Canadian Microbiome Initiative
|
|
|
- Jasper Skinner
- 10 years ago
- Views:
Transcription
1 Canadian Microbiome Initiative Background The human body plays host to trillions of microbes, including bacteria, viruses and protists. These microbes constitute the Human Microbiome that resides both on the surface and deep within numerous sites in our bodies. It is estimated that the number of microbial cells outnumbers host cells by a factor of at least 10:1 and that they encode approximately 100-fold more genetic information than the human genome. It has been recognized that microbes play an important role in human health, not just as pathogens, or as benign communities that keep pathogens at bay, but also in association with a number of chronic health conditions including gastrointestinal diseases, obesity, autoimmune diseases, diabetes, cancer, arthritis, asthma and cardiovascular disease. Perturbations in the normal microbiome have also been associated with certain neurological and behavioural changes. Until recently the task of studying the human microbiota was daunting, not only because of the sheer number of organisms colonizing the human body, but also because of the difficulties involved in studying colonies Escherichia coli (E. coli) of microbes, and the interactions between them in their natural environment. However, with the emergence of the field of metagenomics and the availability of a new generation of genome sequencing platforms, it is now possible to sequence, analyze and characterize complex microbial communities fast and efficiently. These cuttingedge genomic and bioinformatics technologies open the door for biological studies on the complex relationships Campilobactor between microbes and humans. The National Institutes of Health (NIH), through the Human Microbiome Project (HMP), plan to sequence and analyse the genomes of the human microbiome in selected body sites in order to determine whether there is a core set of microbiota shared by all humans. Using this reference database, it is hoped to be able to predict the genetic capabilities of unknown
2 species on the basis of similarities with known genes and to assess the role of the human microflora in health and disease. Much of the initial sequencing work is being undertaken by the HMP, but the vast amounts of data required calls for a coordinated international approach in which common techniques are used to collect samples, extract DNA and annotate data - hence the recent creation of the International Human Microbiome Consortium (IHMC). IHMC will coordinate the microbiome initiatives around the world including those in the EU, China, Japan, Singapore, Australia and Canada. Canadian Microbiome Initiative Canada is well placed to take advantage of these ongoing initiatives due to research strengths in fields of gastroenterology, neuroimmunology, virology and infectious diseases and also our collaborative research culture and publicly-funded health care system. On behalf of CIHR, the Institute of Infections and Immunity (III) has championed the development of a conceptual framework for a Canadian microbiome strategy and engaged Canadian researchers in establishing research strategies and priorities related to the HMP. In September 2007, III initiated the Canadian Microbiome Initiative (CMI) to align with the HMP and to help Canadian researchers take a leading role in the IHMC. In June 2008, III and Genome Canada co-hosted the Canadian Microbiome Workshop, which brought together Canada s leading microbiome researchers to explore and develop strategies and priorities for the CMI and explore the research areas in which Canada can make unique contributions. III has already secured significant funds in support of CMI and developed strong national partnerships to support a strong Canadian presence in the field of microbiome research. Canadian Microbiome Initiative Workshop Report June 16th - 17th, 2008 Fairmont Royal York Hotel, Toronto
3 The International Human Microbiome Consortium The Scientific Director of III serves as the Canadian representative on the International Human Microbiome Consortium (IHMC). ( ). IHMC s initial focus will be to coordinate research efforts internationally and generate a shared comprehensive data resource available to investigators working in this area. The goals of the IHMC are to: generate a shared resource of human microbiome data and protocols; coordinate international efforts to reduce redundancy; and provide a venue for exchange of results and strategies. Currently, US$250 million has been committed to the IHMC from around the globe, including $10 million from Canada. NATURE Vol May 2008 Current participants in the IHMC include: Australia: Commonwealth Scientific and Industrial Research Organization Canada: Canadian Institutes of Health Research China: Human Gut Microbiome and Infections China: Ministry of Science and Technology Europe: European Commission France: National Agency for Research (INRA) Ireland: the DAFF/HRB elderly gut metagenomics project ELDERMET Japan: Human Metagenome Consortium Japan (HMGJ) South Korea: Ministry for Health, Welfare and Family Affairs United States: National Institutes of Health
