Data file For ordering information, contact your local GE Healthcare sales representative. 8 Filtration products 189

190 ULTA Pure HC The inherent low protein binding properties of the HC membrane minimize product loss due to adsorption. The filters have low extractable levels and broad chemical compatibility. The membrane is inherently hydrophilic and the filters can be easily and repeatedly integrity tested. ULTA Pure HC features include: Optimized membrane configuration allows up to ten times the throughput to blockage Integral prefilter layer can condense filter trains for greater processing economy Sterility tested Low adsorption of proteins for minimal loss of expensive pharmaceutical product 8 Filtration products ULTA Pure HC capsules and cartridges have been specifically designed to extend the throughput of a traditional sterilizing grade filter through the incorporation of an integral PES pre-filter layer. The optimized ULTA Pure HC membrane configuration features a highly asymmetric membrane prefilter layer, which significantly extends throughput and prevents problems associated with premature filter blockage with complex solutions. The integral prefilter layer can also result in compression of filter trains for greater economy on a wide variety of intermediate and final sterilizing applications. ULTA Pure HC cartridge filters are high capacity and fast flowing. Technical specifications Filtration area Recommended operating conditions Materials of construction Filtration membrane Prefiltration membrane Upstream support Downstream support Inner core Sleeve Small capsule body (2, 4, 6 in) Large capsule body (5, 10, 20, 30 in) Capsule vent seals Cartridge end caps Cartridge end cap insert Cartridge 0-rings (full size) Literature 0.54 m 2 (5.8 ft 2 ) per 250 mm (10 in) module. Up to 70 C (158 F) continuous operating temperature and higher short-term temperatures during CIP. Polyethersulfone Polyethersulfone Polyester Polyester Polypropylene Polypropylene Nylon Polypropylene Silicone Nylon 316 stainless steel Silicone or EPDM ULTA Pure HC, Data file For ordering information, contact your local GE Healthcare sales representative

191 ULTA Prime CG The cartridges give an LRV > 5 when challenged with Brevundimonas diminuta in accordance with methods specified in ASTM F (10 7 organisms/cm 2 minimum). Pleated polyethersulfone (PES) membranes combined with thermal-bonded construction in both capsule and cartridge formats ensure low extractables and quick flushup devices. All products are 100% integrity tested before release and are shipped with a certificate of quality. Filters are flushed with pharmaceutical-grade purified water prior to packaging. Liquid column guard filters for reducing bioburden and prefiltering upstream solutions. Can be repeatedly steam sterilized in situ, autoclaved at up to 130 C, or sanitized with hot water at up to 90 C Compatible with a wide range of chemicals Materials conform to the relevant biological safety requirements of 21 CFR Part 177 and current USP Plastics Class VI C and ISO10993 equivalents Meet current USP quality standards for oxidizable substances Aqueous extracts from ULTA Prime CG contain < EU/mL when tested in accordance with the standard (LAL) test for endotoxins Effluent quality conforms to the requirements of USP 28<643> (TOC) and USP 28<645> (conductivity) Full pharmaceutical validation guide available on request ULTA Prime CG filter cartridges and capsules are specifically designed for bioburden control and particle retention in a variety of ph ranges and feed streams. They can act immediately before chromatography columns and prefilter solutions upstream of the sterilizing grade filter. For general bioburden control, they give log reduction of bacteria when sterility is not required. Technical specifications Filtration area 0.54 m 2 (5.8 ft 2 ) per 250 mm (10 in) module. Recommended operating conditions Up to 70 C (158 F) continuous operating temperature and higher short-term temperatures during CIP. Materials of construction Filtration membrane Polyethersulfone Prefilter membrane Polyester Upstream support Polyester Downstream support Polyester Inner core Polypropylene Sleeve Polypropylene Endcaps (cartridge) Nylon Endcap insert 316 stainless steel Small capsule body (2, 4, 6 in) Nylon Full size capsule body (5, 10, 20, 30 in) Polypropylene Capsule vent seals Silicone Cartridge o-rings (full size) Silicone or EPDM Literature ULTA Prime CG, Data file ULTA Prime CG capsule and cartridge pleated filters, Validation guide For ordering information, contact your local GE Healthcare sales representative. 8 Filtration products 191

192 ULTA Prime GF ULTA Prime GF cartridges utilize a glass microfiber filter medium encased within an upstream polypropylene mesh and a downstream non-woven filter support material. ULTA Prime GF filter cartridges are dimensionally stable with no media migration. The pleat pack is supported by an inner polypropylene core and outer polypropylene cage, heatbonded to polypropylene end caps. The hydrophilic nature of ULTA Prime GF filter cartridges also makes them suitable for gravity-fed systems. Retention characteristics have been determined through controlled laboratory tests challenging with a standard aqueous suspension of ACFTD (AC Fine Test Dust) using online laser particle counters. 8 Filtration products Liquid filter cartridges for clarifying, stabilizing and reducing bioburden in aqueous solutions, media and biologicals. High dirt-holding capacity and exceptional flow performance compared with polypropylene filters Compatible with a wide range of chemicals Cartridges can be repeatedly steam sterilized in situ, autoclaved at up to 121 C, or sanitized with hot water at up to 90 C. Capsules can be repeatedly autoclaved up to 121 C Materials conform to the relevant biological safety requirements of 21 CFR Part 177 current USP Plastics Class VI 121 C and ISO10993 equivalents. (Low concentrations of surfactant maybe present) Full pharmaceutical validation guide available on request. Technical specifications Filtration area Up to 0.6m 2 (6.3ft 2 ) per 250 mm (10 in) module. Recommended operating conditions Recommended operating conditions Up to 70 C (158 F) continuous operating temperature and higher short-term temperatures during CIP. Capsules may be operated up to a temperature of 40 C (104 F) at line pressures up to 5.0 barg (72 psi) for liquids and 4.0 bar (58 psi) in air/gas. Materials of construction Filtration membrane Borosilicate glass microfiber Upstream support Polypropylene Downstream support Polypropylene Inner core Polypropylene Sleeve Polypropylene Endcaps (cartridge) Polypropylene Endcap insert 316 stainless steel Capsule body Polypropylene Capsule vent seals Silicone Cartridge o-rings (full size) Silicone or EPDM Literature ULTA Prime GF, Data file ULTA Prime GF capsule and cartridge filters, Validation guide For ordering information, contact your local GE Healthcare sales representative

193 ULTA Prime PP The all-polypropylene construction of ULTA Prime PP cartridges ensures a wide range of chemical compatibility and makes them particularly suitable for filtering viscous and aggressive and chemicals and solvents. Cartridges do not hydrolyze in aggressive solutions and thus do not contaminate process fluids. Filter media of continuously-graded fiber density provide progressively finer particulate retention throughout the depth of the media. This, combined with optimized media pleating density, gives ULTA Prime PP cartridges exceptional lifetime performance. Retention characteristics have been determined by a single-pass technique using suspensions of ISO Part 1 A2 Fine and A4 Coarse test dust in water. Liquid filter cartridges for clarifying and prefiltering in biopharmaceutical and ultra-pure applications. Cartridges can be repeatedly steam sterilized in situ, autoclaved at up to 135 C, or sanitized with hot water at up to 90 C. Capsules can be repeatedly autoclaved up to 135 C Compatible with a wide range of chemicals Materials conform to the relevant biological safety requirements of 21 CFR Part 177 and current USP Plastics Class VI C and ISO10993 equivalents Full pharmaceutical validation guide available on request Technical specifications Filtration area Up to 0.6m 2 (6.3ft 2 ) per 250 mm (10 in) module. Recommended operating conditions Recommended operating conditions Up to 70 C (158 F) continuous operating temperature and higher short-term temperatures during CIP. Capsules may be operated up to a temperature of 40 C (104 F) at line pressures up to 5.0 barg (72 psi) for liquids and 4.0 bar (58 psi) in air/gas. Materials of construction Filtration membrane Polypropylene Upstream support Polypropylene Downstream support Polypropylene Inner core Polypropylene Sleeve Polypropylene Endcaps (cartridge) Polypropylene Endcap insert 316 stainless steel Capsule body Polypropylene Capsule vent seals Silicone Cartridge o-rings (full size) Silicone or EPDM Literature ULTA Prime PP, Data file ULTA Prime PP capsule and cartridge filters, Validation guide For ordering information, contact your local GE Healthcare sales representative. 8 Filtration products 193

194 Filtration hardware ÄKTAcrossflow system UNICORN control software means one common control platform and user-interface for all scales of operation in filtration and chromatography. Scouting gives automatic support to process development and optimization. Method wizards and pre-programmed cleaning methods provide a high degree of efficiency. UNICORN is compatible with all applicable regulations, including 21 CFR Part 11. The system is for use with flat sheet cassettes and hollow fibers. A wide range of cross flow devices include MidGee hollow fiber cross flow cartridges and Kvick Start flat sheet cassettes. The cassettes require small working volumes and are well-suited for ultrafiltration and diafiltration process development. The cassettes have a surface are of 50 cm 2 and can be combined for a total surface area of 150 cm 2. 8 Filtration products Automated cross flow filtration for process development. Broad range of applications that cover ultrafiltration and microfiltration Flexible operation of either hollow fiber cartridges or cross flow cassettes Thorough and efficient process development with full TMP and flux scouting Single familiar UNICORN interface for both chromatography and membrane separations No disruption to proteins or cells with low shear force pumps that require no cooling Minimum working volume of 25 ml ensures operation of complete processes using filters between 40 cm 2 and 150 cm 2 Supported with hardware product documentation to simplify validation Well-suited for small scale processing of material for protein or clinical studies Membrane separations are normally used to concentrate and wash feed prior to chromatography. ÄKTAcrossflow is a fully-automated system for cross flow filtration (ultrafiltration/diafiltration and cell separation) during process development and optimization. The benchtop system is compact and has a sanitary design with changeable wetted parts. It can be installed in a laboratory, which reduces facility and infrastructure expenditure. Ordering information Product Quantity ÄKTAcrossflow Technical specifications Operating range Feed flow rate ml/min Transfer flow rate ml/min Permeate flow rate ml/min Max. system pressure 5.2 bar (75.4 psi) Min. recirculation volume less than 25 ml (excluding cartridge) Detection and control Pressure transducers Less than ± 0.01 bar (0.15 psi) TMP control accuracy Less than ± 0.05 bar (0.73 psi) Literature Data file ÄKTAcrossflow systems

195 UniFlux systems The UniFlux series is a line of cross flow filtration (CFF) systems that utilizes UNICORN software for full automation with data logging capabilites over the entire cross flow process. The systems are intended for pilot through production scale biological separations. They are available in four sizes and are capable of processing batches of 1 to L of feed material. The systems are configured to operate hollow fiber cartridges suited for microfiltration applications such as cell clarification/ harvesting, or cassettes/hollow fibers for ultrafiltration applications, such as protein concentration and diafiltration in downstream unit operations. UniFlux systems offer: Flexible operation with either hollow fiber or cross flow cassettes A broad range of applications covering both ultrafiltration and microfiltration Single, familiar UNICORN interface for both chromatography and filtration Reduced need for manual controls Extensive real time data logging and reporting function Typical applications Monoclonal antibody clarification/concentration Recombinant protein concentration Vaccine concentration/purification Plasma purification/concentration Cell harvesting/clarification System design UniFlux systems are designed to allow linear scalability for both hollow fiber and cassette filters, and for system sizes varying from lab to manufacturing scale. Zero dead-leg drain valves eliminate dead spaces during processing and cleaning. Low working/hold-up volumes ensure higher concentration factor capabilities, along with maximal recovered product. In addition, over-pressure monitoring protects membranes and hardware during operation. The standardized UniFlux design allows for short delivery lead times as well as simple and rapid upgrade possibilities. The system utilizes castors, which allow easy movement and passage through standard doorways. System components The UniFlux systems offer a flexible, configurable design. System components include: Positive displacement type pump for low shear, negligible heat generation, and reliable operation. For the UniFlux 10 system, a diaphragm pump is supplied; for larger systems, a rotary lobe pump is provided. Automatic, sanitary diaphragm valves with position switches Pressure sensors on feed, retentate, and permeate Temperature sensor on retentate Magnetic flowmeter on feed Mass flowmeter on permeate line for UniFlux 30, 120, and 400 systems. Magnetic flowmeter on permeate line of the UniFlux 10 system. Hydraulic unit to compress cassette for UniFlux 30, 120 and 400 systems. For enhanced safety the hydraulic pressure and generated force are monitored in UNICORN. Zero dead leg piping in 316L stainless steel Wetted surface finish Ra: System < 0.6 μm casette holder < 0.8 μm Integrated tanks CFF processes require a tank to feed the filter and to collect retentate. The tank is normally an integral part of the system and plays a major role in mixing, measurements, and minimizing recirculation volume. When running automated CFF, a tank needs to communicate with system control in order to enable a fully automated process. GE Healthcare offers a series of tanks that communicate with UNICORN, allowing fully automated control of the tank sensors and mixer. Weight and volume in the tank are also monitored via UNICORN, allowing for control of concentration or diafiltration. 8 Filtration products 195

196 Ordering information UniFlux systems, tanks, and accessories can be ordered through GE Healthcare s online configurator. For assistance in placing your order, please contact your local GE Healthcare representative. System performance UniFlux 10 UniFlux 30 UniFlux 120 UniFlux 400 Hollow fiber membranes Number of cartridges up to 4 1 Min/Max area (ft 2 ) 1.3/ / / /560 Min/Max area (m 2 ) 0.12/ /6 1.8/12 10/52 Cartridge size 5 or 6 35, 55, or 75 35, 55, or 75 45, 65, or 85 Lumen diameter Consult your GE Healthcare representative for application specific information. 1 Number of cartridges possible to run in the system will be application dependent. Consult your GE Healthcare representative for further information. Cassette filters Number cassette holders Min/Max cassettes 1/5 Kvick Lab 1/10 Kvick Flow 2/20 Kvick Flow 6/60 Kvick Flow Min/Max area (ft 2 ) 1.2/6 5/50 10/100 30/300 Min/Max area (m 2 ) 0.11/ / / /27.6 System specifications Max recirculation flow rate 10 4 bar 60 4 bar bar bar Min recirculation flow rate bar 3 4 bar 12 4 bar 40 4 bar Feed connection 1/2 in (TC25) 1 in (TC50) 1 ½ in (TC50) 3 in (TC91) Retentate connection 1/2 in (TC25) 1 in (TC50) 1 ½ in (TC50) 2 in (TC64) Permeate connection 3/8 in (TC25) 1/2 in (TC25) 3/4 in (TC25) 1 in (TC50) Feed tank capacity (L) 5 or or , 250, or System hold up volume (L) System dimensions (W L H, mm) Cassette membrane cart dimensions (W L H, mm) N/A N/A N/A Hollow fiber cart dimensions (W L H, mm) N/A N/A N/A The tank is included in the system hold up volume as tank is mounted on the UniFlux 10 system skid. 8 Filtration products Tank specifications Tank size Working volume (L) Total volume (L) Tank skid dimensions (W L H, mm) System compatibility UniFlux 30 UniFlux 30 or 120 UniFlux 120 UniFlux 120 or 400 Minimum working volume tank 3 (L) For total minimum working volume add the hold up volume for the UniFlux system. Utility requirements Compressed air 6 10 Barg ( psig). Dry particle free, non-condensing Power requirements Pump, hydraulic unit: UniFlux 30, 120, Phase, 400/480 VAC; 50/60 Hz; 10A to 30A UniFlux 10 1-Phase; 110/230 VAC; 50/60 Hz; 16/10A Control system hardware 1-Phase; 110/230 VAC; 50/60 Hz; 16A Note: Power to the tanks is supplied from the UniFlux system. Literature Data file UniFlux system

197 GrandStand pilot/process systems The GrandStand pilot/process system is a versatile, cartmounted system intended for pilot through production scale biological separations from 50 to L. It accommodates ultrafiltration and microfiltration hollow fiber cartridges. The GrandStand system is capable of concentration and/or diafiltration. Feature rich basic system The basic GrandStand system consists of a heavy-duty stainless steel frame, positive displacement rotary lobe pump for gentle recirculation of biological solutions, diaphragm type backpressure valve, sanitary inlet and outlet pressure gauges, and a cone bottom clean-inplace (CIP) tank. A programmable AC inverter features a multitude of functions including the ability to set the pump acceleration time as well as to monitor pump speed. A high-pressure switch is incorporated for equipment and operator safety. Robust streamlined design The GrandStand system s narrow profile allows it to fit through standard door openings for easy transport from the lab to the cold room to the manufacturing area. Heavy-duty swivel casters with a total locking feature provide mobility and stability. The system is designed to interchange easily between process and cleaning cycles. The modular design enhances the versatility of the GrandStand system to address changing needs associated with scale-up and sophistication from pilot to process scale. Modular kits enhance the flexibility of the GrandStand systems to meet the needs of process development and process manufacturing groups without the delivery issues associated with custom systems. Simply purchase the base system and the modules needed for your specific application. The system and selected modules ship together with easy instructions to assemble them on site. A service option is available for on site assembly combined with IQ/OQ. For those with changing requirements, simply select the modules that provide the necessary system upgrade thereby eliminating the need to purchase a completely new system. Available modules facilitate customization for: Varying process volumes Data acquisition Flow rate Pressure Temperature Conductivity UV Permeate flow control Steam-in-place (SIP) GrandStand system specifications Base system GrandStand 450 GrandStand 550 Weight (approximate) 1576 lb (715 kg) 1876 lb (851 kg) Materials of construction: Frame 304 stainless steel 304 stainless steel Fluid path 316 L stainless steel 316 L stainless steel Fluid path surface finish < 20 Ra μ in (0.5 Ra μm) < 20 Ra μ in (0.5 Ra μm) CIP tank 15 gal. Polypropylene 30 gal. Polypropylene Pump type Rotary lobe Rotary lobe Max Pump Flow rate 120 L/min@ 30 psig 400 L/min@ 30 psig O-rings, gaskets, valve diaphragms EPDM EPDM Power requirements 230/460 vac 3 Phase 50/60 Hz (except 380 vac 3 Phase 50/60 Hz for GSMRLP450380V and GSM550380V) System dead volume* 9.5 L 18.9 L *Approximate base system without tank or filter cartridge Note: To determine minimum working volume, add volume of filter holder, tank working volume to system dead volume. 8 Filtration products 197

198 Ordering information Code Number Catalog Number Description Base System GSMRLP550SYS 4 GrandStand 550 Modular System GSMRLP450SYS 4 GrandStand 450 Modular System GSMRLP550380V 4 GrandStand 550 Mod Sys 380VAC GSMRLP450380V 4 GrandStand 450 Mod Sys 380VAC GSMRLP550440V 4 GrandStand 550 Mod Sys 440VAC GSMRLP450440V 4 GrandStand 450 Mod Sys 440VAC Filter Modules GSM550HF4KIT GS 550 HF 4 Position Exp. Kit Data Acquisition GSMDAQENCLKIT 1 GrandStand PLC Enclosure GSMDAQPRESTRA psig Pressure Transmitter GSMDAQTEMPKIT Temperature Transmitter GSMDAQMFM550 GS 550 Magnetic Flow Meter GSMDAQMFM450 GS 450 Magnetic Flow Meter GSMDAQUV1KIT 280 μm UVSensor With Display GSMDAQCONTRA Conductivity Sensor With Display SIP Modules GSMSIPCMPKIT GS HF SIP Manifold Kit SS-35STM 3 Housing assembly for-35stm cartridges SS-55STM 3 Housing assembly for-55stm cartridges SS-35SMO-DP 3 Housing assembly for-35smo cartridges SS-55SMO-DP 3 Housing assembly for-55smo cartridges SS-45MSM-DP 3 Housing assembly for-45msm cartridges SS-65MSM-DP 3 Housing assembly for-65msm cartridges SS-85MSM-DP 3 Housing assembly for-85msm cartridges SS-85MSM-EL-DP 3 Housing assembly for-85msm cartridges Permeate Pump GSM450PERPRP GS 450 Permeate Pump Kit GSM550PERPRP GS 550 Permeate Pump Kit GSM550PERPRH GS 550 Add on Permeate Pump Head Service GrandStand Module Assembly to System and IQ/OQ 8 1 GSMDAQENCLKIT is required to power any data acquisition module that is purchased. 2 Assembly of module kits is not available without IQ/OQ service. 3 Items are not included in modular accessory kits and must be purchased separately. 4 Includes one set of documentation. Additional set of documents can be supplied at an aditional cost. Filtration products 198

199 Customized filtration hardware GE Healthcare provides a wide range of customized solutions for your filtration needs. UniFlux systems can be customized to operate with hollow-fiber cartridges or cassettes/hollow fibers. In addition, integrated tanks can be customized (with valves, sensors, mixers, cooling jackets, hoses) to fit particular filtration needs. The flexible UNICORN control system can also be customized to match any desired hardware modifications. To explore the possible customized filtration possibilities, please contact your local GE Healthcare representative. 8 Filtration products 199

200 9Protein interaction and stability analysis Biacore systems 202 MicroCal systems

201 Protein interaction and stability analysis

202 Biacore systems Protein interaction and stability analysis Biacore systems characterize molecules in terms of their: specificity and selectivity of interaction on and off rates (kinetics) binding strength (affinity) Biacore systems allow for rapid, label-free interaction analyses, giving deeper insights into the interactions of proteins with other molecules, and leading to better decision making and increased productivity. The wealth of information provided by Biacore systems binding kinetics, affinity, specificity, selectivity, and concentration measurement is invaluable across many applications such as unraveling molecular mechanisms, fragment screening, vaccine research, antibody characterization, immunogenicity testing, process development, and quality control. The systems also provide sensitive binding activity measurements. This is based on the ability of the biomolecule of interest to interact with a specific binding partner, and may therefore be more informative than generic measurement techniques (e.g., total protein concentration). For more information, please visit:

203 Biacore T200 Work in GxP-regulated environments An optional GxP package allows Biacore T200 to integrate seamlessly into GxP-regulated workflows. The package provides software supporting GLP/GCP/GMP and 21 CFR Part 11 compliance, and includes validation support. For full validation support during the lifetime of the system, the package can be supplemented with GE Healthcare Validation GxP service agreements. Technical specifications Productive research and development Biacore T200 offers a versatile, multi-application solution for detailed studies of biomolecular interactions in real time with exceptional sensitivity. Wizard-supported software for assay development, analysis, data evaluation and interpretation makes the system straightforward to use. Applications, such as antibody characterization, which could take a week by conventional methods, can be completed in days. The performance and versatility of Biacore T200 system allows users to: Perform time-and cost-efficient concentration analyses in vaccine development Select and characterize antibodies as research tools, assay components or therapeutics by fully defining their interaction behavior (e.g., on/off rates) Define potential drug targets and diagnostic markers Detect and characterize immune responses (e.g., anti-drug antibodies) during preclinical and clinical development Increase understanding of molecular mechanisms and structure-function relationships Select and optimize lead compounds during drug discovery Detection technology Surface Plasmon Resonance (SPR) biosensor Information provided Kinetic and affinity data (KD, ka, kd), specificity, selectivity, concentration, and thermodynamics data Data presentation Result tables, result plots and real time monitoring of sensorgrams Analysis time per cycle Typically 2 15 min Automation 48 h unattended operation Sample type Low MW drug candidates to high molecular weight proteins (also DNA, RNA, polysaccharides, lipids, cells and viruses), in various sample environments (e.g., in DMSO-containing buffers, plasma, serum Required sample volume Injection volume µl (application dependent) Injection volume µl Flow rate range From µl/min Flow cell volume 0.06 µl Flow cell height 40 µm Sample/reagent capacity 1 96, or 384 well microplate + up to 33 reagent vials Analysis temperature range 4 C to 45 C (maximum 20 C below ambient temperature) Sample storage 4 C to 45 C (maximum 15 C below ambient temperature) Sample refractive index range Buffer selector Automatic switching between 4 buffers Inline reference subtraction Automatic Literature Brochure: Biacore T Data file: Biacore T Data file: Biacore T200 GxP Package Data file: Biacore T200 Upgrade Kit White Paper: Outstanding sensitivity for confident label-free interaction analysis Protein interaction and stability analysis

204 Biacore C Validation support Biacore C is fully supported with validation services, including Installation and Operational qualification (IQ/ OQ) documentation upon system delivery and on-site IQ/ OQ performance by a certified GE Healthcare engineer. To maintain the system in a validated state, a maintenance requalification service is also included. Technical specifications Protein interaction and stability analysis 9 Biacore C is an automated Surface Plasma Resonance (SPR) system specifically designed for concentration determination of biopharmaceuticals in GLP/GMP applications. Increasing speed and quality of concentration analysis, while meeting stringent regulations is essential for ensuring success in drug development and manufacturing quality control (QC). Biacore C has user-friendly software and advanced instrumentation, which provide comprehensive assay control, high quality data, and high reproducibility with minimal sample usage, thereby increasing efficiency and saving costs. Key applications areas are: Manufacturing QC and IPC (In-Process Control) Release assays System design and evaluation support Biacore C Control Software is designed to support the GLP/GMP regulated working processes with built-in validation features for compliance with worldwide regulations. Assay development, concentration analysis and evaluation of test data are straightforward with the user-friendly Wizard based software. Detection technology Surface Plasmon Resonance (SPR) Data presentation Result tables, plots, and real-time monitoring Automation Unattended working capacity for 2 96 well microtiter plates (automatic control of sample handling and injection) Flow rate range µl/min in steps of 1 µl/min Flow rate precision Typically < 1% Injection volume µl Analysis temperature 25 C ± 0.1 C Power requirements Autorange VAC, Hz Power consumption Max 400 VA Literature Data file Biacore C For more information, please visit:

205 Biacore system validation support Laboratories involved in pharmaceutical drug development and manufacturing must satisfy the GxP (GLP, GCP, GMP) regulations. Computer-controlled analytical systems used in GxP applications must be validated and properly maintained. Failure to comply with regulatory demands is not a viable option from either a safety or economic standpoint. Validation is the process of establishing documented evidence of control and is absolutely necessary for gaining product approval. Computer system validation ensures that: Hardware and software function as designed The process is controlled at all stages Data are processed as intended Validation lifecycle model A validation life cycle model is applied to keep a system in a validated state during the entire product life cycle. User Requirements Functional Requirements Detailed Design Develop System Installation Qualification Operational Qualification Performance Qualification The validation life cycle ensures adequate validation of computerized systems. GE Healthcare offers a range of products and services to help customers meet the current regulatory requirements: 21 CFR Part 11 compliance Equipment qualification Change Control Notifications (CNN) Security of electronic records For systems used in regulated applications, Biacore T200 GxP Package facilitates compliance with worldwide regulatory expectations by ensuring GxP support and 21 CFR Part 11 compliance. For Biacore C, this support is included in the standard system. Protecting the security and integrity of electronic records (ER) is essential for compliance. This includes ensuring the reliability of ER used to support critical decisions. Key issues in complying with 21 CFR Part 11 are: System validation support Accurate, complete copies Protection of records Limiting system access Audit trails Authority checks The software has been developed in accordance with an accepted development model to ensure adequate validation support. Validation support with Biacore GxP services Equipment Qualification is the overall process of ensuring that a system performs according to specifications agreed by the user and vendor. Biacore systems are supported by Equipment Qualification meeting worldwide regulatory requirements. Biacore GxP Services include: Instrument qualification (IQ/OQ/IPQ) Requalifications (RQ) Change Control Procedures (CCP) Equipment qualification is performed by qualified GxPtrained personnel when the system is installed in its selected operating environment. In addition, to keeping the system in a validated state, a requalification (RQ) is also provided. This supports the ongoing qualification process and ensures correct function and maintenance throughout the system's lifetime. Change Control Notification CCN is a free-of-charge, web based service offering customers notifications about changes in certain GE Healthcare products that may impact customer processes and products. It provides a basis for customer evaluation and control of changes. For Biacore systems, the service is available for: Biacore instruments and software Biacore consumables Literature Data file For more information, please visit: Biacore T200 GxP Package Biacore C Protein interaction and stability analysis

206 MicroCal systems Ultrasensitive microcalorimetry provides fundamental information on thermodynamics in biomolecular interaction and stability analyses. This information helps scientists understand how biomolecules function, and why there are stable. Calorimetry data can be used to design new drugs, or to engineer proteins of higher stability or modified function. MicroCal Isothermal Titration Calorimetry (ITC) and Differential Scanning Calorimetry (DSC) instruments are designed and optimized for analysis of biomolecules in solution and are widely used at major pharmaceutical, biotech, academic and government institutions worldwide. For more information, please visit: Protein interaction and stability analysis

207 MicroCal VP-Capillary DSC system Ordering information Product MicroCal VP-Capillary DSC MicroCal Manual Capillary DSC MicroCal VP-Capillary DSC Software 2.0 Upgrade Capillary DSC system automation upgrade Technical specifications Short-term noise (RMS average) 0.05 μcal/ C* Baseline repeatability 1.5 μcal/ C Experimental temperature range -10 C to 130 C A new level of productivity for stability studies Differential scanning calorimetry (DSC) is a powerful analytical tool for characterizing the stability of proteins and other biomolecules. DSC directly measures the enthalpy (ΔH) and temperature (T m ) of thermally induced structural transitions in solution. This information gives valuable insights into factors that stabilize or destabilize proteins, and other macromolecular systems, alone or as complexes. This information can be used to predict shelf lives, develop purification strategies, screen formulation conditions and characterize protein constructs. MicroCal VP-Capillary DSC System provides high throughput and sensitivity in an automated, integrated platform. The software streamlines the workflow with simplified experiment setup and flexible instrument scheduling and reduces the data analysis bottleneck with automated data analysis and improved data sorting. The automated data analysis features can reduce data analysis of a typical experiment from days to hours. All the features in MicroCal VP-Capillary DSC - automation, high sensitivity, minimal assay development time, and automated data analysis capabilities result in highly reproducible results, as well as confident conclusions and decision making. Maximum scan rate Response time User selectable response times (3) 240 C/h 5 s Sample volume 370 µl Typical sample concentration Cell design Cell to cell heat compensation Throughput Sample capacity High gain, low gain, and passive 0.1 to 2.0 mg/ml Tantalum 130 μl, capillary type, fixed-in-place, non-removable Power feedback Up to 50 samples/24 h Six 96-well plates Sample compartment, temperature control 4 C to 70 C Self-contained pressuring system 0 to 45 psi Weight 25 kg Dimensions (W H D) cm * Using upscan mode at 200 C/h with 10 s filter and over a temperature range of 10 C to 110 C, in passive mode. Average standard deviation between successive upscans at 90 C/hr with 30 s data point filter over the temperature range 5 C to 110 C. Using upscan mode at 60 C/h. When using upscan mode at 200 C/h, the upper temperature limit is 115 C. High feedback Literature MicroCal VP-Capillary DSC system, Data file MicroCal DSC, Brochure Protein interaction and stability analysis

208 10 Oligonucleotide synthesis Synthesizers 211 Columns 213 Solid supports

209 Oligonucleotide synthesis

210 Oligonucleotide synthesis Oligonucleotides are a major tool in drug discovery and diagnostic chip technology. They are used in initial research and screening through to target validation and drug production. Developers of oligonucleotide-based drugs have a clear need for regulatory compliant material to use in pre/early-phase clinical trials. Similarly, companies involved in molecular diagnostics need cost-effective oligonucleotidebased probes to include in commercial kits. Oligonuleotides synthesized on our instruments and supports are currently in several clinical trials. All our synthesizers are based on flowthrough column technology. This gives cost-efficient synthesis, creates less waste and allows simple scale-up. It also permits exact control of flow rate and thus fine control of reactions. All systems are compatible with most synthesis chemistries used today, including RNA synthesis. Recirculation of monomers over the column reactor is included. The common use of UNICORN control software means convenient scale-up from research to full production, and enables use of PAT (Process Analytical Technology) in combination with in-line monitors. System selection guide System ÄKTA oligopilot plus 10 ÄKTA oligopilot plus 100 OligoPilot 400 OligoProcess Nominal scale* 1 50 µmol 250 µmol 9 mmol 4 30 mmol , mmol (or higher) Oligonucleotide synthesis * All scale examples used Primer Support 5G loaded at 350 µmol/g, except the lower range in which custom Primer Support 40s was used with ÄKTA oligopilot plus 10. Longer oligos might require a lower loading and thus the corresponding scale is affected

211 Oligonucleotide synthesizers ÄKTA oligopilot plus ÄKTA oligopilot plus is a flexible, fully-automated DNA/RNA oligonucleotide synthesizer for use in research, process development and production. This compact, pump-driven system meets the needs of most synthesis chemistries thereby enabling cost-efficient, high-quality synthesis. ÄKTA oligopilot plus employs flow-through reactor technology and features column re-circulation, an important factor when performing RNA synthesis. It is available in two configurations: ÄKTA oligopilot plus 10 for synthesis in the 1 to 50 μmol range, and ÄKTA oligopilot plus 100 for the range 50 μmol to 9 mmol. The system is compatible with a range of column reactors, small scale cassettes and pre-packed disposable Oligosynt columns. For larger scale synthesis, the adjustable FineLINE 35 oligo column has been specifically developed to allow synthesis at scales from 250 μmol to 3.8 mmol. Adjustable Column 200 ml enables 9 mmol synthesis. ÄKTA oligopilot plus is controlled via an external computer using UNICORN software specially designed for production needs. OligoPilot 400 OligoPilot 400 is specifically developed for synthesizing oligonucleotides in quantities suitable for pre-clinical and early-phase clinical trials. The system uses flow-through column technology, UNICORN software and comes with the same level of technical support as ÄKTA oligopilot plus and OligoProcess Systems to allow seamless scale-up/scaledown. Synthesis scale range is from 4 to 30 mmol using column diameters of 70 and 100 mm. As much as 150 gram crude 20-mer oligo per run can be produced with the 100 mm column. The synthesizer is designed in an integrated manner with reagent bottles and column reactors forming a single unit in the system. The system reduces facility expenditure since it can be installed in a laboratory. The tilted bottle holder allows organized and cost-efficient use of amidite. A rotating column holder that simplifies unpacking of the columns is also included. Oligonucleotide synthesis 10 Ordering information Product ÄKTA oligopilot plus ÄKta oligopilot plus For larger OligoPilot 400 and OligoProcess systems, contact your local representative 211

212 OligoProcess OligoProcess systems are custom-designed for reliable and cost-effective industrial production. They use the same flow-through column technology as the other synthesizers. Production range is from 50 mmol to over 1 mol, or more, of therapeutic oligonucleotides. The systems are explosion-proof and constructed with industrial grade components that withstand harsh synthesis chemicals. UNICORN control allows rapid scale up of methods developed on OligoPilot 400. OligoProcess systems are installed and qualified for GMP production by GE Healthcare personnel. continuously replace those used. Smooth liquid distribution ensures that coupling efficiencies remain the same, even in different parts of the column. This continuous replacement of consumed reagents keeps the concentration constant throughout the zone. Both the amidite concentration and the reaction rate remain the same throughout the reaction. In a batch reactor, on the other hand, consumed reagents are not replaced. Amidite concentration (red zone in Figure below) decreases continuously, thus lowering the overall reaction rate. Flow-through technology gives high amidite concentration to available reaction sites regardless of whether they are situated on the periphery of the bead or situated in deep cavities, since overpressure is created within the column. Moreover, flow-through technology gives faster synthesis cycle time, which thus reduces overall production time. In addition, reagent consumption is lower for flow-through technology and therefore less waste is produced. Finally, flow-through technology in combination with high accuracy pumps allows for more exact control of reagent contact times implying low batch to batch variation. A) Flow-through reactor. The coupling mixture moves down as a reagent zone, continuously replacing reagents consumed by the reaction. The amidite concentration is the same at the end of the reaction as at the beginning. B) Batch reactor. Reagents consumed by the coupling reaction are not replaced. Amidite concentrations fall to low levels. Oligonucleotide synthesis 10 Flow-through technology The flow-through reactor is a feature common to ÄKTA oligopilot plus, OligoPilot 400 and OligoProcess synthesizers. It is more efficient than typical batch reactors found in other systems. The better efficiency of a flowthrough reactor is due to the way the coupling mixture behaves. The figure illustrates this behavior. Coupling mixture is added to the solid support as a reagent zone (shown in blue) and is pushed through the column as a well-defined zone. Reagents at the front of this zone are consumed by the coupling reaction at a continuous rate. As this zone moves down the reactor, new reagents The flow-through reactor (A) is more efficient than a batch reactor (B). At the end of the reaction, when one equivalent has been consumed, the active concentration of amidite in OligoPilot 400 for example, can be more than 6 times higher

213 Oligonucleotide synthesis columns The GE Healthcare range of oligonucleotide columns is manufactured to withstand the harsh organic conditions used in oligonucleotide synthesis. They are designed for use with ÄKTA oligopilot plus, OligoPilot 400 and OligoProcess systems and employ flow-through reactor technology. There are two ranges of medium pressure columns suitable for industrial oligonucleotide synthesis and production. At the lower end of the production scale, FineLINE steel columns have diameters of 35 (glass), 70, and 100 (steel) mm. For large-scale industrial production, BioProcess MPLC columns cover the range of diameters from 50 to 1200 mm. Contact your local GE Healthcare office for more information about large-scale industrial columns. Highlights of oligonucleotide columns: Solvent resistant Convenient packing of solid supports Stainless steel, fixed volume column reactors for use with ÄKTA oligopilot plus Variable bed heights Ordering information Product Scale* Stainless steel columns 1.2 ml 50 μmol ml 260 μmol ml 500 μmol ml 1 mmol ml 2 mmol Adjustable bed height columns FineLine 35 oligo ml mmol Adjustable column ml mmol * All scale examples used Prime Support 5G loaded at 350 μmol. Oligonucleotide synthesis

214 Solid supports Polystyrene-based supports have been produced by GE Healthcare since the mid-1980 s. They allow high scales of synthesis per reaction volume and are suitable for synthesis chemistries that are incompatible or ineffective with glass beads. These solid supports not only exceed what you can achieve with glass beads, they also enable the synthesis of substantially higher yields of pure full-length products and reduce reagent consumption. A significant cost reduction, in other words. Our supports are produced in large quantities and are available world-wide via our global distribution network. Primer Support 5G Oligonucleotide synthesis 10 Primer Support 5G is the fifth generation solid support for oligonucleotide synthesis from GE Healthcare Life Sciences. This high-loaded solid support is optimized for synthesis of DNA and RNA oligonucleotides up to 25 bases in length. The base particle, based on cross-linked polystyrene, delivers a number of benefits compared to previous generations of solid supports. Primer Support 5G is designed for synthesis of therapeutic oligonucleotides, by biopharmaceutical companies, with high yield and purity. High loading capacity For synthesis of DNA and RNA oligonucleotides of up to 25 bases, a nucleoside loading of 350 μmol/g for DNA and 300 μmol/g for RNA can be used without compromising yield or purity. Cost efficient synthesis With higher nucleoside loading, Primer Support 5G delivers major cost savings compared to previous generations of solid supports. Scalability Primer Support 5G meets industrial demands and offers excellent scalability, with synthesis of phophorothioate DNA oligonucleotides at scales from 100 μmol to 750 mmol. Regulatory support Essential information for the registration of materials used for oligonucleotide production in the form of confidential Regulatory Support Files

215 Oligosynt prepacked disposable columns Long oligonucleotides (30 to 90 or more bases) are used as probes in analytical or diagnostic methods for applications such as blood testing, gene expression studies and genetic profiling or identification. To ensure optimal purity and yield of long oligonucleotides, GE Healthcare provides Primer Support 200 loaded at nucleoside densities of 40 µmol/g. For convenience and ease of use, the solid support is prepacked in disposable Oligosynt columns that run on ÄKTA oligopilot instruments. Oligosynt combined with ÄKTA oligopilot is well-suited for GMP production of long oligonucleotides. High quality and yield of long oligonucleotides More than 50% pure full-length product*. Less than 4% (n-1) contamination*. More than 300 OD/µmol crude yield*. Convenience Columns are prepacked and disposable UNICORN method templates simplify operation. On-column cleavage possibility. Reproducibility and reliability Reproducible performance with each batch of prepacked columns. All batches of solid support certified for use in long oligonucleotide synthesis. Long oligonucleotide production Reagents and instrumentation from process development to production syntheses. Primer Support Regulatory Support Files available for product registration. IQ/OQ installation service available for ÄKTA oligopilot instruments. * Test 60mer sequence used: 5 ATACCGATTAAGCGAAGTTTATACCGATTAAGCGAAGTTTATACC GATTAAGCGAAGTTT Custom Primer Support GE Healthcare offers Custom Primer Support to meet your exact needs by coupling with Unylinker, linkers, labels, modified bases, alternative protecting groups, or almost any molecule of your choice. Primer Support 5G can be loaded at 20 to 400 μ mol/g and delivered in bulk or in prepacked, disposable Oligosynt columns. Primer Support 200 is also offered within the Custom Primer Support service. Note: Use of THF-based synthesis reagents from other vendors is NOT recommended for GE Healthcare synthesizers. They may cause irreparable instrument damage. For more information, please contact your local sales representative or go to Oligonucleotide synthesis

216 11 Service and support Service agreements 218 Smart Asset Management Services 219 Application services - Fast Trak 220 Validation Services 224 Online regulatory and technical support 226 System and column support 228 Security of supply 229 Literature

217 Service and support

218 Service agreements Life Sciences Services has over 50 years of experience as a provider of service solutions for the pharmaceutical and biotechnology industries. Maintaining complex instruments in prime condition is a science in itself - to optimize lifelong performance, we build serviceability into our equipment beginning at the R&D stage. Our service packages improve productivity and efficiency by optimizing the equipment maintenance, thereby minimizing downtime and repair costs. Service agreements offer the following benefits: Confidence in your results through regular PM visits Predictable ownership costs rates are guaranteed for the duration of the contract Minimal disruptions with priority response from our trained service engineers Timely access to secured, productspecific wear parts to maximize uptime Service agreements FullCare A full-coverage, comprehensive service agreement that includes one annual PM visit, all parts, and travel and labor costs. FullCare Plus A full-coverage, comprehensive service agreement that includes two annual PM visits, all parts, and travel and labor costs. ExtendedCare A 24-month, full-coverage service agreement that includes one PM visit, all parts, and travel and labor costs. ExtendedCare Plus A 24-month, full-coverage service agreement that includes two PM visits (a comprehensive PM visit in the first year and a basic PM visit in the second year), all parts, and travel and labor costs. EssentialCare An annual Preventive Maintenance visit. Service and support For more information, please visit

219 Smart Asset Management Services Over a period of 15 years, GE Healthcare has designed a business optimization process for asset management in both the laboratory and healthcare environments. Smart Asset Management Services (SAMS) was developed in response to the demands of a changing marketplace. SAMS is a modular, scalable service that enables consolidation of multivendor service support for lab assets, provides insights into asset utilization, and supports process optimization. Lab Optimization Solutions Lab Optimization Solutions support customers in the drive to asset management optimization by providing tools and analytics that enable smart decision-making, from service model optimization to CAPEX reduction via intelligent utilization. Lab asset management assessments Change management Process optimization Asset intelligence solutions For more information, please visit Multivendor Life Cycle Asset Management Life Cycle Asset Management goes beyond conventional maintenance for all lab equipment, regardless of manufacturer, by ensuring a predictable total cost of ownership per asset and providing powerful metrics and analytics, as well as an accurate evaluation of projected service costs and the level of service needed. Pre-purchase planning Install and move Asset management and Maintenance Redeployment and Disposition Partner Solutions Our goal is to help our customers businesses thrive and grow. By leveraging our wealth of experience, business acumen, technical expertise and best practices gleaned from the broad spectrum of GE industries and other collaborations, we are able to provide a solid foundation on which to build a dynamic, long-term relationship. Strategic partners GE Finance Solutions GE Energy & Water GE Fleet Services Service and support