4 The CIHR-III Catalyst Grant In Human Microbiome Research In June 2008, III, in partnership with the CIHR Institute of Nutrition, Metabolism and Diabetes (INMD), launched a Human Microbiome Catalyst Grant competition to support one-year grants of up to $100,000 that will enable Canadian researchers to make a contribution to the creation of new knowledge in the area of the human microbiome and its translation into an understanding of how the microbes in the human body affect both the normal healthy and disease states. This catalyst grant funding opportunity garnered a great deal of interest from the research community and attracted 21 applications. With funding support from the CIHR Institute of Circulatory and Respiratory Health (ICRH), the CIHR Institute of Gender and Health (IGH), INMD, and the CIHR Ethics Office, the following 12 projects received one year funding to support individual researchers working in the area of the human microbiome to begin forming teams as an initial step towards the pursuit of additional funding opportunities in the national and international realms. Researchers funded in the CIHR-III Microbiome Catalyst Grant competition Principal Investigator Institution Project Title Allen-Vercoe, Emma University of Guelph Investigating the potential effects of host-derived stress hormones on the human gut microflora Finlay, Barton University of British The Role of the Gastrointestinal Microbiota in Asthma Columbia Holt, Rob BC Cancer Research Linking Infectious Agents to Cancer: A Metagenomics Approach Centre Hwang, David University Health Network Assessing the impact of polymicrobial pulmonary infections in cystic fibrosis via metagenomics Kozyrskyj, Anita University of Alberta The impact of antibiotics on intestinal microbiota of infants Manges, Amee McGill University Microbial metagenomics of the intestinal microbiota and the etiology of Clostridium difficile-associated disease in hospitalized patients Money, Deborah University of British Metagenomic characterization of the human vaginal microbiome Columbia Neufeld, Josh University of Waterloo Establishing a complete taxonomic baseline for the human microbiome O Doherty, Kieran University of British Columbia Developing Ethical and Regulatory Guidelines for Research on the Human Microbiome and its Applications: Speaking to the Experts and Stakeholders Rioux, Kevin University of Calgary Characterizing the fecal microbiome and bacteria-derived volatile organic compounds in patients with non-alcoholic fatty liver disease (NAFLD) Stintzi, Alain University of Ottawa Role of the gut microbiome in Pediatric Gastrointestinal Illnesses Surette, Michael University of Calgary Elusive respiratory pathogens in the oropharyngeal flora
5 Research Descriptions of the projects funded in the CIHR-III Microbiome Catalyst Grant competition Dr. Holt is analysing RNA samples from early stage tumours with the intention of determining if an infectious agent is detectable in these neoplasms using a method called Whole Transcriptome Shotgun Sequencing. Dr. Surette is tracking down the elusive pathogens in the oral cavity and upper respiratory tract that are unidentifiable and are currently escaping detection by conventional clinical microbiology. Dr. Hwang is trying to show that the lungs of CF patients harbour dozens of bacterial species, and that the composition of the bacterial community in the lung affects the severity of the disease and the effectiveness of different treatments. Dr. Neufled is comprehensively profiling the phylogenetic diversity of the human gut and oral microbiome by pioneering a newly developed high-throughput sequencing technique and developing novel bioinformatic tools for subsequent data analysis. Dr. Finlay is determining whether shifts in resident gastrointestinal microbiota play a role in developing atopic diseases such as asthma (i.e. testing the so-called hygiene hypothesis). Dr. Allen-Vercoe is exploring the effects of host-derived stress hormones on the human gut microbiota and to show that these stress hormones exert a direct effect on the population balance of the gut s microflora. Dr. Rioux is examining previously unexplored links between compositional and functional changes in the intestinal microbiota and the pathogenesis of liver disease (NAFLD), possibly identifying novel therapeutic targets in the prevention and management of this disease. Dr. Manges is investigating the etiology of C. difficile-associated disease in order to test and compare three alternate models of pathogenesis. Dr. Kozyrskyj is measuring the effect of antibiotic use during infancy on the composition of intestinal microbiota and whether it is associated with the development of atopic disease in children. Dr. Money is looking to determine whether healthy reproductive-aged women share a core vaginal microbiome, with variations that can be clearly defined and correlated with health and disease. Dr. O Doherty is undertaking the challenge of collating and critically analysing the diversity of views and positions on human microbiome research and develop and understanding of how the human microbiome project is likely to shape public understanding of health and the human body. Dr. Stintzi is performing a comprehensive analysis of the gastrointestinal tract microbiome in children with IBD in order to test the hypothesis that the composition of the gut microbiota is uniquely associated with either Crohn s disease and/or ulcerative colitis.
6 Emerging Team Grants In July, 2009, The CIHR Institute of Infection and Immunity announced the launch of the Emerging Team Grant: Canadian Microbiome Initiative (CMI). This initiative will provide an opportunity for multidisciplinary teams of Canadian researchers to analyze and characterize the microbes that colonize the human body in order to: understand of the composition and distribution of the microbial flora in different body sites; gain new insights on the function of the normal flora in healthy individuals; and probe the links between the human microflora and disease.. It is expected that successful teams will take advantage of the international microbiome research database where appropriate. Total amount available for this initiative is $ million, with the possibility of increased funding through additional partnerships. Letters of Intent are due November 2nd, 2009 and funding is set to being in September This funding opportunity is supported by: The Canadian Partnership for Tomorrow Project Projet de partenariat canadien Espoir pour demain
7 Emerging Team Grants The specific objectives of this funding opportunity are: To characterize communities of microbes found in different body sites in healthy individuals to determine if individuals share a common microbiome; To explore the interactions between microbes and determine how perturbations at one site can affect microbes at another body site; To investigate the role the microbiota play in human health and to probe the associations between the human microbiome and a variety of diseases and health conditions; To establish links and collaborations between researchers with expertise in different fields e.g. genomics, proteomics, bioinformatics, immunology, physiology, microbial ecology, ethics; To establish links and collaborations between research teams currently studying microbes at different body sites e.g. oral, gastrointestinal, respiratory tract; To promote research that utilizes existing Canadian infrastructures such as largescale genomics and bioinformatics platforms and cohort studies; To create competitive Canadian teams that are able to contribute to, and benefit from, the work of the IHMC and other international opportunities; To identify and address potential ethical and legal issues associated with microbiome research and the emerging technologies as an integral part of research teams. For information about this funding opportunity, please visit: or contact Judith Bray CIHR Institute of Infection and Immunity [email protected]
Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools.
Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Empowering microbial genomics. Extensive methods. Expansive possibilities. In microbiome studies
The National Institute of Genomic Medicine (INMEGEN) was
Genome is...... the complete set of genetic information contained within all of the chromosomes of an organism. It defines the particular phenotype of an individual. What is Genomics? The study of the
FACULTY OF MEDICAL SCIENCE
Doctor of Philosophy Program in Microbiology FACULTY OF MEDICAL SCIENCE Naresuan University 171 Doctor of Philosophy Program in Microbiology The time is critical now for graduate education and research
Evidence-Based Practice for Public Health Identified Knowledge Domains of Public Health
1 Biostatistics Statistical Methods & Theory Evidence-Based Practice for Public Health Identified Knowledge Domains of Public Health General Public Health Epidemiology Risk Assessment Population-Based
Human Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data
Csaba Kerepesi, Dániel Bánky, Vince Grolmusz: AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data http://pitgroup.org/amphoranet/ PIT Bioinformatics Group, Department of Computer
BSc in Medical Sciences with GASTROENTEROLOGY AND HEPATOLOGY
BSc in Medical Sciences with GASTROENTEROLOGY AND HEPATOLOGY Introduction The BSc in Gastroenterology and Hepatology allows a science-based study of the physiology, cell biology, pathology and pharmacology
PHYSIOLOGY AND MAINTENANCE Vol. II Intestinal Microflora - Erkki Eerola, Wen Hua Ling
INTESTINAL MICROFLORA Erkki Eerola Turku University. Department of Medical Microbiology, Turku, Finland. Wen Hua Ling Zhongshan University. Department of Clinical Nutrition, Guangzhou, PRChina Keywords:
TRACKS GENETIC EPIDEMIOLOGY
Dr. Priya Duggal, Director In the post-genomic era where larger amounts of genetic data are now readily available, it has become increasingly important to design studies and use analytical techniques that
Ethics and Scientific Oversight for Phase 1 Clinical Trials in Hong Kong. Sydney TANG Chairman, HKU/HA HKW IRB November 21, 2015
Ethics and Scientific Oversight for Phase 1 Clinical Trials in Hong Kong Sydney TANG Chairman, HKU/HA HKW IRB November 21, 2015 Clinical Trials at HKU Phase 1 Phase II Phase III Phase IV Conducted on patient
Owen White Institute for Genome Sciences University of Maryland
Owen White Institute for Genome Sciences University of Maryland hmpdacc.org Gevers D, Knight R, Petrosino JF, Huang K, et al. (2012) The Human Microbiome Project: A Community Resource for the Healthy Human
Nutrition and Toxicants in Autoimmune Disease: Implications for Prevention and Treatment
Nutrition and Toxicants in Autoimmune Disease: Implications for Prevention and Treatment Collaborative on Health and the Environment June 17, 2014 Ted Schettler MD, MPH 1 Autoimmune diseases Autoimmunity
HEALTH SCIENCES RESEARCH GROUPS AT THE UNIVERSITY OF ALICANTE. Field. Translational Research. Mortality Analysis. Public Health.