220 Application services - Fast Trak Use our expertise to your advantage Fast Trak brings our extensive knowledge and experience in the upstream and downstream processing of biopharmaceuticals to your organization. Our global team of bioprocessing experts can support you in the optimization/ troubleshooting of existing unit operations or in the design of efficient and cost-effective processes that meet current regulatory demands and reduce time-to-market. The services can be run onsite at your facility or at our global Fast Trak Centers. Our Centers in Shanghai, Bangalore, Munich, and New Jersey supplement your own laboratory and pilot plant capabilities, featuring full process development capabilities. The foundation for our efficient support services is our highly qualified, highly motivated Fast Trak bioprocessing staff. Their expert knowledge, skills, experience, and commitment play a substantial role and are based on more than 50 years of company history in the processing of biomolecules. Our Fast Trak experts have university degrees in a relevant field and handson experience in biomanufacturing in a regulated environment. For further support, our team of Fast Trak experts has access to a strong network of other expert and support teams within the global GE Healthcare Life Sciences organization. Bioprocess development Reviewing and assessing existing protocols to help define critical parameters Offering resources for developing scalable up/downstream processes Redesigning and optimizing individual steps or entire processes Performing scale-up, scale-down, cleaning-in-place (CIP), and media lifetime studies Troubleshooting different unit operations Consulting Advising on regulatory trends and performing internal audits Improving workflows by Lean Six Sigma programs Service and support

221 Fast Trak training and education Now in its third decade, Fast Trak training and education continues to provide an exceptional learning experience for process development and manufacturing scientists, engineers, plant operators, and support staff. Fast Trak delivers hands-on training courses in all aspects of bioprocessing from cell culture and downstream process development to scale-up and manufacturing. The presentations and hands-on exercises allow participants to: Integrate theory and practice with a high ratio of instructors and instruments to trainees Understand the purification issues using automated systems for both chromatography and filtration Gain an awareness of the regulatory aspects in today s biotechnology processes Fully utilize the tools and principles of effective biomanufacturing Standard courses The two to five day standard courses consist of theoretical and practical exercises, designed to give you an optimal learning experience. These training courses are run at our Fast Trak Centers in Germany, India, China, Singapore, and New Jersey (USA). UNICORN ecourses are taken at your convenience from your computer. Custom courses Custom courses are developed specifically to suit your organization s particular needs. Custom training can be given at your facility or at a Fast Trak Center, allowing your company the flexibility to train complete teams. Training programs Training programs focused on your specific needs are developed in partnership with your company, taking into consideration all aspects of a biopharmaceutical s lifecycle. Strategic training programs support your company in times of growth or transition by bringing your staff up to speed in a minimal amount of time, with a maximal amount of expertise. Online training ease and flexibility UNICORN 6 ecourse (esys6) covers UNICORN 6 that supports the ÄKTA avant systems. Basic Training Course for UNICORN (esys1) covers UNICORN 3, 4 and 5 that support other ÄKTA systems. Interactive step-by-step tutorials guide you through different tasks Complete the training at your own pace over one year The courses are accessed via Fast Trak Education Gateway and do not require an ÄKTA system or UNICORN software Visit us on the web at Service and support

222 List of standard courses available worldwide Service and support Upstream processing Theory, Setup and Operation of Single-use WAVE Bioreactor (WAV1). A two day practical course providing theoretical and technical background knowledge as well as hands-on experience on the operation and optimal performance of the WAVE Bioreactor and related WAVE equipment. Advanced Bioreactor Cultivation Technology (CELL1). This three and a half day practical course provides in-depth training on cell culture technology, combining scientific background and handson experimentation for animal cell cultivation. Process development Introduction to Downstream Techniques and Bioprocessing (DEV1). A three or four day basic handson course on chromatographic techniques suitable for productionscale biomolecule purification. Downstream Bioprocess Development (DEV2). A five day hands-on course for people with basic experience who want to improve their knowledge in downstream process development. Bioprocess Scale-Up and Technology Transfer (DEV4). A three day handson course focused on designing and scaling up a laboratory scale process to production. Introduction to high-throughput process development - Workshop (HTPD1). This three day workshop, with practical exercises, focuses on process development and process optimization of chromatographic purification steps using HTPD. Single-Use Manufacturing Single-Use Manufacturing Technologies (SUM1). This training course focuses on the practical aspects of the application of disposable technology for process development and biomanufacturing. Monoclonal antibodies Downstream Bioprocessing of Monoclonal Antibodies (MAB1). A three and a half day practical course on the downstream processing of antibody molecules using chromatographic techniques. Membrane filtration Bioprocessing using Membrane Separations (MEM1). A two and a half day practical course on membrane separation techniques in downstream processing. Column packing Large-scale Column Packing (COL1). A three day practical course on packing, qualifying and maintaining production chromatography columns. UNICORN system control Advanced UNICORN System Control for Chromatography Systems (SYS2). A three day advanced course on conditional control programming to achieve optimal performance of the system, document and report results, as well as network considerations. UNICORN System Control for Automated Filtration Systems (SYS3). A two and a half day intensive course on system control with ÄKTAcrossflow systems. Validation Validation - Workshop (VWS1). A three day workshop where the latest regulatory issues associated with manufacturing a biopharmaceutical product and aspects of bioprocess validation will be presented and discussed

223 Fast Trak Centers Fast Trak, including training & education, process development, and consulting services are available from GE Healthcare throughout the world via our Fast Trak Centers. Fast Trak Center Europe GE Healthcare Europe GmbH Oskar-Schlemmer-Strasse München, Germany T: +49 (0) F: +49 (0) Fast Trak Center North America GE Healthcare Bio-Sciences Corp. 800 Centennial Avenue Piscataway, NJ , USA T: F: Fast Trak Center India GE India Technology Centre Pvt. Ltd. John F. Welch Technology Center 122, EPIP, Whitefield Road Bangalore , India T: F: [email protected] Fast Trak Center Japan GE Healthcare Sanken Bldg, Hyakunincho 3-chome Shinjuku-ku Tokyo, Japan T: +81 (0) F: +81 (0) [email protected] Fast Trak Center China GE Healthcare GE (China) Research and Development Center Co.,Ltd 1800 Cai Lun Road Zhangjiang High-Tech Park, Pudong Shanghai , China T: F: [email protected] Administrative office GE Healthcare Bio-Sciences AB Björkgatan 30 SE Uppsala Sweden T: [email protected] Fast Trak Center Singapore GE Healthcare Life Sciences 1 Maritime Square #13-01 HarbourFront Centre Singapore Singapore T: F: [email protected] For further information, contact your nearest Fast Trak Center, GE Healthcare office, or visit: Service and support

224 Validation Services Validation Services is an independent product and service provider within GE Healthcare that offers validation support and documentation. To date, we have supplied validation documentation to almost 5000 biopharmaceutical and pharmaceutical projects. Facilities that have used Validation Services have been successfully audited on numerous occasions by the FDA and other regulatory bodies. Significant costs are incurred for each day that a new biotherapeutic is in process development rather than on the market. To stay competitive, it is imperative that regulatory compliance is achieved efficiently on production facilities as well as laboratory systems and processes. Historically, equipment qualification was considered a one-off activity necessary for using equipment in a regulated environment. However, the regulatory landscape has changed the biopharma industry, as well as regulatory authorities, now require a validation lifecycle approach to demonstrate compliance throughout the equipment s working life. Using a modern, risk-based strategy as implemented by GE Healthcare Validation Services reduces errors and minimizes the often hectic validation activity before a candidate drug can enter production and the market. The life cycle approach as offered by Validation Services focuses on what is critical to end-product quality. For more information, please visit Purchase planning Customized approaches to documentation and validation Validation impact assessment Equipment qualification approach description Installation IQ/OQ documentation IQ/OQ performance Service and support 11 Decommissioning Decommission your system Prove status of a validated system after the last production cycle Maintenance and utilization Change Control documents Continuous verification ValidationCare subscription Our lifecycle validation approach provides you with a service that begins with purchase planning and includes maintenance, utilization, and decommissioning of your equipment

225 Accelerate your time to market The equipment qualification approach used by Validation Services is in alignment with GAMP5, ISPE, and ASTM E2500, whereby validation activities and documentation focus on end-product quality and are scaled according to risk, complexity, and novelty. This approach, based on scientific understanding and product knowledge, is recommended by the FDA initiative Pharmaceutical cgmp for the 21st Century: A Risk-Based Approach, September GE Healthcare equipment and software are developed and verified according to structured and documented procedures. This enables leverage of validation activities and results in a much faster qualification phase, decreasing the start-up phase at the customer site. Furthermore, our standardized test methodologies and modular formats enable efficient validation life cycle activities such as Change Control verifications and continuous verification following equipment upgrades and relocations. Validation Services offerings System impact assessment A risk-based assessment is based on the ISPE s Baseline Guide to Commissioning and Qualification. The system impact assessment clarifies the impact of a system on end product quality, both at the system level and component level, by the application of a series of specific questions. Once the assessment is complete, each item is either formally included in the scope of the validation process or excluded from the validation process and placed into the less rigorous category of Good Engineering Practice (GEP). This is described in an Equipment Qualification Approach document supplied with documentation for each project. Increased efficiency and accuracy Validation Services procedures eliminate the piles of paper traditionally associated with FAT-SAT-IQ/OQ and replace them with a modern, efficient approach, which harvests the benefits of risk management and know-how from subject-matter experts. Validation Services therefore increases accuracy and quality while reducing non valueadded steps. By separation of protocols from record sheets, the Validation Services approach facilitates a timely review and approval process. Validation information is correctly documented in the correct part of the overall validation life cycle, and not duplicated throughout a documentation package. Modular validation strategy Consistency and quality is critical for successful compliance, and it is acknowledged that a consistent documentation package is indicative of the quality of the work it records. We have listened to your needs and have developed a LEAN approach combined with the latest IT tools to ensure consistent packages within the shortest time frame. Our modular validation strategy has been developed to actively support and comply during the lifecycle of a system and to minimize the impact of changes. This increases accuracy, versatility, and speed well beyond traditional validation. Exposure during inspections is minimized through modularity because only specific information that is asked for is presented at any given time. Summary GE Healthcare Validation Services ensure efficient verification of your GE Healthcare equipment compliance status, in line with current interpretation of regulatory directives and guidance. Our documentation supports your equipment throughout its entire lifecycle. When you choose GE Healthcare as your partner in validation support, you can be confident that your equipment is operating in a reliable, consistent, and GxP compliant manner. Brochure Validation Services. Compliance support through lifecycle management Service and support

226 Online regulatory and technical support Regulatory support files GE Healthcare pioneered the development of Regulatory support files to provide customers with detailed information about performance, stability, extractable compounds, and analytical methods for BioProcess media. This information is an invaluable starting point for process development and validation, for preparing Standard Operating Procedures and quality control, and as support for clinical and marketing applications to regulatory agencies. GE Healthcare has over 15 years of experience in providing customers with Regulatory support files. Change Control Notifications Change control notifications alert subscribers of changes associated with the manufacture of products, in accordance with a change control policy. GE Healthcare offers this regulatory support online, including the following features: Direct access notification of updates Downloadable files in Adobe Acrobat (.pdf) format Online subscriptions Sharing subscriptions with colleagues Visit us on the web at Service and support 11 As some of the information is proprietary, Regulatory support online is available only after signing a Secrecy agreement

227 Technical support online Users of GE Healthcare s columns and systems may need quick and easy access to information regarding their equipment. System support information is now available online, on an easily accessed tab for each product. Online technical support information includes: Spare parts for columns, packing stations and systems Accessories necessary for packing and running columns Columns and systems recommended for your scale and selected medium Column packing tips A troubleshooting guide with solutions for specific issues Maintenance instructions Service and support 11 Most GE products now have tabs providing extensive product support information

228 System and column support Spare parts solutions Customized equipment tends to require a specialized spare parts solution. As only small numbers of these parts are needed, they are usually not kept in a standard service inventory. Due to the longer lead time for access to critical spare parts, we highly recommended that you purchase them in advance and keep them on-site in case of a breakdown. For customers with standard equipment and very high uptime demands, we also recommend that critical standard spare parts be purchased and kept on-site in case of breakdown. We can provide guidance as to which parts to keep in stock onsite to maximize uptime. Upgrades Our service engineers can perform certified hardware and software upgrades in a controlled manner according to Change Control Protocols. We ensure that all changes are carefully evaluated, verified, documented, and reviewed. Wear parts supply With any service agreement, identified wear parts will be held in inventory as agreed upon in case of breakdown. This ensures that critical wear parts are available at all times to our service contract customers. Service and support Visit us on the web at purification_techsupport

229 Security of supply Securing the supply of chromatography media is essential to successful biopharmaceutical development and manufacture. As protein-based drugs and/or vaccines progress further along their routeto-market, manufacturers need to be confident that they can produce enough material, on time, for clinical trials, product launches, and commercial manufacturing. The media must be of consistently high quality and delivered on time during all stages of your production cycle. With an annual media production exceeding L, GE Healthcare has the media production capacity to meet your needs. In part, security-of-supply means being certain that you will receive the right quantity of media, manufactured to specified quality levels, and delivered at the right time. Given today s competitive marketplace, there really is no room for unnecessary risks. Large production capacity integrated with clear ordering and delivery routines make BioProcess Media available in the right quantity, at the right place, at the right time. Safety stock agreements ensure extra security of supply. Safety stock of chromatography media Media safety stock agreements offer assurance of a smooth, continuous supply of chromatography media. A customized media safety stock agreement guarantees: Minimized downtime and product loss due to an incident occurring during development, campaign production or regular production Minimized cash layout (transfer cost from balance sheet to profit and loss account) Simplified risk management of consumption fluctuations of production material during therapeutic and clinical trials Help in meeting security and safety demands of regulatory agencies and insurance companies GE Healthcare maintains full responsibility for effective media stocking, rotation, and rapid supply during any emergency situation. You choose: Stock situation Media products and quantities Storage period Commencement date Service and support

230 Literature There is a wealth of literature available from GE Healthcare Life Sciences, and most of it is free. These include our product Data files, Application notes, well-known chromatography handbooks, as well as Upstream and Downstream, our magazine for bioprocessors. Most of these can be found in Acrobat pdf file format on our web site, bioprocess. Contact us through your local GE Healthcare office or via the web site. We look forward to hearing from you. Upstream and Downstream Upstream and Downstream is our customer magazine that covers a range of topics, from cell culture and fermentation through downstream processing. Ordering information Upstream and Downstream Upstream and Downstream Upstream and Downstream Upstream and Downstream Upstream and Downstream Vaccines Supplement Downstream Downstream Downstream Downstream Downstream Downstream Downstream Downstream Downstream If you are not already on the mailing list and wish to receive Upstream and Downstream regularly, please contact your nearest GE Healthcare office. Technique handbooks These handbooks are designed as an introduction to the principles behind each technique and as a practical guide to the selection and use of the products available from GE Healthcare. They are regularly updated and are frequently used in university education. Service and support 11 Handbooks Gel Filtration: Principles and Methods Ion Exchange Chromatography and chromatofocusing: Principles and Methods Affinity Chromatography: Principles and Methods Hydrophobic Interaction Chromatography & Reversed Phase Chromatography: Principles and Methods Strategies for Protein Purification Microcarrier Cell Culture: Principles and Methods Antibody Purification Handbook Recombinant Protein Purification Handbook, Principles and Methods Cell Separation Media: Methodology and applications Isolation of Mononuclear Cells: Methodology and applications D Electrophoresis: Principles and Methods GST Gene Fusion Systems Handbook Purifying Challenging Proteins: Principle and Methods Protein Sample Preparation Handbook Western Blotting, Principles and Methods

231 Data files, Application notes and Posters Data files are available on request for most of our products. These are often complemented with specific technical information or relevant case studies published separately as Application notes or Posters. You can download many of these in PDF format from our web site. Find them under related literature beside product information. Books Handbook of Process Chromatography Development, Manufacturing, Validation and Economics Hagel, L., G. Jagschies, and G. Sofer. Academic Press, London, 2007, (ISBN10: , ISBN13: ) A completely revised edition of the book first published in Over the last 10 years the biotechnology and biologics industries have gained extensive knowledge and experience in downstream processing using chromatography and other technologies associated with recovery and purification unit operations. Protein Purification Principles, High Resolution Methods and Applications Edited by J-C. Janson. Wiley-Liss, New York 2011, (ISBN ). This standard work in the field of protein purification covers a broad range of techniques, both in chromatography and electrophoresis. It provides a comprehensive background for anyone seriously moving into the area. Since the Second Edition of Protein Purification was published in 1998, the sequencing of the human genome and other developments in biosciences has dramatically changed the landscape of protein research. This new edition addresses these developments, featuring a wealth of new topics and several chapters that have been completely rewritten. Service and support Ordering information Product Handbook of Process Chromatography: A Guide to Optimization, Scale-up and Validation (2nd Edition) Protein Purification Principles, High Resolution Methods and Applications (3rd Edition)

232 12 Index and legal A to Z of media and chemicals 234 Terms and conditions of sale 268 Trademarks 271 Licensing information 271 Alphabetical index

233

234 A Z of media and chemicals This is an alphabetical listing of our chromatography media (resins) and other chemical products for industrial scale applications; it includes technical and ordering information. For laboratory scale media, columns and equipment, and convenience products and kits for research applications, please consult Lot number-specific Certificates of Analysis and country-specific Material Safety Data Sheets are available on the internet. Note: ph stability (operational) = for long term exposure CIP = Cleaning-in-Place ph for short term exposure For ion exchangers, the working ph range is dependent on the titration curve. Pressure is given in kpa; conversion as follows (100 kpa = 0.1 MPa = 1 bar = 14.5 psi). = BioProcess media CDM = Custom Designed Media CDM 6-AKS Sepharose 4 Fast Flow. See p 86, 101 Pack size 1 L Regulatory Support File Technical data Composition highly cross-linked 4% agarose Particle size 90 μm median (d 50,volume ) Coupling chemistry Ligand Ligand density epoxy carboxylic acid groups on long spacer arm µmol carboxylic acid groups/ml drained medium For coupling to -NH 2 ph stability of medium after coupling 3 13, depending on ligand stability Pressure/flow spec cm/h, 100 kpa, XK 50/60 column, bed height 25 cm (base matrix) CDM Amino Sepharose 6 Fast Flow. See p 86, 101 Pack size 1 L Regulatory Support File Technical data Composition highly cross-linked 6% agarose Particle size 90 μm median (d 50,volume ) Coupling chemistry Ligand Ligand density For coupling to Chloride ion capacity ph stability of medium after coupling epoxy amino groups on long spacer arm ~ 10 µmol primary amino groups/ml drained medium -COOH, -CHO µmol Cl - /ml drained medium 3 13, depending on ligand stability Pressure/flow spec cm/h, 100 kpa, XK 50/60 column, bed height 25 cm (base matrix) Index and legal 12 CDM Alpha-1 Antitrypsin Select. See p 101 Pack size 25 ml ml L L Regulatory Support File Technical data Composition Highly cross-linked spherical agarose Particle size 75 μm median (d 50,volume ) Coupling chemistry NHS Ligand AAT binding ligand Ligand density ~ 5.5 mg/ml medium Binding capacity ~ 10 mg AAT/mL medium ph stability (operational) 3 10 CIP stability (short-term) 2 11 Pressure/flow spec. At least 600 cm/h in a 1 m column with 20 cm bed height at 20 C using process buffers with the same viscosity as water at < 3 bar (0.3 Mpa) ANX Sepharose 4 Fast Flow (high sub). See p 81, 160 Pack size 25 ml ml L L L Data file Regulatory Support File Prepacked columns HiTrap ANX FF (high sub), 5 1 ml HiTrap ANX FF (high sub), 5 5 ml HiTrap IEX Selection Kit, 7 1 ml Technical data Composition highly cross-linked agarose, 4% Particle size µm Ion capacity mmol Cl - /ml drained medium ph stability (operational) 3 13 CIP stability (working) 2 14 Pressure/flow spec. min 200 cm/h, 100 kpa, XK 50/60 column, bed height 25 cm 234

235 ANX Sepharose 4 Fast Flow (low sub). Pack size 500 ml L Regulatory support file Technical data Composition highly cross-linked 4% agarose Particle size 90 μm median (d 50,volume ) Ion capacity mmol Cl - /ml drained medium. ph stability (operational) 3 13 CIP stability (short term) 2 14 Pressure/flow spec. min 200 cm/h, 100 kpa, XK 50/60 column, bed height 25 cm AVB Sepharose High Performance. See p 86 Pack size 75 ml L Regulatory support file Prepacked columns HiTrap AVB Sepharose HP, 5 1 ml HiTrap AVB Sepharose HP, 1 5 ml Technical data Composition highly cross-linked 6% agarose Particle size 34 μm median (d 50,volume ) Coupling chemistry Ligand NHS protein ligand with affinity for Adeno associated virus Benzamidine Sepharose 4 Fast Flow (high sub). See p 86 Pack size 25 ml ml ml L Regulatory support file Prepacked columns HiTrap Benzamidine FF (high sub), 5 1 ml HiTrap Benzamidine FF (high sub), 2 1 ml HiTrap Benzamidine FF (high sub), 1 5 ml Technical data Composition highly cross-linked 4% agarose Particle size 90 μm median (d 50,volume ) Coupling chemistry amide linkage (carbodiimide) Ligand p-aminobenzamidine Ligand density > 12 µmol/ml drained medium Trypsin capacity > 35 mg trypsin/ml packed medium ph stability (operational) 2 8 CIP stability (short term) 2 9 Pressure/flow spec. min 150 cm/h, 100 kpa, XK 50/60 column, bed height 25 cm (base matrix) Benzamidine Sepharose 4 Fast Flow (low sub). Pack size 100 ml L Regulatory support file Technical data Composition highly cross-linked 4% agarose Particle size 90 μm median (d 50,volume ) Coupling chemistry amide linkage (carbodiimide) Ligand p-aminobenzamidine Ligand density 6 10 µmol/ml drained medium Trypsin capacity ~ 25 mg trypsin/ml packed medium ph stability (operational) 2 8 CIP stability (short term) 2 9 Pressure/flow spec. min 150 cm/h, 100 kpa, XK 50/60 column, bed height 25 cm (base matrix) Blue Sepharose 6 Fast Flow. See p 82, 86 Pack size 50 ml ml L L Data file Regulatory support file Prepacked columns HiScreen Blue FF, ml ( cm) Technical data Composition highly cross-linked 6% agarose Particle size 90 μm median (d 50,volume ) Ligand Ligand density Cibacron Blue F3G-A ~ 7 µmol Cibacron Blue/mL drained medium Coupling chemistry Triazine Binding capacity > 18 mg HSA/mL drained medium ph stability (operational) 4 12 CIP stability (short term) 3 13 Pressure/flow spec. base matrix cm/h, 100 kpa, XK 50/60 column, bed height 25 cm Index and legal