HEALTH SCIENCES RESEARCH GROUPS AT THE UNIVERSITY OF ALICANTE Field Name Description Translational Research Mortality Analysis Join University-Conselleria Unit for Translational Research in the health
Proposal to Establish the Crohn s and Colitis Center at the University of Miami Miller School of Medicine
Proposal to Establish the Crohn s and Colitis Center at the University of Miami Miller School of Medicine Contents Mission... 1 Background... 2 Services and Programs... 2 Clinical Care... 2 IBD Specialists...
Influence of the skin mechanical and microbial properties on hair growth
Call for Interdisciplinary Projects Sevres 2014 A General Information Project title Influence of the skin mechanical and microbial properties on hair growth Acronym TADDEI: The Ambiguous Dupond and Dupont
Course Descriptions. I. Professional Courses: MSEG 7216: Introduction to Infectious Diseases (Medical Students)
Course Descriptions I. Professional Courses: MSEG 7216: Introduction to Infectious Diseases (Medical Students) This course is offered during the first semester of the second year of the MD Program. It
History of DNA Sequencing & Current Applications
History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied
Graduate and Postdoctoral Affairs School of Biomedical Sciences College of Medicine. Graduate Certificate. Metabolic & Nutritional Medicine
Graduate and Postdoctoral Affairs School of Biomedical Sciences College of Medicine Graduate Certificate in Metabolic & Nutritional Medicine Graduate Certificate Metabolic & Nutritional Medicine Purpose
Dietary emulsifiers impact the mouse gut microbiota promoting colitis and metabolic syndrome
Dietary emulsifiers impact the mouse gut microbiota promoting colitis and metabolic syndrome Andrew T. Gewirtz et al N A T U R E VOL 519 5 M A R C H 2 0 1 5 Background Incidence of IBD Fact 1: increasing
MOLECULAR BIOLOGY 4P03 / BIOLOGY 6P03 - Medical Microbiology
MOLECULAR BIOLOGY 4P03 / BIOLOGY 6P03 - Medical Microbiology Term II 2015-2016 Instructor: Guest Lecturers: Dr. Jianping Xu (Microbiologist) Dr. Marek Smieja (Medical Microbiologist, Infectious Diseases
REGULATIONS FOR THE DEGREE OF MASTER OF CLINICAL PHARMACY (MClinPharm)
REGULATIONS FOR THE DEGREE OF MASTER OF CLINICAL PHARMACY (MClinPharm) (See also General Regulations) MCP1 Definition The degree of Master of Clinical Pharmacy (MClinPharm) is a postgraduate degree awarded
New York Bio Conference 2016. Mark J. Alles Chief Executive Officer
New York Bio Conference 2016 Mark J. Alles Chief Executive Officer Great Progress AGE 72 World Life Expectancy 2005-2014* 17 new drugs for rare diseases 71.5 71 Two new MS drugs First drug to target root
October 17, 2005. Elias Zerhouni, M.D. Director National Institutes of Health One Center Drive Suite 126 MSC 0148 Bethesda, MD 20892
October 17, 2005 Elias Zerhouni, M.D. Director National Institutes of Health One Center Drive Suite 126 MSC 0148 Bethesda, MD 20892 Dear Dr. Zerhouni: The undersigned nonprofit medical and scientific societies
How Can Institutions Foster OMICS Research While Protecting Patients?
IOM Workshop on the Review of Omics-Based Tests for Predicting Patient Outcomes in Clinical Trials How Can Institutions Foster OMICS Research While Protecting Patients? E. Albert Reece, MD, PhD, MBA Vice
MASTER OF SCIENCE IN BIOLOGY
MASTER OF SCIENCE IN BIOLOGY The Master of Science in Biology program is designed to provide a strong foundation in concepts and principles of the life sciences, to develop appropriate skills and to inculcate
High-throughput sequencing and big data: implications for personalized medicine?
High-throughput sequencing and big data: implications for personalized medicine? Dominick J. Lemas, PhD Postdoctoral Fellow in Pediatrics - Neonatology Mentor: Jacob E. (Jed) Friedman, PhD What is Big
Grand V Challenge We must improve human health, nutrition and wellness of the U.S. population
Grand V Challenge We must improve human health, nutrition and wellness of the U.S. population 1 Current Health Challenges Large health care costs(estimates range from $2.5 to $3 trillion in 2008 and 2009)
7- Doctoral Degree in Public Health and Public Health Sciences (Majoring Microbiology)
7- Doctoral Degree in Public Health and Public Health Sciences (Majoring Microbiology) Students should fulfill a total of 44 credit hours: 1- Compulsory courses: 14 credit hours. 1504801, 1504802, 1504803,
IMCAS-BRC: toward better management and more efficient exploitation of microbial resources
IMCAS-BRC: toward better management and more efficient exploitation of microbial resources Xiuzhu Dong Biological Resources Center Institute of Microbiology, Chinese Academy of Sciences Challenges Global
Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France
Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France Special Science Online Collec-on: Dealing with Data (feb 2011) DNA Protein TTGTGGATAACCTCAAAACTTTTCTCTTTCTGACCTGTGGAAAACTTTTTCGTTTTATGATAGAATCAGAGGACAAGAATAAAGA!
AUSTRALIAN VIETNAM VETERANS Mortality and Cancer Incidence Studies. Overarching Executive Summary
AUSTRALIAN VIETNAM VETERANS Mortality and Cancer Incidence Studies Overarching Executive Summary Study Study A u s t ra l i a n N a t i o n a l S e r v i c e V i e t n a m Ve t e ra n s : M o r t a l i
General RID Curriculum
General RID Curriculum The goal of all Reproductive Infectious Diseases (RID) fellowships is to produce welltrained, academically-focused specialists in RID. After completion of a 2-3 year fellowship experience
Definition: What is the Microbiome- A Big Picture
The Microbiome What is the Microbiome- A Big Picture Definition: The collection of genomes of the microbes (bacteria, bacteriophages, fungi, protozoa, and viruses) that live inside a human body Are we
Mini-Medical School on Infectious Diseases. Session #1 - Basic Science
Mini-Medical School on Infectious Diseases Session #1 - Basic Science The Microbial World Michael V. Norgard, Ph.D., Chairman Department of Microbiology U.T. Southwestern Medical Center The Microbial World
http://www.univcan.ca/programs-services/international-programs/canadianqueen-elizabeth-ii-diamond-jubilee-scholarships/
QUANTITATIVE BIOLOGY AND MEDICAL GENETICS FOR THE WORLD PROGRAM ANNOUNCEMENT The "Quantitative Biology and Medical Genetics for the World" program at McGill is offering a number of prestigious Queen Elizabeth
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
A: Nursing Knowledge. Alberta Licensed Practical Nurses Competency Profile 1
A: Nursing Knowledge Alberta Licensed Practical Nurses Competency Profile 1 Competency: A-1 Anatomy and Physiology A-1-1 A-1-2 A-1-3 A-1-4 A-1-5 A-1-6 A-1-7 A-1-8 Identify the normal structures and functions
7- Master s Degree in Public Health and Public Health Sciences (Majoring Microbiology)
7- Master s Degree in Public Health and Public Health Sciences (Majoring Microbiology) Students should fulfill a total of 38 credit hours: 1- Basic requirements: 10 credit hours. 150701, 150702, 150703,
Probiotics for the Treatment of Adult Gastrointestinal Disorders
Probiotics for the Treatment of Adult Gastrointestinal Disorders Darren M. Brenner, M.D. Division of Gastroenterology Northwestern University, Feinberg School of Medicine Chicago, Illinois What are Probiotics?