236 Butyl Sepharose High Performance. See p 88 89, 160 Pack size 25 ml ml L L Regulatory support file Prepacked columns HiTrap Butyl HP, 5 1 ml HiTrap Butyl HP, 5 5 ml HiScreen Butyl HP, ml ( cm) HiTrap HIC Selection Kit, 7 1 ml PreDictor RoboColumn Butyl Sepharose HP, 200 μl PreDictor RoboColumn Butyl Sepharose HP, 600 μl Technical data Composition highly cross-linked 6% agarose Particle size 34 μm median (d 50,volume ) Ligand n-butyl ph stability (operational) 3 13 CIP stability (short term) 2 14 Pressure/flow spec cm/h, 300 kpa, BioPilot 60/600 column, bed height 30 cm Butyl Sepharose 4 Fast Flow. See p 88 89, 160 Pack size 25 ml ml ml L L Data file Regulatory support file Prepacked columns HiTrap Butyl FF, 5 1 ml HiTrap Butyl FF, 5 5 ml HiTrap HIC Selection Kit, 7 1 ml HiPrep Butyl FF 16/10, 1 20 ml HiScreen Butyl FF, ml ( cm) PreDictor RoboColumn Butyl Sepharose 4FF, 200 μl PreDictor RoboColumn Butyl Sepharose 4FF, 600 μl well filter plates PreDictor Butyl Sepharose 4 Fast Flow, 6 µl, 4 96-well filter plates PreDictor Butyl Sepharose 4 Fast Flow, 50 µl, 4 96-well filter plates Technical data Composition highly cross-linked 4% agarose Particle size 90 μm median (d 50,volume ) Ligand n-butyl ph stability (operational) 3 13 CIP stability (short term) 2 14 Pressure/flow spec. min 150 cm/h, 100 kpa, XK 50/60column, bed height 25 cm. Index and legal

237 Butyl-S Sepharose 6 Fast Flow. See p 88 89, 160 Pack size 25 ml ml L L Data file Regulatory support file Prepacked columns HiTrap Butyl-S FF, 5 1 ml HiTrap Butyl-S FF, 5 5 ml HiTrap HIC Selection Kit, 7 1 ml HiScreen Butyl-S FF, ml ( cm) PreDictor RoboColumn Butyl-S Sepharose 6FF, 200 μl PreDictor RoboColumn Butyl-S Sepharose 6FF, 600 μl well filter plates PreDictor Butyl S Sepharose 6 Fast Flow, 6 µl, 4 96-well filter plates PreDictor Butyl S Sepharose 6 Fast Flow, 50 µl, 4 96-well filter plates Technical data Composition highly cross-linked 6% agarose Particle size 90 μm median (d 50,volume ) Ligand butyl-s ph stability (operational) 3 13 CIP stability (short term) 2 14 Pressure/flow spec cm/h, 100 kpa, XK 50/60 column, bed height 25 cm Capto adhere. See p 81, 92, 160 Pack size 25 ml ml L L L L Data file Regulatory support file Prepacked columns HiTrap Capto adhere, 5 1 ml HiTrap Capto adhere, 5 5 ml HiScreen Capto adhere, ml ( cm) HiTrap Capto IEX Selection Kit, 5 1 ml PreDictor RoboColumn Capto adhere, 200 μl PreDictor RoboColumn Capto adhere, 600 μl ReadyToProcess Capto adhere 1, 1 L ReadyToProcess Capto adhere 2.5, 2.5 L ReadyToProcess Capto adhere 10, 10 L ReadyToProcess Capto adhere 20, 20 L well filter plates PreDictor Capto adhere, 6 µl, 4 96-well filter plates PreDictor Capto adhere, 20 µl, 4 96-well filter plates PreDictor Capto adhere, 50 µl, 4 96-well filter plates Technical data Ligand type multimodal strong anion exchanger Composition highly cross-linked agarose Particle size 75 µm median (d 50,volume ) Ion capacity mmol Cl - /ml medium ph stability (operational) 3 12 CIP stability 2 14 Pressure/flow spec. 300 kpa at 600 cm/h, 1 m diameter column, 20 cm bed height Index and legal

238 Index and legal Capto Blue. See p 82, 86 Pack size 25 ml ml L Data file Regulatory support file Prepacked columns HiScreen Capto Blue, ml ( cm) Technical data Composition highly cross-linked agarose Particle size 75 µm median (d 50,volume ) Ligand Cibacron Blue F3G-A Ligand density ~ 13 umol Cibacron blue/ml drained medium Coupling chemistry Amine functional spacer Pressure/flow spec. At least 600 cm/h in a 1 m column with 20 cm bed height at 20 C using process buffers with the same viscosity as water; corresponds to a residence time of 2 min CDM Capto Blue (hs). See p 101 Pack size 25 ml ml L Data file Regulatory support file Technical data Composition highly cross-linked agarose Particle size 75 µm median (d 50,volume ) Ligand Ligand density Coupling chemistry Pressure/flow spec. Cibacron Blue F3G-A ~ 18 μmol Cibacron blue/ml drained medium Amine functional spacer At least 300 cm/h in a BPG 300 column with 20 cm bed height at 20 C using process buffers with the same viscosity as water at < 2 bar (0.2 MPa) Capto Butyl. See p 89 Pack size 25 ml ml L L Data file Regulatory support file Prepacked columns PreDictor RoboColumn Capto Butyl, 200 μl PreDictor RoboColumn Capto Butyl, 600 μl HiScreen Capto Butyl, ml ( cm) well filter plates PreDictor Capto Butyl, 6 μl, 4 96-well filter plates PreDictor Capto Butyl, 50 μl, 4 96-well filter plates Technical data Composition highly cross-linked agarose Hydrophobic ligand butyl Particle size 75 μm median (d 50,volume ) Ion capacity ~ 53 μmol/ml medium ph stability (operational) 3 13 CIP stability 2 14 Pressure/flow spec. 300 kpa at 600 cm/h, 1 m diameter column, 20 cm bed height in water Capto Core 700. See p 91 Pack size 25 ml ml L L Data file Regulatory support file Prepacked columns HiTrap Capto Core 700, 5 1 ml HiScreen Capto Core 700, ml ( cm) Technical data Composition Ligand highly cross-linked agarose octylamine Particle size 85 µm median (d 50,volume ) Ion capacity 13 mg ovalbumin/ml medium ph stability (operational) 3 13 CIP stability 2 14 Pressure/flow spec. 500 cm/h in column with 20 cm bed height at < 2 bar (0.2 MPa)

239 Capto DEAE. See p 78 81, 160 Pack size 25 ml ml L L L L Data file Regulatory support file Prepacked columns HiTrap Capto DEAE, 5 1 ml HiTrap Capto DEAE, 5 5 ml HiScreen Capto DEAE, ml ( cm) HiTrap Capto IEX Selection Kit, 5 1 ml PreDictor RoboColumn Capto DEAE, 200 μl PreDictor RoboColumn Capto DEAE, 600 μl well filter plates PreDictor Capto DEAE, 2 µl, 4 96-well filter plates PreDictor Capto DEAE, 20 µl, 4 96-well filter plates PreDictor Capto DEAE, 50 µl, 4 96-well filter plates Technical data Ligand type weak anion exchange Composition highly cross-linked agarose Particle size 90 µm median (d 50,volume ) Ion capacity mmol Cl - /ml ph stability (operational) 2 12 CIP stability 2 14 Pressure/flow spec. 300 kpa at 700 cm/h, 1 m diameter column, 20 cm bed height in water Capto L. See p 82, Pack size 25 ml ml L L L Data file Regulatory support file Prepacked columns HiTrap Protein L, 5 1 ml HiTrap Protein L, 1 5 ml HiTrap Protein L, 5 5 ml HiScreen Capto L, ml ( cm) PreDictor RoboColumn Capto L, 50 μl PreDictor RoboColumn Capto L, 200 μl well filter plates PreDictor Capto L, 6 μl, 4 96-well plates PreDictor Capto L, 20 μl, 4 96-well plates PreDictor Capto L, 50 μl, 4 96-well plates Technical data Composition rigid, highly cross-linked agarose Ligand Protein L (E. coli) Particle size 85 µm Ion capacity ~ 25 mg Fab/mL medium ph stability (operational) 2 12 CIP stability up to 50 mm NaOH* Pressure/flow spec. 500 cm/h in column with 20 cm bed height at < 2 bar (0.2 MPa) * recommended value. Index and legal

240 Index and legal Capto MMC. See p 81, 91, 160 Pack size 25 ml ml L L L L Data file Regulatory support file Prepacked columns HiTrap Capto MMC, 5 1 ml HiTrap Capto MMC, 5 5 ml HiScreen Capto MMC, ml ( cm) HiTrap Capto IEX Selection Kit, 5 1 ml PreDictor RoboColumn Capto MMC, 200 μl PreDictor RoboColumn Capto MMC, 600 μl ReadyToProcess Capto MMC 1, 1 L ReadyToProcess Capto MMC 2.5, 2.5 L ReadyToProcess Capto MMC 10, 10 L ReadyToProcess Capto MMC 20, 20 L well filter plates PreDictor Capto MMC, 6 µl, 4 96-well filter plates PreDictor Capto MMC, 20 µl, 4 96-well filter plates PreDictor Capto MMC, 50 µl, 4 96-well filter plates Technical data Ligand type multimodal weak cation exchanger Composition highly cross-linked agarose Particle size 75 μm median (d 50,volume ) Ion capacity mmol H + /ml medium ph stability (operational) 3 12 CIP stability 2 14 Pressure/flow spec. 300 kpa at 600 cm/h, 1 m diameter column, 20 cm bed height in water CDM Capto Octyl. See p 89, 101 Pack size 25 ml ml L on request 5 L on request Data file well filter plates PreDictor Capto Octyl, 6 μl, 4 96-well filter plates PreDictor Capto Octyl, 50 μl, 4 96-well filter plates Technical data Composition highly cross-linked agarose Hydrophobic ligand octyl Particle size 75 μm median (d 50,volume ) Ligand density ~ 5 μmol/ml medium ph stability (operational) 3-13 CIP stability 2 14 Pressure/flow spec. 300 kpa at 600 cm/h, 1 m diameter column, 20 cm bed height in water Capto Phenyl (high sub). See p 89 Pack size 25 ml ml L L Data file Regulatory support file Prepacked columns HiScreen Capto Phenyl (high sub), ml ( cm) PreDictor RoboColumn Capto Phenyl (high sub), 200 μl PreDictor RoboColumn Capto Phenyl (high sub), 600 μl well filter plates PreDictor Capto Phenyl (high sub), 6 μl, 4 96-well filter plates PreDictor Capto Phenyl (high sub), 50 μl, 4 96-well filter plates Technical data Composition highly cross-linked agarose Hydrophobic ligand phenyl Particle size 75 μm median (d 50,volume ) Ion capacity ~ 27 μmol/ml medium ph stability (operational) 3 13 CIP stability 2 14 Pressure/flow spec. 300 kpa at 600 cm/h, 1 m diameter column, 20 cm bed height in water

241 Capto Q. See p 78 81, 160 Pack size 25 ml ml L L L Data file Regulatory support file Prepacked columns HiTrap Capto Q, 5 1 ml HiTrap Capto Q, 5 5 ml HiScreen Capto Q, ml ( cm) HiTrap Capto IEX Selection Kit, 5 1 ml PreDictor RoboColumn Capto Q, 200 μl PreDictor RoboColumn Capto Q, 600 μl ReadyToProcess Capto Q 1, 1 L ReadyToProcess Capto Q 2.5, 2.5 L ReadyToProcess Capto Q 10, 10 L ReadyToProcess Capto Q 20, 20 L well filter plates PreDictor Capto Q, 2 µl, 4 96-well filter plates PreDictor Capto Q, 20 µl, 4 96-well filter plates PreDictor Capto Q, 50 µl, 4 96-well filter plates Technical data Ion exchanger type Quaternary ammonium strong anion with dextran coating Composition highly cross-linked agarose Particle size 90 μm median (d 50,volume ) Ion capacity mmol Cl - /ml medium ph stability (operational) 2 12 CIP stability 2 14 Pressure/flow spec. 300 kpa at 700 cm/h, 1 m diameter column, 20 cm bed height in water Capto Q ImpRes. See p Pack size 25 ml ml L L Data file Regulatory support file Prepacked columns HiTrap Capto Q ImpRes, 5 1 ml HiTrap Capto Q ImpRes, 5 5 ml HiScreen Capto Q ImpRes, ml ( cm) PreDictor RoboColumn Capto Q ImpRes, 200 μl PreDictor RoboColumn Capto Q ImpRes, 600 μl well filter plates PreDictor Capto Q ImpRes, 6 μl, 4 96-well filter plates PreDictor Capto Q ImpRes, 20 μl, 4 96-well filter plates Technical data Ion exchanger type strong anion exchanger Composition high-flow agarose Particle size 40 μm median (d 50,volume ) Ion capacity mmol Cl - /ml medium ph stability (operational) 2 12 CIP stability 2 14 Pressure/flow spec. 3 bar (300 kpa), min 220 cm/h, 1 m diameter column, 20 cm bed height in water Index and legal

242 Index and legal Capto S. See p 78 81, 160 Pack size 25 ml ml L L L L Datafile Regulatory support file Prepacked columns HiTrap Capto S, 5 1 ml HiTrap Capto S, 5 5 ml HiTrap Capto IEX Selection Kit, 5 1 ml HiScreen Capto S, ml ( cm) PreDictor RoboColumn Capto S, 200 μl PreDictor RoboColumn Capto S, 600 μl ReadyToProcess Capto S 1, 1 L ReadyToProcess Capto S 2.5, 2.5 L ReadyToProcess Capto S 10, 10 L ReadyToProcess Capto S 20, 20 L well filter plates PreDictor Capto S, 2 µl, 4 96-well filter plates PreDictor Capto S, 20 µl, 4 96-well filter plates PreDictor Capto S, 50 µl, 4 96-well filter plates Technical data Ion exchanger type Sulfonate, strong cation exchanger with dextran coating Composition highly cross-linked agarose Particle size 90 µm median (d 50,volume ) Ion capacity mmol Na + /ml ph stability (operational) 4 12 CIP stability 3 14 Pressure/flow spec. 300 kpa at 700 cm/h, 1 m diameter column, 20 cm bed height in water Capto SP ImpRes See p Pack size 25 ml ml L Datafile Regulatory support file Prepacked columns HiTrap Capto SP ImpRes, 5 1 ml HiTrap Capto SP ImpRes, 5 5 ml HiScreen Capto SP ImpRes, ml ( cm) PreDictor RoboColumn Capto SP ImpRes, 200 μl PreDictor RoboColumn Capto SP ImpRes, 600 μl well filter plates PreDictor Capto SP ImpRes, 6 μl, 4 96-well filter plates PreDictor Capto SP ImpRes, 20 μl, 4 96-well filter plates Technical data Ion exchanger type strong cation exchanger Composition high-flow agarose Particle size 40 μm median (d 50,volume ) Ion capacity mmol Na + /ml ph stability (operational) 4 12 CIP stability 3 14 Pressure/flow spec. 3 bar (300 kpa), min 220 cm/h, 1 m diameter column, 20 cm bed height in water CDM Chelating Sepharose Big Beads. See p 101 Pack size 1 L L Regulatory support file Technical data Composition Particle size µm highly cross-linked 6% agarose Coupling chemistry epoxy Ligand imino diacetic acid Metal ion capacity µmol Cu2 + /ml packed medium ph stability (operational) 3 13 CIP stability (short term) 3 14 Pressure/flow spec cm/h, 100 kpa, XK 50/60 column, bed height 25 cm

243 Chelating Sepharose Fast Flow. See p 82, 86 Pack size 50 ml ml L Data file Regulatory support file Technical data Composition highly cross-linked 6% agarose Particle size 90 μm median (d 50,volume ) Ligand iminodiaceticacid groups on spacer Coupling chemistry ether Metal ion capacity µmol Cu 2+ /ml medium ph stability (operational) 3 13 CIP stability (short term) 2 14 Pressure/flow spec. base matrix cm/h, 100 kpa, XK 50/60 column, bed height 25 cm CM Sephadex C-25. See p 80 Pack size 100 g g kg Regulatory support file Technical data Composition cross-linked dextran Particle size wet (in 0.15 M NaCl), µm ph stability (operational) 4 10 CIP stability (short term) 3 13 Pressure/flow spec. min 120 cm/h, pressure drop cm H 2 O/bed height=5, bed height 10 cm, 5 cm i.d. CM Sephadex C-50. See p 80 Pack size 100 g g kg Regulatory support file Technical data Composition cross-linked dextran Particle size wet (in 0.15 M NaCl), µm ph stability (operational) 4 10 CIP stability (short term) 3 13 Pressure/flow spec. min 100 cm/h, pressure drop cm H 2 O/bed height=10, bed height 10 cm, 5 cm i.d. CM Sepharose Fast Flow. See p 81, 160 Pack size 25 ml ml L L Data file Regulatory support file Prepacked columns HiTrap CM FF, 5 1 ml HiTrap CM FF, 5 5 ml HiTrap IEX Selection Kit, 7 1 ml HiPrep CM FF 16/10, 1 20 ml ReadyToProcess CM Sepharose FF 1, 1 L ReadyToProcess CM Sepharose FF 2.5, 2.5 L ReadyToProcess CM Sepharose FF 10, 10 L ReadyToProcess CM Sepharose FF 20, 20 L Technical data Composition highly cross-linked 6% agarose Particle size µm Binding capacity 50 mg Ribonuclease/mL drained medium Ion capacity mmol H + /ml medium ph stability (operational) 4 13 CIP stability (short term) 2 14 Pressure/flow spec cm/h, 100 kpa, XK 50/30 column, bed height 15 cm CM Sepharose High Performance. See p 81 Pack size 1 L L L Regulatory support file Technical data Composition highly cross-linked 6% agarose Particle size 34 μm median (d 50,volume ) Total capacity H mmol/ml medium ph stability (operational) 4 13 CIP stability (short term) 2 14 Pressure/flow spec cm/h, 300 kpa, BioPilot 60/600 column, bed height 30 cm Index and legal

244 CNBr-activated Sepharose 4B. Pack size 15 g g kg Regulatory support file Technical data Composition 4% agarose Particle size 90 μm median (d 50,volume ) For coupling to -NH 2 Activation method cyanogen bromide (CNBr) activated Coupling capacity mg a-chymotrypsinogen/ml drained medium ph stability (operational) 3 11, ligand dependent CIP stability (short term) 3 11, ligand dependent Pressure/flow spec. base matrix cm/h, pressure drop cm H 2 O/bed height=15, bed height 10 cm, 5 cm i.d. CNBr-activated Sepharose 4 Fast Flow. See p 82, 86 Pack size 10 g g kg Data file Regulatory support file Technical data Composition highly cross-linked 4% agarose Particle size 90 μm median (d 50,volume ) For coupling to -NH 2 Activation method cyanogen bromide (CNBr) activated Coupling capacity mg a-chymotrypsinogen/ml drained medium ph stability (operational) 3 11, ligand dependent CIP stability (short term) 3 11, ligand dependent Pressure/flow spec. base matrix cm/h, 100 kpa, XK 50/60 column, bed height 25 cm Con A Sepharose 4B. See p 86 Pack size 5 ml ml ml L Prepacked columns HiTrap Con A 4B, 5 1 ml HiTrap Con A 4B, 5 5 ml Technical data Composition 4% agarose Particle size 90 μm median (d 50,volume ) Ligand Concanavalin A Ligand density mg Con A/mL drained medium Coupling chemistry CNBr ph stability (operational) 4 9 CIP stability (short term) 4 9 Pressure/flow spec. base matrix cm/h, pressure drop cm H 2 O/bed height=15, bed height 10 cm, 5 cm i.d. Cytodex 1. See p Pack size 25 g g g kg kg Data file Regulatory support file Technical data Density* 1.03 g/ml in 0.9% NaCl Particle size* 190 µm median (d 50,volume ) Particle size* µm range (d 5-95,volume ) Approx. area* cm 2 /g dry weight Approx. no. microcarriers g/dry weight swelling* 20 ml/g dry weight * In 0.9% NaCl Note: For Cytodex, size is based on median diameter at 50% of the volume of a sample of microcarriers (d 50,volume ), or the range between the diameter at 5% and 95% of the volume of a sample of microcarriers (d 5 95,volume ). This size is calculated from cumulative volume distributions. Index and legal

245 Cytodex 3. See p Pack size 10 g g g kg kg Data file Regulatory support file Technical data Density* 1.04 g/ml in 0.9% NaCl Particle size* 175 µm median (d 50,volume ) Particle size* µm range (d 5-95,volume ) Approx. area* cm 2 /g dry weight Approx. no. microcarriers g/dry weight swelling* 15 ml/g dry weight Cytopore 2. See p Pack size 20 g g g kg Data file Regulatory support file Technical data Particle diameter Effective surface area Density Average diameter of pore openings Volume nm* 1.1 m 2 /g dry weight 1.03 g/ml* 30 µm* 40 ml/g dry weight * In 0.9% NaCl (data from Ashai Chemical Industry Co. Ltd., Japan) * In 0.9% NaCl Note: For Cytodex, size is based on median diameter at 50% of the volume of a sample of microcarriers (d 50,volume ), or the range between the diameter at 5% and 95% of the volume of a sample of microcarriers (d 5 95,volume ). This size is calculated from cumulative volume distributions. Cytoline 1. See p 31, 33 Pack size 50 ml ml L Data file Regulatory support file Technical data Sedimentation velocity cm/min Length mm Thickness mm Density 1.32 g/ml Pore size µm Surface area > 0.3 m 2 /g Cytopore 1. See p Pack size 20 g g g Data file Regulatory support file Technical data Particle diameter Effective surface area Density Average diameter of pore openings Volume nm* 1.1 m 2 /g dry weight 1.03 g/ml* 30 µm* 40 ml/g dry weight * In 0.9% NaCl (data from Ashai Chemical Industry Co. Ltd., Japan) DEAE Sephadex A-25. See p 80 Pack size 100 g g kg kg Data file Regulatory support file Technical data Composition cross-linked dextran Particle size wet (in 0.15 M NaCl), µm ph stability (operational) 2 10 CIP stability (short term) 2 13 Pressure/flow spec. min 120 cm/h, pressure drop cm H 2 O/bed height=5, bed height 10 cm, 5 cm i.d. DEAE Sephadex A-50. See p 80 Pack size 100 g g kg Data file Regulatory support file Technical data Composition cross-linked dextran Particle size wet (in 0.15 M NaCl), µm ph stability (operational) 2 10 CIP stability (short term) 2 13 Pressure/flow spec. min 60 cm/h, pressure drop cm H 2 O/bed height=10, bed height 10 cm, 5 cm i.d. Index and legal

246 Index and legal DEAE Sepharose Fast Flow. See p 81, 160 Pack size 25 ml ml L L IEX Selection Kit Data file Regulatory support file Prepacked columns HiTrap DEAE FF, 5 1 ml HiTrap DEAE FF, 5 5 ml HiTrap IEX Selection Kit, 7 1 ml HiPrep DEAE FF 16/10, 1 20 ml HiScreen DEAE FF, ml ( cm) ReadyToProcess DEAE Sepharose FF 1, 1 L ReadyToProcess DEAE Sepharose FF 2.5, 2.5 L ReadyToProcess DEAE Sepharose FF 10, 10 L ReadyToProcess DEAE Sepharose FF 20, 20 L Technical data Composition highly cross-linked 6% agarose Particle size µm Binding capacity 110 mg HSA/mL drained medium Ion capacity mmol Cl - /ml medium ph stability (operational) 2 12 CIP stability (short term) 2 14 Pressure/flow spec cm/h, 100 kpa, XK 50/30 column, bed height 15 cm ECH-Lysine Sepharose 4 Fast Flow. See p 86 Pack size 500 ml L Regulatory support file Technical data Composition highly cross-linked 4% agarose Particle size 90 μm median (d 50,volume ) Coupling chemistry NHS Ligand L-lysine Ligand density ~ 16 µmol/ml drained medium ph stability (operational) 3 12 CIP stability (short term) 2 13 Pressure/flow spec cm/h, 100 kpa, XK 50/60 column, bed height 25 cm (base matrix) Epoxy-activated Sepharose 6B. See p 86 Pack size 15 g g Technical data Composition 6% agarose Particle size 90 μm median (d 50,volume ) For coupling to Active groups -NH 2, -OH, -SH epoxy groups on 12-atom spacer Amount of active groups µmol epoxy groups/ml drained medium ph stability (operational) CIP stability (short term) Pressure/flow spec GammaBind G Type 2. Pack size 3 13, ligand dependent 3 13, ligand dependent base matrix cm/h, pressure drop cm H 2 O/bed height=15, bed height 10 cm, 5 cm i.d. 1 g g g Gelatin Sepharose 4 Fast Flow. See p 86 Pack size 1 L L Regulatory support file Technical data Composition highly cross-linked 4% agarose Particle size 90 μm median (d 50,volume ) Coupling chemistry CNBr Ligand bovine gelatin derivative Ligand density ~ 5 mg/ml drained medium Pressure/flow spec cm/h, 100 kpa, XK 50/60 column, bed height 25 cm (base matrix)

247 Glutathione Sepharose 4 Fast Flow. See p 86 Pack size 25 ml ml ml Data file Prepacked columns GSTrap FF, 5 1 ml GSTrap FF, 2 1 ml GSTrap FF, ml* GSTrap FF, 1 5 ml GSTrap FF, 5 5 ml GSTrap FF, ml* GSTPrep FF 16/10, 1 20 ml well filter plates GST MultiTrap FF, 4 96-well filter plates Technical data Composition highly cross-linked 4% agarose Particle size 90 μm median (d 50,volume ) Ligand glutathione Ligand density µmol glutathione/ml drained medium Coupling chemistry epoxy Binding capacity ~ 10 mg recombinant GST/mL medium, protein dependent ph stability 3 12 Pressure/flow spec. base matrix cm/h, 100 kpa, XK 50/60 column, bed height 25 cm *Special pack size delivered on specific customer order. Heparin Sepharose 6 Fast Flow. See p 82, 86 Pack size 50 ml ml L L Data file Regulatory support file Prepacked columns HiPrep Heparin FF 16/10, 1 20 ml Technical data Composition highly cross-linked 6% agarose Particle size 90 μm median (d 50,volume ) Ligand heparin Ligand density ~ 4 mg heparin/ml drained medium Coupling chemistry reductive amination ph stability (operational) 4 12 CIP stability (short term) 4 13 Pressure/flow spec. base matrix cm/h, 100 kpa, XK 50/60 column, bed height 25 cm CDM IgSelect. See p 86, 101 Pack size 25 ml ml L Data file Regulatory support file Prepacked columns HiTrap, 5 1 ml HiTrap, 1 5 ml Technical data Composition highly cross-linked agarose Particle size 75 μm median (d 50,volume ) Ligand Coupling chemistry Dynamic binding capacity Pressure/flow spec. ph stability (long term) 3 11 ph stability (short term) 2 13 IgG Sepharose 6 Fast Flow. Pack size 14 kd recombinant protein produced in S. cerevisiae. Binds to Fc fragments of all human IgG subclasses. NHS 17 mg/ml at 2.4 min residence time At least 600 cm/h in a 1 m column with 20 cm bed height at 20 C using process buffers with the same viscosity as water at < 3 bar (0.3 MPa) 10 ml ml L Technical data Composition highly cross-linked 6% agarose Particle size 90 μm median (d 50,volume ) Coupling chemistry CNBr Ligand human polyclonal IgG Capacity ~ 5 mg Protein A/mL drained medium ph stability (operational) 3 10 Pressure/flow spec cm/h, 100 kpa, XK 50/60 column, bed height 25 cm (base matrix) Index and legal

248 Index and legal IMAC Sepharose 6 Fast Flow. See p 82, 86 Pack size 25 ml ml L L Data file Regulatory support file Prepacked columns HiTrap IMAC FF, 5 1 ml HiTrap IMAC FF, 5 5 ml HiPrep IMAC FF 16/10, 1 20 ml HiScreen IMAC FF, ml ( cm) Technical data Composition highly cross-linked 6% agarose Particle size 90 μm median (d 50,volume ) Metal ion capacity Dynamic binding capacity ~ 15 µmol Ni 2+ /ml drained medium ~ 40 mg histidine-tagged protein/ml medium, protein and metal ion dependent ph stability (operational) 3 12 ph stability (short term) 2 14 Pressure/flow spec. base matrix cm/h, 100 kpa, XK50/60 column, bed height 25 cm KappaSelect. See p 85 Pack size 25 ml ml L L Regulatory support file Technical data Composition Highly cross-linked high-flow agarose Particle size 75 μm median (d 50,volume ) Ligand Recombinant protein (Mr ), produced in S. cerevisiae, with affinity for the constant domain of the immunoglobulin kappa light chain ph stability (operational) 3 10 CIP stability (short term) 2 12 Pressure/flow spec. At least 600 cm/h in a 1 m column with 20 cm bed height at 20 C using process buffers with the same viscosity as water at < 3bar (0.3 Mpa) CDM LambdaFabSelect. See p 85, 101 Pack size 25 ml ml L L Data file Regulatory support file Prepacked columns HiTrap LambdaFabSelect, 5 x 1 ml HiTrap LambdaFabSelect, 1 x 5 ml well filter plates PreDictor LambdaFabSelect, 6 µl, 4 96-well filter plates PreDictor LambdaFabSelect, 20 µl, 4 96-well filter plates PreDictor LambdaFabSelect, 50 µl, 4 96-well filter plates Technical data Composition highly cross-linked high-flow agarose Particle size 75 µm median (d 50,volume ) Ligand recombinant protein (M r ), produced in S. cerevisiae, that binds to constant region of Fab lambda light chain ph stability (operational) 3 10 CIP stability (short term) 2 12 Pressure/flow spec. At least 600 cm/h in a 1 m column with 20 cm bed height at 20 C using buffers with the same viscosity as water at < 3 bar (0.3 MPa) Lentil Lectin Sepharose 4B. See p 86 Pack size 25 ml L Regulatory support file Technical data Composition 4% agarose Particle size 90 μm median (d 50,volume ) Ligand lentil lectin Ligand density ~ 2 mg lentil lectin/ml drained medium Coupling chemistry CNBr ph stability (operational) 3 10 CIP stability (short term) 3 10 Pressure/flow spec. base matrix cm/h, pressure drop cm H 2 O/bed height=15, bed height 10 cm cm, 5 cm i.d

249 MabSelect. See p 83, 86 Pack size 25 ml ml L L L Data file Regulatory support file Prepacked columns HiTrap MabSelect, 5 1 ml HiTrap MabSelect, 1 5 ml HiTrap MabSelect, 5 5 ml HiScreen MabSelect, ml ( cm) PreDictor RoboColumn MabSelect, 50 μl PreDictor RoboColumn MabSelect, 200 μl well filter plates PreDictor MabSelect, 6 µl, 4 96-well filter plates PreDictor MabSelect, 20 µl, 4 96-well filter plates PreDictor MabSelect, 50 µl, 4 96-well filter plates Technical data Composition highly cross-linked agarose Particle size 85 µm median (d 50,volume ) Ligand recombinant Protein A (E. coli) Coupling chemistry epoxy Dynamic binding capacity min 30 mg human IgG/mL medium at 2.4 min residence time ph stability (operational) 3 10 CIP stability (short term) 2 12 Pressure/flow spec. up to 500 cm/h, < 200 kpa, BPG 300, bed height 20 cm MabSelect SuRe. See p 83, 86, 92 Pack size 25 ml ml L L L Data file Regulatory support file Prepacked columns HiTrap MabSelect SuRe, 5 1 ml HiTrap MabSelect SuRe, 1 5 ml HiTrap MabSelect SuRe, 5 5 ml HiScreen MabSelect SuRe, ml ( cm) PreDictor RoboColumn MabSelect SuRe, 50 μl PreDictor RoboColumn MabSelect SuRe, 200 μl ReadyToProcess MabSelect SuRe 1, 1 L ReadyToProcess MabSelect SuRe 2.5, 2.5 L ReadyToProcess MabSelect SuRe 10, 10 L ReadyToProcess MabSelect SuRe 20, 20 L well filter plates PreDictor MabSelect SuRe, 6 µl, 4 96-well filter plates PreDictor MabSelect SuRe, 20 µl, 4 96-well filter plates PreDictor MabSelect SuRe, 50 µl, 4 96-well filter plates Technical data Composition highly cross-linked agarose Particle size 85 µm median (d 50,volume ) Ligand alkali-stabilized Protein A-derived (E. coli) Coupling chemistry epoxy Dynamic binding capacity min 30 mg human IgG/mL medium at 2.4 min residence time ph stability (operational) 3 12 CIP stability (short term) M NaOH Pressure/flow spec. up to 500 cm/h, < 2 bar, BPG 300, bed height 20 cm Index and legal

250 MabSelect SuRe LX. See p 83, 86, 92 Pack size 25 ml ml L L L Data file Regulatory support file Prepacked columns HiScreen MabSelect SuRe LX, ml ( cm) PreDictor RoboColumn MabSelect SuRe LX, 200 μl PreDictor RoboColumn MabSelect SuRe LX, 600 μl well filter plates PreDictor MabSelect SuRe LX, 6 μl, 4 96-well filter plates PreDictor MabSelect SuRe LX, 20 μl, 4 96-well filter plates PreDictor MabSelect SuRe LX, 50 μl, 4 96-well filter plates Technical data Composition Rigid, highly cross-linked agarose Particle size 85 µm median (d 50,volume ) Ligand alkali-tolerant Protein A-derived (E. coli) Coupling chemistry epoxy Dynamic binding capacity ~ 60 mg human IgG/mL medium at 6.0 min residence time ph stability (operational) 3 12 CIP stability (short term) M NaOH Pressure/flow spec. up to 500 cm/h, < 2 bar, AxiChrom 300, bed height 20 cm MabSelect Xtra. See p 83, 86 Pack size 25 ml ml L L L L Data file Regulatory support file Prepacked columns HiTrap MabSelect Xtra, 5 1 ml HiTrap MabSelect Xtra, 1 5 ml HiTrap MabSelect Xtra, 5 5 ml HiScreen MabSelect Xtra, ml ( cm) PreDictor RoboColumn MabSelect Xtra, 50 μl PreDictor RoboColumn MabSelect Xtra, 200 μl well filter plates PreDictor MabSelect Xtra, 6 μl, 4 96-well filter plates PreDictor MabSelect Xtra, 20 μl, 4 96-well filter plates PreDictor MabSelect Xtra, 50 μl, 4 96-well filter plates Technical data Composition highly cross-linked agarose Particle size 75 µm median (d 50,volume ) Ligand recombinant Protein A (E. coli) Coupling chemistry epoxy Dynamic binding capacity ~ 40 mg human IgG/mL medium at 2.4 min residence time ph stability (operational) 3 10 CIP stability (short term) 2 12 Pressure/flow spec. up to 300 cm/h, < 200 kpa, BPG 300, bed height 20 cm Index and legal

251 CDM MacroCap Q. See p 78, 80, 101 Pack size 25 ml ml L Data file Regulatory support file Technical data Composition Cross-linked co-polymer of allyl dextran and N,N-methylene bisacrylamide Particle size 50 μm median (d 50,volume ) Ion exchanger type Strong anion Charged group -N(CH 3 ) 3+ Total ionic capacity 0.07 to 0.10 mmol Cl - /ml medium Recommended separation range a) proteins in excess of 150 kda b) functionalized Dextrans or PEGs MW c) PEG-proteins containing PEG (total) per conjugate ph stability (operational) 3 11 ph stability (short term) 1 12 ph stability (long term) 3 10 CIP stability 2 13 Chemical stability all commonly used aqueous buffers, 0.1 M citric acid, 0.5 M NaOH, 25% ethanol, 30% propanol, 30% methanol, 50% ethylene glycol, 1% Tween 20, 1% SDS. Flow velocity 120 cm/h in BPG 300 columns with 20 cm bed height at 20 C using process buffers with the same viscosity as water at < 300 kpa. MacroCap SP. See p 78, 80 Pack size 25 ml ml L L L L Data file Regulatory support file Technical data Composition Cross-linked co-polymer of allyl dextran and N,N-methylene bisacrylamide Particle size 50 μm median (d 50,volume ) Ion exchanger type Strong cation Charged group - SO 3 Total ionic capacity mmol H + /ml medium Recommended separation range a) proteins in excess of 150 kda b) functionalized Dextrans or PEGs MW c) PEG-proteins containing PEG (total) per conjugate ph stability (operational) 3 12 ph stability (short term) 2 13 ph stability (long term) 4 11 CIP stability 2 13 Chemical stability all commonly used aqueous buffers, 0.1 M citric acid, 0.5 M NaOH, 25% ethanol, 30% propanol, 30% methanol, 50% ethylene glycol, 1% Tween 20, 1% SDS. Flow velocity 120 cm/h in BPG 300 columns with 20 cm bed height at 20 C using process buffers with the same viscosity as water at < 300 kpa. NHS-activated Sepharose 4 Fast Flow. See p 82, 86 Pack size 25 ml ml L Data file Regulatory support file Technical data Composition highly cross-linked 4% agarose Particle size 90 μm median (d 50,volume ) For coupling to -NH 2 Active groups NHS ester on 14-atom spacer Amount of active groups ~ 18 µmol NHS/mL drained medium ph stability (operational) 3 13, ligand dependent CIP stability (short term) 3 13, ligand dependent Pressure/flow spec. base matrix cm/h, 100 kpa, XK 50/60 column, bed height 25 cm Index and legal

252 Index and legal 12 Ni Sepharose 6 Fast Flow. See p 82, 86 Pack size 5 ml ml ml ml L L Data file Regulatory support file Prepacked columns HisTrap FF, 5 1 ml HisTrap FF, ml* HisTrap FF, 5 5 ml HisTrap FF, ml* HisPrep FF 16/10, 1 20 ml HisTrap FF crude, 5 1 ml HisTrap FF crude, ml* HisTrap FF crude, 5 5 ml HisTrap FF crude, ml* HiScreen Ni FF, ml ( cm) well filter plates His MultiTrap FF, 4 96-well filter plates Technical data Composition highly cross-linked 6% agarose Particle size 90 μm median (d 50,volume ) Metal ion capacity ~ 15 µmol Ni 2+ /ml medium Dynamic binding capacity ~ 40 mg histidine-tagged protein/ ml medium, protein dependent ph stability (operational) 3 12 CIP stability (short term) 2 14 Pressure/flow spec. base matrix cm/h, 100 kpa, XK 50/60 column, bed height 25 cm *Special pack size delivered on specific customer order. nprotein A Sepharose 4 Fast Flow. See p 86 Pack size 5 ml ml ml L L L Data file Regulatory support file Technical data Composition highly cross-linked 4% agarose Particle size 90 µm median (d 50,volume ) Ligand Protein A from Staphylococcus aureus Coupling chemistry CNBr ph stability (operational) 3 9 CIP stability (short term) 2 10 Pressure/flow spec. base matrix cm/h, 100 kpa, XK 50/60 column, bed height 25 cm Octyl Sepharose 4 Fast Flow. See p 89, 160 Pack size 25 ml ml L L Regulatory support file Prepacked columns HiTrap Octyl FF, 5 1 ml HiTrap Octyl FF, 5 5 ml HiTrap HIC Selection Kit, 7 1 ml HiPrep Octyl FF 16/10, 1 20 ml HiScreen Octyl FF, ml ( cm) PreDictor RoboColumn Octyl Sepharose 4FF, 200 μl PreDictor RoboColumn Octyl Sepharose 4FF, 600 μl well filter plates PreDictor Octyl Sepharose 4 Fast Flow, 6 μl, 4 96-well filter plates PreDictor Octyl Sepharose 4 Fast Flow, 50 μl, 4 96-well filter plates Technical data Composition highly cross-linked 4% agarose Particle size 90 μm median (d 50,volume ) Ligand n-octyl ph stability (operational) 3 13 CIP stability (short term) 2 14 Pressure/flow spec. base matrix cm/h, 100 kpa, XK 50/60 column, bed height 25 cm 252

253 Oligosynt. See Solid supports for oligonucleotide synthesis p 266 Phenyl Sepharose 6 Fast Flow (high sub). See p 89, 160 Pack size 25 ml ml L L L L Data file Regulatory support file Prepacked columns HiTrap Phenyl FF (high sub), 5 1 ml HiTrap Phenyl FF (high sub), 5 5 ml HiTrap HIC Selection Kit, 7 1 ml HiPrep Phenyl FF (high sub) 16/10, 1 20 ml HiScreen Phenyl FF (high sub), ml ( cm) PreDictor RoboColumn Phenyl Sepharose 6FF (high sub), 200 μl PreDictor RoboColumn Phenyl Sepharose 6FF (high sub), 600 μl well filter plates PreDictor Phenyl Sepharose 6 Fast Flow (high sub), 6 μl, 4 96-well filter plates PreDictor Phenyl Sepharose 6 Fast Flow (high sub), 50 μl, 4 96-well filter plates Technical data Composition highly cross-linked 6% agarose Particle size 90 μm median (d 50,volume ) Ligand phenyl ph stability (operational) 3 13 CIP stability (short term) 2 14 Pressure/flow spec cm/h, 100 kpa, XK 50/60 column, bed height 25 cm Phenyl Sepharose 6 Fast Flow (low sub). See p 89, 160 Pack size 25 ml ml L L Data file Regulatory support file Prepacked columns HiTrap Phenyl FF (low sub), 5 1 ml HiTrap Phenyl FF (low sub), 5 5 ml HiTrap HIC Selection Kit, 7 1 ml HiPrep Phenyl FF (low sub) 16/10, 1 20 ml HiScreen Phenyl FF (low sub), ml ( cm) PreDictor RoboColumn Phenyl Sepharose 6FF (low sub), 200 μl PreDictor RoboColumn Phenyl Sepharose 6FF (low sub), 600 μl ReadyToProcess Phenyl Sepharose 6 FF (low sub) 1, 1 L ReadyToProcess Phenyl Sepharose 6 FF (low sub) 2.5, 2.5 L ReadyToProcess Phenyl Sepharose 6 FF (low sub) 10, 10 L ReadyToProcess Phenyl Sepharose 6 FF (low sub) 20, 20 L well filter plates PreDictor Phenyl Sepharose 6 Fast Flow (low sub), 6 μl, 4 96-well filter plates PreDictor Phenyl Sepharose 6 Fast Flow (low sub), 50 μl, 4 96-well filter plates Technical data Composition highly cross-linked 6% agarose Particle size 90 μm median (d 50,volume ) Ligand phenyl ph stability (operational) 3 13 CIP stability (short term) 2 14 Pressure/flow spec cm/h, 100 kpa, XK 50/60 column, bed height 25 cm Index and legal