Introduction. 1. General outline. 1) Position of the Healthcare Policy. 2) Basic principles of the Healthcare Policy (Article 2 of the Promotion Act)
Overview of the Healthcare Policy Introduction For Japan, which is becoming an ultra-aging society ahead of other countries, it is important to realize the world s most advanced medical technologies and
R. Landstorfer et al. BMC Genomics, 2014. Audrey Segura
Comparison of strand-specific transcriptomes of enterohemorrhagic Escherichia coli O157:H7 EDL933 under eleven different environmental conditions including radish sprouts and cattle feces R. Landstorfer
Priority Areas of Australian Clinical Health R&D
Priority Areas of Australian Clinical Health R&D Nick Pappas* CSES Working Paper No. 16 ISSN: 1322 5138 ISBN: 1-86272-552-7 December 1999 *Nick Pappas is a Henderson Research Fellow at the Centre for Strategic
Give a NOD to diabetes:
Give a NOD to diabetes: NOD proteins ti link immunity it and metabolism tbli Jonathan Schertzer McMaster University McMaster University Faculty of Health Sciences Department of Biochemistry and Biomedical
Graduate Certificate Pre-Med Program Course Descriptions For Year 2015-2016 FALL
Graduate Certificate Pre-Med Program Course Descriptions For Year 2015-2016 FALL COURSE TITLE: BIOCHEMISTRY COURSE NUMBER: 5104 This course emphasizes biochemical compounds, processes and systems, designed
The Healing Power of Data
The Healing Power of Data The Healing Power of Data A Message from the Dean and Vice President for Health Sciences Imagine living in a world in which: a mobile device predicts when you are at high risk
Research in IBD at University of Colorado Denver
Research in IBD at University of Colorado Denver Blair Fennimore, MD Assistant Professor of Medicine Division of Gastroenterology and Hepatology UCH Crohn s and Colitis Center Mucosal Inflammation Program
Programme Specification (Undergraduate) Date amended: August 2012
Programme Specification (Undergraduate) Date amended: August 2012 1. Programme Title(s) and UCAS code(s): BSc Biological Sciences C100 BSc Biological Sciences (Biochemistry) C700 BSc Biological Sciences
Dr. Mark Freedman. Keynote Speaker
Dr. Mark Freedman Mark Freedman, HBSc, MSc, MD, CSPQ, FAAN, FRCPC, is professor of medicine in the field of neurology at the University of Ottawa, as well as director of the Multiple Sclerosis Research
Pharmacology skills for drug discovery. Why is pharmacology important?
skills for drug discovery Why is pharmacology important?, the science underlying the interaction between chemicals and living systems, emerged as a distinct discipline allied to medicine in the mid-19th
Principles of Disease and Epidemiology. Copyright 2010 Pearson Education, Inc.
Principles of Disease and Epidemiology Pathology, Infection, and Disease Disease: An abnormal state in which the body is not functioning normally Pathology: The study of disease Etiology: The study of
Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action
Les Rencontres de L INRA Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action E Albina (CIRAD) / S Guyomard(Institut Pasteur) Guadeloupe The era
WHY IS THIS IMPORTANT?