254 Phenyl Sepharose High Performance. See p 89, 160 Pack size 75 ml L L Data file Regulatory support file Prepacked columns HiLoad 16/10 Phenyl Sepharose HP, 1 20 ml HiLoad 26/10 Phenyl Sepharose HP, 1 53 ml HiTrap Phenyl HP, 5 1 ml HiTrap Phenyl HP, 5 5 ml HiTrap HIC Selection Kit, 7 1 ml HiScreen Phenyl HP, ml ( cm) PreDictor RoboColumn Phenyl Sepharose HP, 200 μl PreDictor RoboColumn Phenyl Sepharose HP, 600 μl Technical data Composition highly cross-linked 6% agarose Particle size 34 μm median (d 50,volume ) Ligand phenyl ph stability (operational) 3 13 CIP stability (short term) 2 14 Max pressure 300 kpa CDM Plasminogen Removal Gel. See p 86, 101 Pack size 1 L Regulatory support file Technical data Composition highly cross-linked 4% agarose Particle size 90 µm median (d 50,volume ) Coupling chemistry epoxy Ligand Tranexamic acid Ligand density 9 13 µmol/ml drained medium ph stability (operational) 3 12 CIP stability (short term) 2 14 Pressure/flow spec cm/h, 100 kpa, XK 50/60 column, bed height 25 cm (base matrix) Primer Support. See Solid supports for oligonucleotide synthesis p 266 Protein A. See p 82 83, 92 Pack size 50 mg g g CDM Procainamide Sepharose 4 Fast Flow. See p 86, 101 Index and legal PlasmidSelect Xtra. See p 93, 160 Pack size PlasmidSelect Xtra Screening Kit PlasmidSelect Xtra Starter Kit ml ml L L Data file Regulatory support file Technical data Composition Particle size µm Ligand highly cross-linked 6% agarose 2-mercaptopyridine Ligand concentration 3.5 mg/ml Capacity for supercoiled pdna (6125 bp) > 2 mg/ml ph stability (operational) 3 11 CIP stability (short term) 2 13 Cleaning-in-place 0.5 M NaOH Flow velocity for supercoiled plasmid purification < 120 cm/h, XK 16/20 column, bed height 15 cm Pack size 1 L L Technical data Composition highly cross-linked 4% agarose Particle size 90 µm median (d 50,volume ) Coupling chemistry amide linkage (carbodiimide) Ligand procainamide Ligand density ~ 23 µmol/ml drained medium Pressure/flow spec. min 150 cm/h, 100 kpa, XK 50/60 column, bed height 25 cm (base matrix)

255 rprotein A Sepharose 4 Fast Flow. See p 86 Pack size 5 ml ml ml L L L Data file Regulatory support file Prepacked columns HiTrap rprotein A FF, 5 1 ml HiTrap rprotein A FF, 2 1 ml HiTrap rprotein A FF, ml* HiTrap rprotein A FF, 1 5 ml HiTrap rprotein A FF, 5 5 ml Technical data Composition highly cross-linked 4% agarose Particle size 90 µm median (d 50,volume ) Ligand recombinant Protein A from E. coli Coupling chemistry epoxy Dynamic binding capacity min 27 mg human IgG/mL medium at 3 min residence time ph stability (operational) 3 10 CIP stability (short term) 2 11 Pressure/flow spec. base matrix cm/h, 100 kpa, XK 50/60 column, bed height 25 cm *Special pack size delivered on specific customer order. rmp Protein A Sepharose Fast Flow. See p 86 Pack size 5 ml ml ml L L Data file Regulatory support file Technical data Composition highly cross-linked 4% agarose Particle size 90 µm median (d 50,volume ) Ligand recombinant Protein A from E. coli Coupling chemistry reductive amination Dynamic binding capacity min 22 mg human IgG/mL medium at 3 min residence time ph stability (operational) 3 10 CIP stability (short term) 2 11 Pressure/flow spec. base matrix cm/h, 100 kpa, XK 50/60 column, bed height 25 cm Protein G. Pack size 5 mg g g Protein G Sepharose 4 Fast Flow. See p 86 Pack size 5 ml ml ml L L Data file Regulatory support file Technical data Composition Particle size µm Ligand highly cross-linked 4% agarose recombinant Protein G from E. coli Ligand density ~ 2 mg protein G/mL drained medium Coupling chemistry CNBr ph stability (operational) 3 9 CIP stability (short term) 2 10 Pressure/flow spec. base matrix cm/h, 100 kpa, XK 50/60 column, bed height 25 cm CDM VIISelect. See p 101 Pack size 25 ml ml L L Regulatory support file Technical data Composition highly cross-linked high-flow agarose Particle size 75 μm median (d 50,volume ) Ligand recombinant protein (Mr ) produced in S. cerevisiae Ligand density ~ 5.7 mg/ml of medium Binding capacity ~ 8 mg/ml of medium ph stability (operational) 3 10 CIP stability (short term) 2 12 Pressure/flow spec. at least 600 cm/h in a 1 m column with 20 cm bed height at 20 C using buffers with the same viscosity as water at < 3 bar (0.3 MPa) Index and legal

256 CDM VIIISelect. See p 86, 101 Pack size 25 ml ml Regulatory support file Technical data Composition highly cross-linked high flow agarose Particle size 75 μm median (d 50,volume ) Ligand Coupling chemistry Pressure/flow spec. 13 kd recombinant protein produced in S. cerevisiae. Binds to beta-domain depleted factor VIII molecules. NHS At least 300 cm/h in a BPG 300 column with 20 cm bed height at 20 C using process buffers with the same viscosity as water at < 2 bar (0.2 MPa) Q Sepharose Big Beads. See p 80, 160 Pack size 1 L L L IEX Selection Kit Data file Regulatory support file Technical data Composition Particle size µm Ion capacity highly cross-linked 6% agarose mmol Cl - /ml medium ph stability (operational) 2 12 CIP stability (short term) 2 14 Pressure/flow spec cm/h, 100 kpa, XK50/60 column, bed height 25 cm Q Sepharose Fast Flow. See p 81, 160 Pack size 25 ml ml L L L IEX Selection Kit Data file Regulatory support file Prepacked columns HiTrap Q FF, 5 1 ml HiTrap Q FF, 5 5 ml HiPrep Q FF 16/10, 1 20 ml HiScreen Q FF, ml ( cm) HiTrap IEX Selection Kit, 7 1 ml PreDictor RoboColumn Q Sepharose FF, 200 μl PreDictor RoboColumn Q Sepharose FF, 600 μl ReadyToProcess Q Sepharose FF 1, 1 L ReadyToProcess Q Sepharose FF 2.5, 2.5 L ReadyToProcess Q Sepharose FF 10, 10 L ReadyToProcess Q Sepharose FF 20, 20 L well filter plates PreDictor Q Sepharose Fast Flow, 6 μl, 4 96-well filter plates PreDictor Q Sepharose Fast Flow, 20 μl, 4 96-well filter plates PreDictor Q Sepharose Fast Flow, 50 μl, 4 96-well filter plates Technical data Composition highly cross-linked 6% agarose Particle size µm Binding capacity 120 mg HSA/mL drained medium Ion capacity mmol Cl - /ml medium ph stability (operational) 2 12 CIP stability (short term) 2 14 Pressure/flow spec cm/h, 100 kpa, XK 50/30 column, bed height 15 cm. Index and legal

257 Q Sepharose High Performance. See p 81, 160 Pack size 75 ml L L L Data file Regulatory support file Prepacked columns HiLoad 16/10 Q Sepharose HP, 1 20 ml HiLoad 26/10 Q Sepharose HP, 1 53 ml HiTrap Q HP, 5 1 ml HiTrap Q HP, 5 5 ml HiScreen Q HP, ml ( cm) HiTrap IEX Selection Kit, 7 1 ml PreDictor RoboColumn Q Sepharose HP, 200 μl PreDictor RoboColumn Q Sepharose HP, 600 μl Technical data Composition cross-linked agarose Particle size 34 µm median (d 50,volume ) Binding capacity 120 mg HSA/mL drained medium Ion capacity mmol Cl - /ml medium ph stability (operational) 2 12 CIP stability (short term) 2 14 Pressure/flow spec. min 75 cm/h, 250 kpa, BioPilot 60/100 column, bed height 30 cm Q Sepharose XL. See p 81, 160 Pack size 300 ml L L L Data file Regulatory support file Prepacked columns HiTrap Q XL, 5 1 ml HiTrap Q XL, 5 5 ml HiTrap IEX Selection Kit, 7 1 ml HiPrep Q XL 16/10, 1 20 ml Technical data Composition cross-linked 6% agarose with dextran coating Particle size µm Binding capacity > 130 mg bovine serum albumin/ml medium Ion capacity mmol Cl - /ml medium ph stability (operational) 2 12 CIP stability (working) 2 14 Flow rate cm/h QAE Sephadex A-25. See p 80 Pack size 100 g g kg Data file Regulatory support file Technical data Composition cross-linked dextran Particle size dry, µm ph stability (operational) 2 10 CIP stability (short term) 2 13 Pressure/flow spec. min 100 cm/h, pressure drop cm H 2 O/bed height=5, bed height 10 cm, 5 cm i.d. QAE Sephadex A-50. See p 80 Pack size 100 g kg Data file Regulatory support file Technical data Composition cross-linked dextran Particle size dry, µm ph stability (operational) 2 10 CIP stability (short term) 2 13 Pressure/flow spec. min 60 cm/h, pressure drop cm H 2 O/bed height=10, bed height 10 cm, 5 cm i.d. Sephacryl S-100 High Resolution. See p Pack size 150 ml ml L Data file Regulatory support file Prepacked columns HiPrep 16/60 Sephacryl S-100 HR, ml HiPrep 26/60 Sephacryl S-100 HR, ml Technical data Composition allyl dextran and N,N methylene bisacrylamide Particle size 50 µm Fractionation range, globular proteins to ph stability (operational) 3 11 CIP stability (short term) 2 13 Pressure/flow spec. flow at 100 kpa > 125 cm/h, XK 50/30 column, bed height 15 cm Index and legal

258 Index and legal Sephacryl S-200 High Resolution. See p Pack size 150 ml ml L L Data file Regulatory support file Prepacked columns HiPrep 16/60 Sephacryl S-200 HR, ml HiPrep 26/60 Sephacryl S-200 HR, ml Technical data Composition allyl dextran and N,N methylene bisacrylamide Particle size 50 µm Fractionation range, globular proteins to ph stability (operational) 3 11 CIP stability (short term) 2 13 Pressure/flow spec. flow at 100 kpa > 150 cm/h, XK 50/30 column, bed height 15 cm Sephacryl S-300 High Resolution. See p Pack size 150 ml ml L Data file Regulatory support file Prepacked columns HiPrep 16/60 Sephacryl S-300 HR, ml HiPrep 26/60 Sephacryl S-300 HR, ml Technical data Composition allyl dextran and N,N methylene bisacrylamide Particle size 50 µm Fractionation range, globular proteins to ph stability (operational) 3 11 CIP stability (short term) 2 13 Pressure/flow spec. flow at 100 kpa > 150 cm/h, XK 50/30 column, bed height 15 cm Sephacryl S-400 High Resolution. See p Pack size 150 ml ml L Data file Regulatory support file Prepacked columns HiPrep 16/60 Sephacryl S-400 HR, ml HiPrep 26/60 Sephacryl S-400 HR, ml Technical data Composition allyl dextran and N,N -methylene bisacrylamide Particle size 50 µm Fractionation range, globular proteins to ph stability (operational) 3 11 CIP stability (short term) 2 13 Pressure/flow spec. flow at 100 kpa > 150 cm/h, XK 50/30 column, bed height 15 cm Sephacryl S-500 High Resolution. See p Pack size 150 ml ml L Data file Regulatory support file Prepacked columns HiPrep 16/60 Sephacryl S-500 HR, ml HiPrep 26/60 Sephacryl S-500 HR, ml Technical data Composition allyl dextran and N,N -methylene bisacrylamide Particle size 50 µm Fractionation range, globular proteins not determined ph stability (operational) 3 11 CIP stability (short term) 2 13 Pressure/flow spec. flow at 100 kpa > 125 cm/h, XK 50/30 column, bed height 15 cm

259 Sephadex G-25 Coarse. See p Pack size 100 g g kg kg Data file Regulatory support file Technical data Composition cross-linked dextran Particle size dry, min 90% volume share between µm; wet (in 0.15 M NaCl), µm Fractionation range, globular proteins to ph stability (operational) 2 13 CIP stability (short term) 2 13 Pressure/flow spec cm/h, pressure drop cm H 2 O/bed height=2, bed height 30 cm, 2.6 cm i.d. Sephadex G-25 Medium. See p Pack size 25 g g g kg Data file Regulatory support file Prepacked columns Prepacked Disposable Columns PD-10, ml Technical data Composition cross-linked dextran Particle size dry, min 90% volume share between µm; wet (in 0.15 M NaCl), µm Typical flow rate 200 cm/h Fractionation range, globular proteins to ph stability (operational) 2 13 CIP stability (short term) 2 13 Pressure/flow spec cm/h, pressure drop cm H 2 O/bed height=2, bed height 30 cm, 2.6 cm i.d. Sephadex G-25 Fine. See p Pack size 100 g g kg Data file Regulatory support file Prepacked columns HiPrep 26/10 Desalting, 1 53 ml HiPrep 26/10 Desalting, 4 53 ml Technical data Composition cross-linked dextran Particle size dry, min 80% volume share between µm; wet (in 0.15 M NaCl), µm Typical flow rate 150 cm/h Fractionation range, globular proteins to ph stability (operational) 2 13 CIP stability (short term) 2 13 Pressure/flow spec cm/h, pressure drop cm H 2 O/bed height=2, bed height 30 cm, 2.6 cm i.d. Sephadex G-25 Superfine. See p Pack size 100 g g kg Data file Regulatory support file Prepacked columns HiTrap Desalting, 5 5 ml HiTrap Desalting, ml* Technical data Composition cross-linked dextran Particle size dry, min 80% volume share between µm; wet (in 0.15 M NaCl), µm. Typical flow rate 100 cm/h Fractionation range, globular proteins to ph stability (operational) 2 13 CIP stability (short term) 2 13 Pressure/flow spec cm/h, pressure drop cm H 2 O/bed height=2, bed height 30 cm, 2.6 cm i.d. *Special pack size delivered on specific customer order. Index and legal

260 Index and legal 12 Sephadex LH-20. See p 98 Pack size 25 g g g kg Data file Regulatory support file Technical data Composition hydroxypropylated, cross-linked dextran (based on Sephadex G-25) Particle size dry, min 85% volume share between µm, wet (in methanol) µm ph stability (operational) 2 13 CIP stability (short term) 2 13 Pressure/flow spec cm/h, pressure drop cm H 2 O/bed height=2, bed height 30 cm, 2.6 cm i.d. Sepharose 4B. Pack size 1 L L Regulatory support file Technical data Composition 4% agarose Particle size µm Fractionation range, globular proteins to ph stability (operational) 4 9 CIP stability (short term) 4 9 Pressure/flow spec cm/h, pressure drop cm H 2 O/bed height=15, bed height 10 cm, column 5 cm i.d. Sepharose 6B. Pack size 1 L L Regulatory support file Technical data Composition 6% agarose Particle size µm Fractionation range, globular proteins to ph stability (operational) 4 9 CIP stability (short term) 4 9 Pressure/flow spec cm/h, pressure drop cm H 2 O/bed height=15, bed height 10 cm, 5 cm i.d. Sepharose CL-2B. See p 99 Pack size 1 L L Regulatory support file Technical data Composition Particle size µm cross-linked 2% agarose Fractionation range, globular proteins to ph stability (operational) 3 13 CIP stability (short term) 2 14 Pressure/flow spec cm/h, pressure drop cm H 2 O/bed height=15, bed height 10 cm, 5 cm i.d. Sepharose CL-4B. Pack size 1 L L Regulatory support file Technical data Composition Particle size µm cross-linked 4% agarose Fractionation range, globular proteins to ph stability (operational) 3 13 CIP stability (short term) 2 14 Pressure/flow spec cm/h, pressure drop m H 2 O/bed height=15, bed height 10 cm, column 5 cm i.d. Sepharose CL-6B. Pack size 1 L L Regulatory support file Technical data Composition Particle size µm cross-linked 6% agarose Fractionation range, globular proteins to ph stability (operational) 3 13 CIP stability (short term) 2 14 Pressure/flow spec cm/h, pressure drop cm H 2 O/bed height=15, bed height 10 cm, column 5 cm i.d

261 Sepharose 4 Fast Flow. See p Pack size 1 L L Data file Regulatory support file Technical data Composition Particle size µm highly cross-linked 4% agarose ph stability (operational) 3 13 CIP stability (short term) 2 14 Pressure/flow spec cm/h, 100 kpa, XK 50/60 column, bed height 25 cm Sepharose 6 Fast Flow. See p Pack size 1 L L Data file Regulatory support file Technical data Composition Particle size µm highly cross-linked 6% agarose ph stability (operational) 3 13 CIP stability (short term) 2 14 Pressure/flow spec cm/h, 100 kpa, XK 50/60 column, bed height 25 cm SOURCE 15ETH. Pack size 50 ml ml L Data file Regulatory support file Prepacked columns RESOURCE ETH, 1 ml RESOURCE HIC Test kit Technical data Composition Particle size polystyrene/divinylbenzene 15 µm monosized Typical flow rate cm/h ph stability (operational) 2 12 CIP stability (short term) 1 14 Pressure/flow spec. 400 cm/h, 1000 kpa, FineLINE 100 column, bed height 10 cm, i.d. 10 cm SOURCE 15ISO. Pack size 50 ml ml L Data file Regulatory support file Prepacked columns RESOURCE ISO, 1 ml RESOURCE HIC Test kit Technical data Composition Particle size polystyrene/divinylbenzene 15 µm monosized Typical flow rate cm/h ph stability (operational) 2 12 CIP stability (short term) 1 14 Pressure/flow spec. 400 cm/h, 1000 kpa, FineLINE 100 column, bed height 10 cm, i.d. 10 cm SOURCE 15PHE. Pack size 50 ml ml L L Data file Regulatory support file Prepacked columns RESOURCE PHE, 1 ml RESOURCE HIC Test kit SOURCE 15PHE PE 4.6/ Technical data Composition Particle size polystyrene/divinylbenzene 15 µm monosized Typical flow rate cm/h ph stability (operational) 2 12 CIP stability (short term) 1 14 Pressure/flow spec. 400 cm/h, 1000 kpa, FineLINE 100 column, bed height 10 cm, i.d. 10 cm Index and legal

262 SOURCE 15Q. See p 79, 81 Pack size 10 ml ml ml ml L Regulatory support file Prepacked columns RESOURCE Q, 1 ml RESOURCE Q, 6 ml SOURCE 15Q 4.6/100 PE Technical data Ion exchanger type Composition Particle size Quaternary ammonium strong anion exchanger polystyrene/divinylbenzene 15 µm monosized Binding capacity 45 mg BSA/mL drained medium Typical flow rate cm/h ph stability (operational) 2 12 CIP stability (short term) 1 14 Pressure/flow spec. 400 cm/h, 1000 kpa, FineLINE 100 column, bed height 10 cm, i.d. 10 cm SOURCE 15RPC. See p 95 Pack size 10 ml ml ml L L Regulatory support file Prepacked columns RESOURCE RPC, 1 ml RESOURCE RPC, 3 ml SOURCE 15 RPC ST 4.6/ Technical data Composition Particle size polystyrene/divinylbenzene 15 µm monosized Binding capacity ~ 10 mg BSA/mL medium at 300 cm/h ~ 30 mg bacitracin/ml medium at 300 cm/h ~ 50 mg insulin/ml medium at 300 cm/h Typical flow rate cm/h ph stability (operational) 1 12 CIP stability (short term) 1 14 Pressure/flow spec. 400 cm/h, 1000 kpa, FineLINE 100 column, bed height 10 cm, i.d. 10 cm Index and legal SOURCE 30Q. See p 81, 160 Pack size 50 ml ml L L Data file Regulatory support file Technical data Ion exchanger type Composition Particle size Quaternary ammonium strong anion exchanger polystyrene/divinylbenzene 30 µm monosized Binding capacity 40 mg BSA/mL drained medium Typical flow rate cm/h ph stability (operational) 2 12 CIP stability (short term) 1 14 Pressure/flow spec cm/h, 1000 kpa, FineLINE 100 column, bed height 10 cm, i.d. 10 cm SOURCE 30RPC. See p 95 Pack size 10 ml ml ml L L Data file Regulatory support file Technical data Composition Particle size polystyrene/divinylbenzene 30 µm monosized Binding capacity ~ 14 mg BSA/mL medium at 300 cm/h ~ 23 mg bacitracin/ml medium at 300 cm/h ~ 72 mg insulin/ml medium at 300 cm/h Typical flow rate cm/h ph stability (operational) 1 12 CIP stability (short term) 1 14 Pressure/flow spec cm/h, 1000 kpa, FineLINE 100 column, bed height 10 cm, i.d. 10 cm

263 SOURCE 15S. See p 79, 81 Pack size 10 ml ml ml ml L Regulatory support file Prepacked columns RESOURCE S, 1 ml RESOURCE S, 6 ml SOURCE 15S 4.6/100 PE Technical data Ion exchanger type Sulfonate strong cation exhanger Composition polystyrene/divinylbenzene Particle size 15 µm monosized Binding capacity 75 mg lysozyme/ml drained medium Typical flow rate cm/h ph stability (operational) 2 13 CIP stability (short term) 1 14 Pressure/flow spec. 400 cm/h, 1000 kpa, FineLINE 100 column, bed height 10 cm, i.d. 10 cm SP Sepharose Big Beads. See p 80, 160 Pack size 1 L L L IEX Selection Kit Data file Regulatory support file Technical data Composition Particle size µm Ion capacity highly cross-linked 6% agarose mmol H + /ml medium ph stability (operational) 4 13 CIP stability (short term) 3 14 Pressure/flow spec cm/h, 100 kpa, XK 50/60 column, bed height 25 cm SOURCE 30S. See p 81 Pack size 50 ml ml L L Data file Regulatory support file Technical data Ion exchanger type Sulfonate strong cation exhanger Composition polystyrene/divinylbenzene Particle size 30 µm monosized Binding capacity 80 mg lysozyme/ml drained medium Typical flow rate cm/h ph stability (operational) 2 13 CIP stability (short term) 1 14 Pressure/flow spec cm/h, 1000 kpa, FineLINE 100 column, bed height 10 cm, i.d. 10 cm Index and legal

264 SP Sepharose Fast Flow. See p 81, 160 Pack size 25 ml ml L L L IEX Selection Kit Data file Regulatory support file Prepacked columns HiTrap SP FF, 5 1 ml HiTrap SP FF, 5 5 ml HiScreen SP FF, ml ( cm) HiTrap IEX Selection Kit, 7 1 ml PreDictor RoboColumn SP Sepharose FF, 200 μl PreDictor RoboColumn SP Sepharose FF, 600 μl HiPrep SP FF 16/10, 1 20 ml ReadyToProcess SP Sepharose FF 1, 1 L ReadyToProcess SP Sepharose FF 2.5, 2.5 L ReadyToProcess SP Sepharose FF 10, 10 L ReadyToProcess SP Sepharose FF 20, 20 L well filter plates PreDictor SP Sepharose Fast Flow, 6 µl, 4 96-well filter plates PreDictor SP Sepharose Fast Flow, 20 µl, 4 96-well filter plates PreDictor SP Sepharose Fast Flow, 50 µl, 4 96-well filter plates Technical data Composition highly cross-linked 6% agarose Particle size µm Binding capacity 120 mg BSA/mL drained medium Ion capacity mmol H + /ml medium ph stability (operational) 4 13 CIP stability (short term) 3 14 Pressure/flow spec cm/h, 100 kpa, XK 50/30 column, bed height 15 cm SP Sepharose High Performance. See p 81, 160 Pack size 75 ml L L L L Data file Regulatory support file Prepacked columns HiLoad 16/10 SP Sepharose HP, 1 20 ml HiLoad 26/10 SP Sepharose HP, 1 53 ml HiTrap SP HP, 5 1 ml HiTrap SP HP, 5 5 ml HiScreen SP HP, ml ( cm) HiTrap IEX Selection Kit, 7 1 ml PreDictor RoboColumn SP Sepharose HP, 200 μl PreDictor RoboColumn SP Sepharose HP, 600 μl Technical data Composition highly cross-linked 6% agarose Particle size 34 µm median (d 50,volume ) Binding capacity 55 mg Ribonuclease/mL drained medium Ion capacity mmol H + /ml medium ph stability (operational) 4 13 CIP stability (short term) 3 14 Pressure/flow spec. min 100 cm/h, 250 kpa, BioPilot 60/100 column, bed height 30 cm Index and legal

265 SP Sepharose XL. See p 81, 160 Pack size 300 ml L L Data file Regulatory support file Prepacked columns HiTrap SP XL, 5 1 ml HiTrap SP XL, 5 5 ml HiTrap IEX Selection Kit, 7 1 ml HiPrep SP XL 16/10, 1 20 ml Technical data Composition cross-linked 6% agarose with dextran coating Particle size µm Binding capacity > 160 mg lysozyme/ml medium Ion capacity mmol H + /ml medium ph stability (operational) 4 13 CIP stability (working) 3 14 Flow rate cm/h Superdex 30 prep grade. See p Pack size 25 ml ml L L Data file Regulatory support file Prepacked columns HiLoad 16/600 Superdex 30 pg, ml HiLoad 26/600 Superdex 30 pg, ml Technical data Composition composite of cross-linked agarose and dextran Particle size 34 µm Fractionation range, globular proteins up to ph stability (operational) 3 12 CIP stability (short term) 1 14 Max pressure 300 kpa Superdex 75 prep grade. See p Pack size 25 ml ml L L Data file Regulatory support file Prepacked columns HiLoad 16/600 Superdex 75 pg, ml HiLoad 26/600 Superdex 75 pg, ml Technical data Composition composite of cross-linked agarose and dextran Particle size 34 µm Fractionation range, globular proteins to ph stability (operational) 3 12 CIP stability (short term) 1 14 Max pressure 300 kpa Superdex 200 prep grade. See p Pack size 25 ml ml L L L L Data file Regulatory support file Prepacked columns HiLoad 16/600 Superdex 200 pg, ml HiLoad 26/600 Superdex 200 pg, ml Technical data Composition composite of cross-linked agarose and dextran Particle size 34 µm Fractionation range, globular proteins to Flow rate cm/h ph stability (operational) 3 12 CIP stability (short term) 1 14 Max pressure 300 kpa Index and legal

266 Solid supports for oligonucleotide synthesis. Oligosynt, disposable columns with Primer Support 200. See p 215 Product Oligosynt da 15 µmol µmol µmol Oligosynt dc 15 µmol µmol µmol Oligosynt dg 15 µmol µmol µmol Oligosynt T 15 µmol µmol µmol Technical data Composition spherical, porous and monodispersed divinylbenzene cross-linked polystyrene particles Particle size 30 µm (retains size in all oligonucleotide synthesis reagents) Swelling volume in acetonitrile 4.8 ml/g Particle size distribution Max 5% CV Storage 4 C to 30 C Degree of nucleoside substitution 40 ± 4 μmol/g Primer Support 5G. See p 214 Product DNA 350 Primer Support 5G da 350, 1 mmol Primer Support 5G da 350, 10 mmol Primer Support 5G dc 350, 1 mmol Primer Support 5G dc 350, 10 mmol Primer Support 5G dg 350, 1 mmol Primer Support 5G dg 350, 10 mmol Primer Support 5G T 350, 1 mmol Primer Support 5G T 350, 10 mmol Primer Support 5G Unylinker 350, 1 mmol Primer Support 5G Unylinker 350, 10 mmol RNA 300 Primer Support 5G ribo A 300, 1 mmol Primer Support 5G ribo A 300, 10 mmol Primer Support 5G ribo C 300, 1 mmol Primer Support 5G ribo C 300, 10 mmol Primer Support 5G ribo G 300, 1 mmol Primer Support 5G ribo G 300, 10 mmol Primer Support 5G ribo U 300, 1 mmol Primer Support 5G ribo U 300, 10 mmol Primer Support 5G Universal 300, 1 mmol Primer Support 5G Universal 300, 10 mmol Primer Support 5G T 300, 1 mmol Primer Support 5G T 300, 10 mmol Technical data Composition porous and polydispersed divinylbenzene cross-linked polystyrene particles Particle size µm ( mesh) Matrix cross-linked polystyrene/ divinylbenzene Recommended column packing volume 111 mg/ml (9 ml/g) Swelling volume in acetonitrile 3.5 ml/g Swelling volume in toluene 7.5 ml/g Storage 4 C to 30 C Degree of nucleoside substitution up to 400 μmol/g Max recommended bed height 10 cm Index and legal

267 Index and legal

268 Terms and conditions of sale / Trademarks / Licensing information Unless otherwise agreed in writing all goods and services are sold subject to the following terms and conditions. Any use of commercially available software is subject to GE Healthcare Standard Software End-User License Agreement for Life Sciences Software Products. In no event shall the products be used for in vivo applications. Any warranty granted by GE Healthcare shall be deemed void if any goods covered by such warranty are used for any purpose not permitted hereunder. For the latest information on our terms and conditions of sale, trademarks, patent and licensing please go to our website GE Healthcare Bio-Sciences AB General Electric Company All rights reserved. Terms and conditions of sale Index and legal General 1.1 In these Terms and Conditions: The Buyer means the person, firm, company or other organization who or which has ordered Products and/or Services from GEHC; GEHC means the GE Healthcare group company referred to in the final written offer, quotation or order acknowledgement or, if none, the GE Healthcare company making the supply; The Contract means the contract for the sale and purchase of Products and/or Services between GEHC and the Buyer as may be further evidenced by GEHC s final written offer, quotation or order acknowledgement and no prior proposals, statements, representations or conditions will be binding on either party; The Equipment means all electronic equipment, hardware and other electronic or mechanical items agreed to be supplied by GEHC, excluding any consumables and spare parts sold separately; The Goods means all items agreed to be supplied by GEHC other than the Equipment and Software; The Products means any Goods, Equipment or Software agreed to be supplied by GEHC; and The Services means all advice given and services performed by GEHC; and The Software means any firmware, software or data compilations (i) identified in the Contract or (ii) provided to Buyer by GEHC in connection with installation or operation of the Equipment. For the avoidance of doubt, Software shall not include any open source firmware, software or data compilations, as any such open source firmware, software or data compilations will be subject to the terms and conditions set out in the relevant open source license. 1.2 These Terms and Conditions shall be incorporated into the Contract and shall apply to the exclusion of any conditions of the Buyer. These Terms and Conditions may not be varied or waived except with the express written agreement of GEHC. The failure of GEHC to enforce its rights under the Contract at any time, for any period of time, shall not be construed as a waiver of any such rights. 2. Prices and Quotations The price of the Products and/or Services will be GEHC s quoted price, inclusive of any duties, but exclusive of value added or other taxes. All quotations issued by GEHC for the supply of Products and/or Services shall remain open for acceptance for the period stated in the quotation or, if none is stated, for sixty (60) days. In all other cases, prices payable are those currently in effect in GEHC s then current pricelist, which may include charges for handling, freight, packaging, insurance and minimum orders. 3. Payment 3.1 Unless otherwise agreed in writing, payment in full shall be made to GEHC in the currency invoiced, no later than thirty (30) days from the date of invoice. 3.2 In the event of late payment, GEHC reserves the right: (i) to suspend deliveries and/or cancel any of its outstanding obligations; and (ii) to charge interest at the lower of (a) an annual rate equal to twelve (12) % and (b) any applicable maximum statutory rate on all unpaid amounts calculated on a day to day basis until the actual date of payment. 4. Changes and Returns 4.1 GEHC reserves the right, subject to prior written notice, to make any change in the specification of the Products, which does not materially affect the installation, performance or price thereof. 4.2 Products may only be returned with prior authorization from GEHC

269 5. Delivery/Installation/Acceptance 5.1 Any term of delivery shall be construed according the latest edition of Incoterms. If no other term of delivery has been specified in the Contract the Products will be delivered CIP to Buyer s premises or to the agreed destination. 5.2 Partial deliveries shall be permitted. If the Buyer fails to accept delivery of the Products within a reasonable period after receiving notice from GEHC that they are ready for delivery, GEHC may dispose of or store the Products at the Buyer s expense. 5.3 GEHC will use all reasonable endeavours to avoid delay in delivery on the notified delivery dates. Failure to deliver by the specified date will not be a sufficient cause for cancellation, nor will GEHC be liable for any loss or damage due to delay in delivery. 5.4 The Buyer shall notify GEHC in writing within five (5) working days of delivery of any short delivery or defects reasonably discoverable on careful examination. GEHC s sole obligation shall be, at its option, to replace or repair any defective Products or refund the purchase price of any undelivered Products. 5.5 Where delivery of any Product requires an export license or other authorization before shipment, GEHC shall not be responsible for any delay in delivery due to delay in, or refusal of, such license or authorization. 5.6 Where the Equipment requires installation, the Buyer shall be responsible at its own cost for making the place where the Equipment will be located ready for installation in accordance with GEHC s instructions. Installation will not begin unless such responsibilities are completed. 5.7 Following installation, and where applicable, GEHC will proceed with final testing using GEHC s published performance specifications and using its standard instruments and procedures. Upon the satisfactory completion of such final testing demonstrating compliance with the above specifications (with any permitted variations/tolerances) GEHC may issue a Test Certificate which shall be conclusive evidence of such compliance and thereupon installation of the Equipment shall be deemed to be complete and in compliance with GEHC s obligations under the Contract. In any event Buyer agrees that the Equipment is accepted (i) seven (7) days after the date on which GEHC notifies Buyer that final testing was successfully completed, or issues the Test Certificate or (ii) on the date Buyer first uses the Equipment for operational use, whichever is earlier. 5.8 Buyer, at its reasonable request, shall be entitled to be present at and to witness the testing and shall not be entitled to raise any objection to testing carried out, or to the results thereof, if Buyer failed to attend when advised that testing was to take place. 5.9 Where Products are supplied by GEHC in returnable containers, these must be returned at the Buyer s expense and in good condition, if requested by GEHC. Title to these containers shall remain with GEHC at all times, but they shall be held at the risk of the Buyer until returned to GEHC. Failure by the Buyer to comply with the above provision shall entitle GEHC to invoice the Buyer for the full replacement value of the containers. 6. Risk and Title 6.1 The risks of loss of and damage to the Products shall transfer to Buyer in accordance with agreed delivery term. Full title to the Goods and Equipment shall pass to the Buyer on full payment. 6.2 In relation to any Equipment used for clinical or diagnostic purposes, the Buyer shall keep adequate written records of the identity of any person or entity to whom the Equipment is transferred and of the location of such Equipment and shall procure that any purchaser of such Equipment is subject to the same requirement in respect of any onward sales. 7. Services 7.1 Where GEHC is to provide Services, the Buyer shall ensure that adequate and safe facilities exist at its premises and that GEHC is properly notified of any relevant regulations. 7.2 If the Buyer has purchased a Product or Service including remote access support, the Buyer shall permit GEHC to connect to the Products by remote access as may be beneficial to the performance of maintenance or repair activities as part of GEHC s warranty obligations or otherwise. This may include automatic software downloads and proactive monitoring and access to performance data related to the products, to gather and use products- and resource usage data in various ways such as product development, quality initiatives, benchmarking and reporting services. The data collected by GEHC will be used, during and after the term of this agreement, in accordance with all applicable laws and regulations and in a manner that will maintain confidentiality. 8. Restricted Use 8.1 With respect to certain Products, use restrictions are a condition of the purchase which Buyer must satisfy by strictly abiding by the restriction as set forth in GEHC s catalogue and/or on the Product and/or accompanying documentation. Buyer is solely liable to ensure compliance with any regulatory requirements related to the Buyer s use of the Products. Any warranty granted by GEHC to the Buyer shall be deemed void if any Products covered by such warranty are used for any purpose not permitted hereunder. In addition, the Buyer shall indemnify GEHC and hold GEHC harmless from and against any and all claims, damages, losses, costs, expenses and other liability of whatever nature that GEHC suffers or incurs by reason of any such unintended use. 8.2 With respect to Products regulatory approved for clinical and medical treatment and diagnostic use, any decisions relating to such treatment and use shall be at the risk of the Buyer and the respective healthcare providers. 9. General Warranty 9.1 Section shall apply in the event no other specific warranty has been agreed in the Contract. As regards any Products covered by a warranty issued by a third party manufacturer, such warranty terms shall apply to the exclusion of Section Goods - GEHC warrants that its Goods meet GEHC s specifications at the time of delivery. All warranty claims on Goods must be made in writing within ninety (90) days of receipt of the Goods. GEHC s sole liability and Buyer s exclusive remedy for a breach of this warranty is limited to repair, replacement or refund at the sole option of GEHC. 9.3 Equipment - GEHC s Equipment of its own manufacture is warranted from date of delivery or GEHC completing any agreed installation works, if later, to be free of defects in workmanship or materials under normal usage for a period of one (1) year and any claim shall be submitted in writing within such period. GEHC s sole liability and Buyer s exclusive remedy for a breach of this warranty is limited to repair, replacement or refund at the sole option of GEHC. Such repairs or replacement will not extend the warranty period. 9.4 Software GEHC warrants, for a period which is the longer of: (i) three (3) months from the date of delivery or; (ii) in the event the Software is intended to be installed and run on GEHC s Equipment of its own manufacture, twelve (12) months from the date of delivery, that the Software substantially conforms to its published specifications and that the media on which the Software resides will be free from defects in materials and workmanship under normal use and any claim shall be submitted in writing within such period. GEHC does not warrant that the Software is error free or that Buyer will be able to operate the Software without problems or interruptions. GEHC s sole liability and Buyer s exclusive remedy in the event of breach of this warranty is limited to repair, replacement or refund, at the sole option of GEHC. 9.5 Services - GEHC warrants that all Services will be carried out with reasonable care and skill. GEHC s sole liability for breach of this warranty shall be at its option to give credit for or re-perform the Services in question. This warranty shall only extend for a period of ninety (90) days after the completion of the Services and any claim shall be submitted in writing within such period. 9.6 To the maximum extent permitted by applicable law GEHC hereby expressly disclaims, and Buyer hereby expressly waives, any warranty regarding results obtained through the use of the Products, including without limitation any claim of inaccurate, invalid, or incomplete results. All other warranties, representations, terms and conditions (statutory, express, implied or otherwise) as to quality, condition, description, merchantability, fitness for purpose or non-infringement (except for the implied warranty of title) are hereby expressly excluded. 9.7 Unless expressly agreed, GEHC is not obliged to carry out dismantling or re-installation of any Product in connection with any warranty claims. Index and legal

270 Index and legal Limitation of Liability 10.1 GEHC shall have no liability under the warranties contained in Section 9 in respect of any defect in the Products arising from: specifications or materials supplied by the Buyer; fair wear and tear; wilful damage or negligence of the Buyer or its employees or agents; abnormal working conditions at the Buyer s premises; failure to follow GEHC s use restrictions or instructions (whether oral or in writing); misuse or alteration or repair of the Products without GEHC s approval; or if the Buyer is in breach of its payment obligations under this Contract Subject to any express obligation to indemnify, neither party shall be liable for any indirect or consequential, or punitive damages of any kind from any cause arising out of the sale, installation, use or inability to use any Product or Service, nor for, without limitation, loss of profits, goodwill or business interruption The total liability of GEHC arising under or in connection with the Contract, including for any breach of contractual obligations and/or any misrepresentation, misstatement or tortious act or omission (including without limitation, negligence and liability for infringement of any third party intellectual property rights) shall be limited to damages in an amount equal to the amount paid to GEHC under the Contract The exclusion of liability in these Terms and Conditions shall only apply to the extent allowed according to applicable law. 11. Intellectual Property Rights 11.1 Where the Buyer supplies designs, drawings, and specifications to GEHC to enable it to manufacture non-standard or custom made Products, the Buyer warrants that such manufacture will not infringe the intellectual property rights of any third party All intellectual property rights in the Products and/or Services shall at all times remain vested in GEHC or its licensors. 12. Health and Safety The Buyer shall ensure that: (i) the Products (provided such Products comply with its specifications) are suitable and safe for the Buyer s intended use; (ii) the Products are handled in a safe manner. (iii) containers, packaging, labelling, equipment and vehicles, where provided by the Buyer, comply with all relevant national and international safety regulations. 13. Indemnities Except where a claim arises as a direct result of the negligence or breach of contract of GEHC, the Buyer shall indemnify GEHC in respect of any claim which may be made against GEHC: (i) arising in connection with the Buyer s unintended use of the Products; (ii) alleging that the Buyer s use of the Products infringes the intellectual property rights of any third party. 14. Insolvency In the event that the Buyer becomes insolvent or applies for bankruptcy or, being a company, goes into liquidation (other than for the purposes of reconstruction or amalgamation), GEHC shall be entitled immediately to terminate the Contract without notice and without prejudice to any other rights of GEHC hereunder. 15. Force Majeure 15.1 A party shall not be liable in respect of the non-performance of any of its obligations to the extent such performance is prevented by any circumstances beyond its reasonable control including but not limited to, strikes, lock outs or labour disputes of any kind (whether relating to its own employees or others), fire, flood, explosion, natural catastrophe, military operations, blockade, sabotage, revolution, riot, civil commotion, war or civil war, acts or threats of terrorism, plant breakdown, computer or other equipment failure and inability to obtain equipment If an event of force majeure exceeds one (1) month a Party may cancel the Contract without liability. 16. Software License Unless a separate software license agreement has been concluded concerning the Software, the Buyer is hereby granted a non exclusive license to use the Software solely in object code format and solely for its own internal business purposes subject to the terms contained herein. The Buyer shall not (i) use the Software for purposes other than those for which it was designed; (ii) use the Software in connection with other manufacturers products unless such connectivity is authorized in the Product documentation; (iii) grant, assign, transfer, or otherwise make available to third parties any right whatsoever in the Software; (iv) disclose to third parties any information contained in the Software; (v) copy or reproduce the Software (except for one copy for back-up purposes or as may otherwise be permitted by applicable law); (vi) alter or modify the Software; or (vii) reverse engineer, decompile, disassemble or create any derivative works based upon the Software except as expressly permitted by mandatory law. 17. Export control The Buyer undertakes not to re-export the Products without the requisite export license from the relevant body of the United Nations or other similar international organization, the United States Government, the country of origin or the original country of export. The requirement to obtain a license may vary depending on the country of destination, the end user, the end use and other factors. Upon request from GEHC the Buyer shall furnish GEHC with copies of all documents relating to such re-export. 18. Waste Electrical and Electronic Equipment (WEEE) Where the Buyer sells, disposes of or otherwise transfers the Equipment to any third party and where this would unreasonably increase the cost of the collection, treatment or recycling of the Equipment for GEHC under applicable WEEE legislation, Buyer shall be liable to GEHC and indemnify GEHC for such increased costs Should the Equipment that Buyer acquires from GEHC be Equipment, which is intended to replace on a like for like -basis, any item of Buyer s existing equipment (e.g. the new Equipment is of an equivalent type or is fulfilling the same function as Buyer s existing equipment) Buyer must in respect of such existing equipment have clearly indicated to GEHC the following: the brand, type, age, condition, current use and the exact location and all other relevant information. In the event Buyer has not complied with such obligations, GEHC may charge Buyer such reasonable additional fees to reflect any related obligations it may have under national legislation regarding the recycling, reuse and/or disposal of such existing equipment and related costs it may incur Unless the relevant mandatory national legislation provides otherwise, or unless otherwise agreed in writing, GEHC s obligation does not include without limitation, creation of physical access to the equipment; de-installation; decoupling; disinfecting; craning/lifting; transportation to a ground level loading area or -ramp; packing; or any related similar activities; and Buyer agrees to perform such activities at its own cost as and when required. 19. Governing Law This Contract shall be governed by and construed in accordance with the substantive laws of the country or state where the GE Healthcare group company (or relevant branch) office referred to in the Contract is situated and the parties hereby submit to the non-exclusive jurisdiction of the courts of that country or state. 20. Product-Specific Terms and Conditions Additional terms and conditions govern the sale of certain Products and Services. These additional terms and conditions are available from the sales offices of GEHC and shall take precedence in the event of any inconsistency with these Terms and Conditions. 21. Translations and Local Variations Translations of these terms and conditions are available from the sales offices of GEHC. In some territories, local variations to these Terms and Conditions may apply. If so, such variations shall take precedence in the event of any inconsistency with these Terms and Conditions