CHAPTER 1 WHAT IS MICROBIOLOGY AND WHY IS IT IMPORTANT? WHO / TDR / Crump WHY IS THIS IMPORTANT? Microbiology is more relevant than ever in today s world. Infectious diseases are a leading health-related
OpenMedicine Foundation (OMF)
Scientific Advisory Board Director Ronald Davis, Ph.D. Genome Technology Center Paul Berg, PhD Molecular Genetics Mario Capecchi, Ph.D Genetics & Immunology University of Utah Mark Davis, Ph.D. Immunology
Against the Growing Burden of Disease. Kimberly Elmslie Director General, Centre for Chronic Disease Prevention
Kimberly Elmslie Director General, Centre for Chronic Disease Prevention Chronic diseases are an increasing global challenge Most significant cause of death (63%) worldwide 1 Chronic diseases cause premature
Department of Food and Nutrition
Department of Food and Nutrition Faculties Professors Lee-Kim, Yang Cha, Ph.D. (M.I.T., 1973) Nutritional biochemistry, Antioxidant vitamins, Fatty acid metabolism, Brain development, and Hyperlipidemia
NETWORK ENVIRONMENTS FOR ABORIGINAL HEALTH RESEARCH ANNOUCEMENT IN THIS ISSUE. 1 Network Environments for Aboriginal Health Research Announcement
VOLUME 3 ISSUE 1 FALL-WINTER 2007-2008 NETWORK ENVIRONMENTS FOR ABORIGINAL HEALTH RESEARCH ANNOUCEMENT IN THIS ISSUE 1 Network Environments for Aboriginal Health Research Announcement 2 ACADRE Program
DNA Sequencing and Personalised Medicine
DNA Sequencing and Personalised Medicine Mick Watson Director of ARK-Genomics The Roslin Institute PERSONALISED MEDICINE What is personalised medicine? Personalized Medicine refers to the tailoring of
SYMPOSIUM. June 15, 2013. Photonics Center Colloquium Room (906) 8 Saint Mary's St., Boston, MA 02215 Boston University
SYMPOSIUM June 15, 2013 Photonics Center Colloquium Room (906) 8 Saint Mary's St., Boston, MA 02215 Bette Korber Los Alamos National Labs HIV evolution and the neutralizing antibody response We have recently
Course Curriculum for Master Degree in Medical Laboratory Sciences/Clinical Microbiology, Immunology and Serology
Course Curriculum for Master Degree in Medical Laboratory Sciences/Clinical Microbiology, Immunology and Serology The Master Degree in Medical Laboratory Sciences / Clinical Microbiology, Immunology or
Complex Microbial Communities. Single-Stage Chemostat Model
Characterization of Complex Microbial Communities Developed in a Single-Stage Chemostat Model Of the Human Distal Gut Julie McDonald [email protected] Allen-Vercoe Laboratory University of Guelph Guelph,
Non-covered ICD-10-CM Codes for All Lab NCDs
Non-covered ICD-10-CM s for All Lab NCDs This section lists codes that are never covered by Medicare for a diagnostic lab testing service. If a code from this section is given as the reason for the test,
If you were diagnosed with cancer today, what would your chances of survival be?
Q.1 If you were diagnosed with cancer today, what would your chances of survival be? Ongoing medical research from the last two decades has seen the cancer survival rate increase by more than 40%. However
Core Functions and Capabilities. Laboratory Services
Core Functions and Capabilities British Columbia Centre for Disease Control Laboratory Services Understanding the role and value of British Columbia s public health laboratory in protecting our community
Ranking Member Subcommittee on Labor-HHS-Education Subcommittee on Labor-HHS-Education. Washington, DC 20515 Washington, DC 20515
THE AD HOC GROUP FOR MEDICAL RESEARCH The Honorable David Obey The Honorable Todd Tiahrt Chair Ranking Member Subcommittee on Labor-HHS-Education Subcommittee on Labor-HHS-Education United States House
Subproject 4: Specification and Documentation of Metabolic and Neoplastic Diseases
Subproject 4: Specification and Documentation of Metabolic and Neoplastic Diseases M. Trauner, Division of Gastroenterology and Hepatology, Department of Internal Medicine, MUG Co- Investigator: H. Samonigg,
Course Curriculum for Master Degree in Food Science and Technology/ Department of Nutrition and Food Technology
Course Curriculum for Master Degree in Food Science and Technology/ Department of Nutrition and Food Technology The Master Degree in Food Science and Technology / Department of Nutrition and Food Technology,
Cystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program
Cystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program Introduction: Cystic fibrosis (CF) is an inherited chronic disease that affects the lungs and
Outline. Personal profile & research interests. Rheumatology research in Ireland. Current standing. Future plans