271 Trademarks GE Healthcare trademarks ÄKTA, ÄKTAcrossflow, ÄKTAexplorer, ÄKTApilot, ÄKTAprime, ÄKTAprocess, ÄKTApurifier, AxiChrom, Biacore, BioPilot, BioProcess, BPG, Capto, Cellbag, Chromaflow, Cytodex, Cytoline, Cytopore, Downstream, Drop Design, FineLINE, GammaBind, Grandstand, GSTrap, GSTPrep, GraviTrap, HiLoad, HiPrep, HiScale, HiScreen, HisPrep, HisTrap, HiTrap, Kvick, Kvick Flow, Kvick Lab, Kvick Start, MabSelect, MabSelect Xtra, MabSelect SuRe, MacroCap, Media Wand, MidGee, MultiTrap, OligoProcess, Oligosynt, Primer Support, ReadyCircuit, ReadyMate, ReadyToProcess, RESOURCE, Sephacryl, Sephadex, Sepharose, SOURCE, Superdex, Superose, Tricorn, ULTA, UNICORN, UniFlux, WAVE Bioreactor, WAVE Mixer, WAVEPOD, and Xampler are trademarks of GE Healthcare companies. GE, imagination at work, and the GE monogram are trademarks of General Electric Company. Trademarks owned by other companies Other trademarks, registered trademarks, product names, and company names or logos displayed in the catalogue are the property of their respective owners. Licensing information ÄKTA oligopilot and OligoPilot 400 ÄKTA oligopilot and OligoPilot 400 are covered by US patent number 5,807,525 and equivalent patents and patent applications in other countries. Post-synthesis procedures for selective deprotection of oligonucleotides on solid supports is covered by US patent number 6,887,990 and equivalent patents and patent applications in other countries, and a license thereto is only given when synthesis of oligonucleotides is performed on GE Healthcare instruments. No other license is granted to the purchaser either directly or by implication, estoppel or otherwise. ÄKTA ready High Flow Kit and ÄKTA ready Low Flow Kit The use of ÄKTA ready High Flow Kit and Low Flow Kit may require a license under the following US patents and their equivalents in other countries: US patent numbers 6,712,963 and 7,052,603 (assignee: SciLog, Inc.). A free, non-transferable license limited to using these products under above mentioned patents accompanies the purchase of the product from any GE Healthcare company and its licensed distributors. Disposable Aseptic Connector This product is sold under licence from Johnson & Boley Holdings, LLC. under US patent number 6,679,529. GST Gene Fusion Vectors A license for commercial use of GST Gene Fusion Vectors under US patent 5,654,176 and equivalent patents and patent applications in other countries must be obtained from Millipore Corp (formerly Chemicon International Inc.). IMAC Sepharose products, Ni Sepharose products and Fe Sepharose products These products are sold under license from Sigma-Aldrich under patent number EP (Metal chelating compositions) and equivalent patents and patent applications in other countries. KappaSelect KappaSelect incorporates BAC BV's proprietary ligand technology, which has been exclusively licensed to GE Healthcare for affinity separation. Other uses of this product may require a separate license from BAC BV, Huizerstraatweg 28, 1411 GP Naarden, The Netherlands. OligoProcess OligoProcess is covered by US patent numbers 5,807,525 and 5,641,459, and equivalent patents and patent applications in other countries. Postsynthesis procedures for selective deprotection of oligonucleotides on solid supports is covered by US patent number 6,887,990 and equivalent patents and patent applications in other countries, and a license thereto is only given when synthesis of oligonucleotides is performed on GE Healthcare instruments. No other license is granted to the purchaser either directly or by implication, estoppel or otherwise. Plasminogen Removal Gel The Plasminogen Removal Gel is subject to EP and its foreign equivalents, and other intellectual property rights owned by OMRIX Biopharmaceuticals S.A, Belgium ( OMRIX ). Any customer wishing to use Plasminogen Removal Gel for any purpose falling under any valid claims of the said patent rights other than for research purposes needs prior to such use to (a) contact OMRIX directly and (b) sign a license agreement with OMRIX. Primer Support 200 Primer Support 200 is covered by US patent number 6,335,438 and equivalent patents and patent applications in other countries. Butyl-S Sepharose 6 Fast Flow Separating Miraculin with this product is subject to US patent number 5,886,155. Licenses are available from BioResources International, Inc., of Somerset, N.J., U.S.A. IMAC Sepharose 6 Fast Flow, Chelating Sepharose Fast Flow and Ni Sepharose 6 Fast Flow (Histidine-tagged protein purification, Bioprocess products) US patent numbers 5,284,933 and 5,310,663, and equivalent patents and patent applications in other countries (assignee: Hoffman La Roche, Inc) relate to the purification and preparation of fusion proteins and affinity peptides comprising at least two adjacent histidine residues (commonly known as the histidine-tag technology). Any customer that wishes to use Chelating Sepharose Fast Flow, Ni Sepharose 6 Fast Flow or IMAC Sepharose 6 Fast Flow for non-research/ commercial applications under these patents is requested to contact Hoffman-La Roche AG, Corporate licensing, attention Dr Andreas Maurer, CH-4070 Basel, Switzerland, telephone , fax , for the purpose of obtaining a license. ReadyMate ReadyMate is covered by US patent No 6,679,529 B2 owned by Johnson & Boley Holdings, LLC and licensed to GE Healthcare companies. VIIISelect VIIISelect incorporates BAC BV s proprietary ligand technology, which has been exclusively licensed to GE Healthcare in the field of purification of beta domain depleted recombinant factor VIII. Other use of this product may require a separate license from BAC BV, Huizerstraatweg 28, 1411 GP Naarden, The Netherlands. Index and legal

272 Alphabetical index Index and legal A A Z of media and chemicals 234 ActiCHO Media System 30 Affinity chromatography 82 Affinity media Product application guide 86 6-AKS Sepharose 4 Fast Flow 86, 101, 234 ÄKTA avant system 140 ÄKTAcrossflow system 194 ÄKTA oligopilot plus 211 ÄKTApilot system 141 ÄKTAprocess system 142 ÄKTA ready system 71 Alpha-1 Antitrypsin Select 101, 234 Amino Sepharose 6 Fast Flow 86, 101, 234 Anion exchanger groups 77 Antibody fragments 85 ANX Sepharose 4 Fast Flow (high sub) 81, 160, 234 ANX Sepharose 4 Fast Flow (low sub) 235 Application notes 231 Application services - Fast Trak 220 AVB Sepharose High Performance 86, 235 AxiChrom columns 106 B Benzamidine Sepharose 4 Fast Flow (high sub) 86, 235 Benzamidine Sepharose 4 Fast Flow (low sub) 235 Biacore systems 202 Biacore C 204 Biacore system validation support 205 Biacore T BioProcess Media 76 Blue Sepharose 6 Fast Flow 82, 86, 235 Books Handbook of Process Chromatography 231 Protein Purification Principles 231 BPG columns 114 Butyl Sepharose 4 Fast Flow 88 89, 160, 236 Butyl Sepharose High Performance 88 89, 160, 236 Butyl-S Sepharose 6 Fast Flow 88 89, 160, 237 C Capto media 78, 91 Capto adhere 81, 92, 160, 237 Capto Blue 82, 86, 238 Capto Blue (hs) 101, 238 Capto Butyl 89, 238 Capto Core , 238 Capto DEAE 78 81, 160, 239 Capto L 82, 84 86, 239 Capto MMC 81, 91, 160, 240 Capto Octyl 89, 101, 240 Capto Phenyl (high sub) 89, 240 Capto, PreDictor 96-well filter plates 155 Capto, Prepacked columns 157 Capto Q 78 81, 160, 241 Capto Q ImpRes 78 80, 241 Capto S 78 81, 160, 242 Capto, Selection kits 160 Capto SP ImpRes 78 80, 242 Cassettes and holders See Cross flow filtration Cation exchanger groups 77 CBS See Customized BioProcess Solutions CDM See Custom Designed Media CELL1 - Fast Trak course 222 Cellbag bioreactors 45 Cell culture 26 Media, sera and reagents 28 ActiCHO Media System 30 Microcarrier 31 Cytodex 31 Cytoline 31 Cytopore 31 Change Control Notifications 205, 226 Chelating Sepharose Big Beads 101, 242 Chelating Sepharose Fast Flow 82, 86, 243 Chromaflow columns 110 Chromatography columns 102 Chromatography media 74, 229, 234 Chromatography media toolbox 92 Chromatography systems

273 CM Sephadex C-25 80, 243 CM Sephadex C-50 80, 243 CM Sepharose Fast Flow 81, 160, 243 CM Sepharose High Performance 81, 243 CNBr-activated Sepharose 4B 244 CNBr-activated Sepharose 4 Fast Flow 82, 86, 244 COL1 - Fast Trak course 222 Columns for oligonucleotide synthesis 213 Columns for process chromatography 104 AxiChrom 106 BPG 114 Chromaflow 110 Custom products 134 FineLINE 126 HiScale 132 INdEX 122 Columns, prepacked HiLoad 97 99, HiPrep HiScreen 79, HiTrap 79, 81, 88, Columns, ReadyToProcess See ReadyToProcess Column support 228 Con A Sepharose 4B 86, 244 Connectors for process-scale columns Courses - Fast Trak 222 Cross flow filtration 170 Kvick Flow cassette holder 176 Kvick Flow cassettes 173 Kvick Lab cassette holder 175 Kvick Lab cassettes 172 Kvick Lab packet holder 174 Kvick Lab packets 172 Kvick Lab SCU cassettes 171 Kvick Start cassettes 170 MaxCell process scale hollow fiber cartridges 185 MidGee cross flow cartridges 178 MidGee Hoop cross flow cartridges 179 Pilot scale hollow fiber cartridges 181 ProCell hollow fiber cartridges 187 Process scale hollow fiber cartridges 183 Start AXM and AXH cartridges 177 Steam-in-place hollow fiber cartridges 188 Xampler laboratory cartridges 180 Cross flow filtration vs. normal flow filtration 167 Custom Designed Media (CDM) 81, 100 Customized BioProcess Solutions (CBS) 145 Customized filtration hardware 199 Custom-packed columns 161 Custom-packed laboratory columns 134 Custom Primer Support 215 Custom ReadyCircuit assemblies 56 Cytodex , 244 Cytodex , 245 Cytoline 1 31, 33, 245 Cytopore , 245 Cytopore , 245 D DAC, ReadyMate See ReadyMate Connectors Data files 231 DEAE Sephadex A-25 80, 245 DEAE Sephadex A-50 80, 245 DEAE Sepharose Fast Flow 81, 160, 246 DeltaV software 145 DEV1 - Fast Trak course 222 DEV2 - Fast Trak course 222 DEV4 - Fast Trak course 222 Differential scanning calorimetry (DSC) 207 Disposable Aseptic Connectors, ReadyMate 67 Downstream magazine See Upstream and Downstream DSC See Differential scanning calorimetry E ECH-Lysine Sepharose 4 Fast Flow 86, 246 Epoxy-activated Sepharose 6B 86, 246 esys1 - Fast Trak course 221 esys6 - Fast Trak course 221 F Fast Trak 220 Filtration hardware 194 ÄKTAcrossflow system 194 Customized filtration hardware 199 Grandstand pilot/process systems 197 UniFlux systems 195 Filtration products 164 FineLINE columns 126 Flow-through technology, oligosynthesis 212 Index and legal

274 G GammaBind G Type Gelatin Sepharose 4 Fast Flow 86, 246 Gel Filtration 96 Application guide 99 Selection guide 97 Glutathione Sepharose 4 Fast Flow 86, 247 GrandStand pilot/process systems 197 GxP services 205 K KappaSelect 85, 248 Kvick Flow cassette holder 176 Kvick Flow cassettes 173 Kvick Lab cassette holder 175 Kvick Lab cassettes 172 Kvick Lab packet holder 174 Kvick Lab packets 172 Kvick Lab SCU cassettes 171 Kvick Start cassettes 170 Index and legal H Handbooks 230 Heparin Sepharose 6 Fast Flow 82, 86, 247 HIC See Hydrophobic interaction chromatography High-throughput process development 153 HiLoad columns 97 99, HiPrep columns HiScale columns 132 HiScreen columns 79, HiTrap Capto IEX Selection Kit 79, 81, HiTrap columns 79, 81, 88, HiTrap HIC Selection Kit 88, 158, 160 HiTrap IEX Selection Kit 79, 81, Hollow fiber cartridges See ReadyToProcess Hollow fiber cartridges See Cross flow filtration HTPD See High-throughput process development HTPD1 - Fast Trak course 222 Hydrophobic interaction chromatography (HIC) 87 Map of HIC media 89 Selection guide 88 I IC See Inline conditioning IEX See Ion exchange chromatography IEX Selection Kit 160 IgG Sepharose 6 Fast Flow 247 IgSelect 86, 101, 247 IMAC media 82 Chelating Sepharose Fast Flow 82, 86, 243 IMAC Sepharose 6 Fast Flow 82, 86, 248 Ni Sepharose 6 Fast Flow 82, 86, 252 INdEX columns 122 Inline conditioning (IC) 144 Ion exchange chromatography (IEX) 77 Selection guide 79 L Label-free interaction analyses 202 LambdaFabSelect 85, 101, 248 Lentil Lectin Sepharose 4B 86, 248 Licensing information 271 Literature 230 Application notes 231 Books 231 Data files 231 Posters 231 Technique handbooks 230 Upstream and Downstream magazine 230 M MAB1 - Fast Trak course 222 MAbs See Monoclonal antibodies MabSelect media 83 MabSelect 83, 85 86, 249 MabSelect, PreDictor 96-well filter plates 155 MabSelect, Prepacked columns MabSelect SuRe 83, 86, 92, 249 MabSelect SuRe LX 83, 86, 92, 250 MabSelect Xtra 83, 86, 250 MacroCap Q 78, 80, 101, 251 MacroCap SP 78, 80, 251 Manufacturing Solutions Column packing 136 Inline conditioning (IC) 144 Media Wand 136 Slurry tanks 137 MaxCell process scale hollow fiber cartridges 185 Media, chromatography 74, 229, 234 Media safety stock 76, 229 Media, Selection kits See Selection kits

275 Media selection strategy 76 Media toolbox 92 Media Wand 136 MEM1 - Fast Trak course 222 MicroCal systems 206 MicroCal VP-Capillary DSC system 207 Microcarrier cell culture 31 Selection guide 31 Microfiltration 166 MidGee cross flow cartridges 178 MidGee Hoop cross flow cartridges 179 Monoclonal antibodies (MAbs) 82, 92 MAbs purification toolbox 92 Multimodal Chromatography 90 N NHS-activated Sepharose 4 Fast Flow 82, 86, 251 Ni Sepharose 6 Fast Flow 82, 86, 252 Normal flow capsule filters See ReadyToProcess Normal flow filtration 189 ULTA Prime CG 191 ULTA Prime GF 192 ULTA Prime PP 193 ULTA Pure HC 190 ULTA Pure SG 189 Normal flow filtration vs. cross flow filtration 167 nprotein A Sepharose 4 Fast Flow 86, 252 O Octyl Sepharose 4 Fast Flow 88 89, 160, 252 Oligonucleotide synthesis 210 ÄKTA oligopilot plus 211 Custom Primer Support 215 Flow-through technology 212 Oligonucleotide synthesis columns 213 Oligonucleotide synthesizers 211 OligoPilot OligoProcess 212 Oligosynt prepacked disposable columns 215, 266 Primer Support 5G 214, 266 Solid supports 214 Online regulatory and technical support 226 Online technical support 227 Online training 221 OPC Connectivity 148 P PAA products Packing stations, Chromaflow columns 113 Phenyl Sepharose 6 Fast Flow (high sub) 88 89, 160, 253 Phenyl Sepharose 6 Fast Flow (low sub) 88 89, 160, 253 Phenyl Sepharose High Performance 88 89, 160, 254 Pilot scale hollow fiber cartridges 181 PlasmidSelect Xtra 93, 160, 254 PlasmidSelect Xtra Screening Kit PlasmidSelect Xtra Starter Kit Plasminogen Removal Gel 86, 101, 254 Posters 231 Powder media 29 Pre-activated media 82 PreDictor 96-well filter plates 154 PreDictor RoboColumn 156 Prepacked columns, examples 158 Primer Support 5G 214, 266 Procainamide Sepharose 4 Fast Flow 86, 101, 254 ProCell hollow fiber cartridges 187 Process scale hollow fiber cartridges 183 Product highlights 16 Products for process development 150 Protein A 82 83, 92, 254 Protein G 255 Protein G Sepharose 4 Fast Flow 86, 255 Protein interaction and stability analysis 200 Biacore C 204 Biacore system validation support 205 Biacore T MicroCal VP-Capillary DSC system 207 Q QAE Sephadex A-25 80, 257 QAE Sephadex A-50 80, 257 Q Sepharose Big Beads 80, 160, 256 Q Sepharose Fast Flow 81, 160, 256 Q Sepharose High Performance 81, 160, 257 Q Sepharose XL 81, 160, 257 Index and legal

276 Index and legal R ReadyCircuit bags 54 ReadyKart mobile processing station 63 ReadyMate Connectors 67 ReadyToProcess 34 Cellbag bioreactors 45 Chromatography 70 ÄKTA ready system 71 Columns 72 Connectivity 66 ReadyMate Connectors 67 Sterile Tube Fuser 68 Tube Sealer 69 ReadyToProcess platform 36 Single-use fluid management and filtration 52 Custom ReadyCircuit assemblies 56 Hollow fiber cartridges 57 ReadyCircuit bags 54 ReadyKart mobile processing station 63 Sensor assemblies 55 Tube assemblies 54 ULTA normal flow filter capsules 60 UNICORN DAQ software 47 WAVE Bioreactor systems 38 WAVE Bioreactor 2/10 system 44 WAVE Bioreactor 20/50 system 43 WAVE Bioreactor 200 system 42 WAVE Bioreactor 500/1000 system 41 WAVE Mixer 50 WAVEPOD II Integrated Controller 48 Regulatory support files 226 Reversed phase chromatography (RPC) 94 rmp Protein A Sepharose Fast Flow 86, 255 RPC See Reversed phase chromatography rprotein A Sepharose 4 Fast Flow 86, 255 S SAMS See Smart Asset Management Services Security of supply 76, 229 Selection kits HiTrap Capto IEX Selection Kit 160 HiTrap HIC Selection Kit 160 HiTrap IEX Selection Kit 160 IEX Selection Kit 160 PlasmidSelect Xtra Screening Kit PlasmidSelect Xtra Starter Kit Sephacryl High Resolution 98 Sephacryl S-100 High Resolution 98 99, 257 Sephacryl S-200 High Resolution 98 99, 258 Sephacryl S-300 High Resolution 98 99, 258 Sephacryl S-400 High Resolution 98 99, 258 Sephacryl S-500 High Resolution 98 99, 258 Sephadex Sephadex G-25 Coarse 98 99, 259 Sephadex G-25 Fine 98 99, 259 Sephadex G-25 Medium 98 99, 259 Sephadex G-25 Superfine 98 99, 259 Sephadex LH-20 98, 260 Sepharose Sepharose 4B 260 Sepharose 4 Fast Flow 98 99, 261 Sepharose 6B 260 Sepharose 6 Fast Flow 98 99, 261 Sepharose CL-2B 99, 260 Sepharose CL-4B 260 Sepharose CL-6B 260 Sepharose Fast Flow 89, Sepharose High Performance 89 Service and support 216 Fast Trak 220 Literature 230 Online regulatory and technical support 226 Security of supply 229 Service agreements 218 Smart Asset Management Services (SAMS) 219 System and column support 228 Validation Services 224 Single-use fluid management and filtration 52 Slurry tanks 137 Smart Asset Management Services (SAMS) 219 Solid supports, oligosynthesis 214 SOURCE 78, 81, 126 SOURCE 15ETH 261 SOURCE 15ISO 261 SOURCE 15PHE 261 SOURCE 15Q 79, 81, 262 SOURCE 15RPC 95, 262 SOURCE 15S 79, 81, 263 SOURCE 30Q 81, 262 SOURCE 30RPC 95, 262 SOURCE 30S 81, 263 SP Sepharose Big Beads 80, 160, 263 SP Sepharose Fast Flow 81, 160,

277 SP Sepharose High Performance 81, 160, 264 SP Sepharose XL 81, 160, 265 Start AXM and AXH cartridges 177 Steam-in-place hollow fiber cartridges 188 Sterile Tube Fuser 68 SUM1 - Fast Trak course 222 Superdex 30 prep grade 98 99, 265 Superdex 75 prep grade 98 99, 265 Superdex 200 prep grade 98 99, 265 Supports, oligonucleotide synthesis 214 SYS2 - Fast Trak course 222 SYS3 - Fast Trak course 222 System and column support 228 System control - UNICORN 146 Systems for chromatography 138 ÄKTA avant 140 ÄKTApilot 141 ÄKTAprocess 142 Customized BioProcess Solutions (CBS) 145 Inline conditioning (IC) 144 Systems for method and process development 162 ÄKTA avant 162 ÄKTApilot 162 V VIISelect 101, 255 Validation Services 224 VIIISelect 86, 101, 256 VWS1 - Fast Trak course 222 W WAV1 - Fast Trak course 222 WAVE Bioreactor systems 38 WAVE Bioreactor 2/10 system 44 WAVE Bioreactor 20/50 system 43 WAVE Bioreactor 200 system 42 WAVE Bioreactor 500/1000 system 41 WAVE Mixer 50 WAVEPOD II Integrated Controller 48 X Xampler laboratory cartridges 180 T Technical support online 105, 227 Technique handbooks 230 Terms and conditions of sale 268 Trademarks 271 Training programs 221 Tube Sealer 69 U ULTA Prime CG 191 ULTA Prime GF 192 ULTA Prime PP 193 ULTA Pure HC 190 ULTA Pure SG 189 Ultrafiltration 166 UNICORN control 146 UNICORN DAQ software 47 UniFlux systems 195 Upstream and Downstream magazine 230 Index and legal

278 Notes

279

280 Notes

281

282 Notes

283

284 GE Healthcare Life Sciences For local office contact information, visit GE Healthcare Bio-Sciences AB Björkgatan Uppsala Sweden imagination at work 2012 General Electric Company All rights reserved. First published Mar GE Healthcare UK Ltd. Amersham Place Little Chalfont Buckinghamshire, HP7 9NA UK GE Healthcare Europe GmbH Munzinger Strasse 5 D Freiburg Germany GE Healthcare Bio-Sciences Corp. 800 Centennial Avenue P.O. Box 1327, Piscataway NJ USA GE Healthcare Japan Corporation Sanken Bldg., , Hyakunincho Shinjuku-ku, Tokyo Japan AB 03/2012