Outline Personal profile & research interests Rheumatology research in Ireland Current standing Future plans Personal profile 1983 MB Queens University 1990-3 ARUK Clinical Research Fellowship 1990-93
TRACKS INFECTIOUS DISEASE EPIDEMIOLOGY
Dr. Shruti Mehta, Director The development of antibiotics, improved access to safe food, clean water, sewage disposal and vaccines has led to dramatic progress in controlling infectious diseases. Despite
Introduction to Microbiology The Microbial World and You (Chapter 1) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Introduction to Microbiology The Microbial World and You (Chapter 1) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus
Masters of Science in Microbiology and Immunology 2013/2014
Fall semester: Graduate Medical Microbiology (4 credits). This course is designed to introduce graduate students to bacterial, fungal and viral pathogens that are the etiological agents of the most significant
USP CONVENTION MEMBERS BY WORLD REGION
USP CONVENTION MEMBERS BY WORLD REGION April 1, 2015 The 459 organizations listed below are Voting Organizational Members of the U.S. Pharmacopeial Convention (USP). WORLD (8) International Council of
Cloud Computing for Scientific Research
Cloud Computing for Scientific Research The NIH Nephele Project for Microbiome Analysis On behalf of: Yentram Huyen, Ph.D., Chief Nick Weber, Scientific Computing Project Manager Bioinformatics and Computational
Course Outline and Syllabus for Students
Course Outline and Syllabus for Students Name: Ian Crandall Course Number: PHM242H1 Course Title: Microbiology of Infectious Diseases Course Description: The course provides a brief introduction to the
BIOLOGICAL SCIENCES REQUIREMENTS [63 75 UNITS]
Biological Sciences Major The Biological Sciences address many of the most important and fundamental questions about our world: What is life? How does our brain produce our ideas and emotions? What are
NOVA SOUTHEASTERN UNIVERSITY. Bacterial Evolutionary Genetics Course Graduate Level Oceanographic Center NOVA Southeastern University
NOVA SOUTHEAST UNIVERSITY Bacterial Evolutionary Genetics Course Graduate Level Oceanographic Center NOVA Southeastern University Lecture Time: Location: Instructor: Telephone: ON-LINE SUMMER SESSION May
4.1 Objectives of Clinical Trial Assessment
L1 4.1 Objectives of Clinical Trial Assessment Presentation to APEC Preliminary Workshop on Review of Drug Development in Clinical Trials Celia Lourenco, PhD, Manager, Clinical Group I Office of Clinical
Chronic Disease and Nursing:
Chronic Disease and Nursing: A Summary of the Issues What s the issue? Chronic diseases are now the major global disease problem facing the world and a key barrier to development, to alleviating poverty,
A link between gut microbiota, mucosal immunity and autoimmune arthritis. Hsin-Jung Joyce Wu "Microbiota and man: the story about us
A link between gut microbiota, mucosal immunity and autoimmune arthritis Microbes and Man The majority of microbes we encounter are gut microbiota that live mostly in harmony with their host Duodenum 10
JIANGSU CARTMAY INDUSTRIAL CO.,LTD www.labfurniture.asia mail: [email protected]
The basic layout, the main functions and instrumentation concept of micro Inspection Division laboratory, 1, Virology Laboratory 1. Functions: for the city to monitor the prevalence of HIV disease, dealing
Personalized medicine in China s healthcare system
Personalized medicine in China s healthcare system Jingmin Kan, Sam Linsen Netherlands office for Science and Technology, Guangzhou and Shanghai, China Content PERSONALIZED MEDICINE 2 FOCUS AT THE INDIVIDUAL
Clinical Research Infrastructure
Clinical Research Infrastructure Enhancing UK s Clinical Research Capabilities & Technologies At least 150m to establish /develop cutting-edge technological infrastructure, UK wide. to bring into practice
Symptomspesifikke probiotikum. Linda Mulder, MSc. Vårseminaret 2014
Linda Mulder, MSc. Vårseminaret 2014 Content Background on probiotics Intestinal microbiota & health on 3 levels Indication-specific probiotics Strain-specific characteristics Monostrain vs. multispecies
Request for Applications. Sharing Big Data for Health Care Innovation: Advancing the Objectives of the Global Alliance for Genomics and Health
1. Overview Request for Applications Sharing Big Data for Health Care Innovation: Advancing the Objectives of the Global Alliance for Genomics and Health In order for Canada to take full advantage of the
Alison Yao, Ph.D. July 2014
* Alison Yao, Ph.D. Program Officer, Office of Genomics and Advanced Technologies Division of Microbiology and Infectious Diseases National Institute of Allergy and Infectious Diseases National Institutes
