Optimizing TaqMan Assays for highthroughput genotyping applications on the Douglas Scientific Array Tape platform

Size: px
Start display at page:

Download "Optimizing TaqMan Assays for highthroughput genotyping applications on the Douglas Scientific Array Tape platform"

Transcription

1 APPLICATION NOTE TaqMan Assays Optimizing TaqMan Assays for highthroughput genotyping applications on the Douglas Scientific Array Tape platform Introduction A growing demand for genetic marker screening has led to a greater need for high-throughput genotyping technologies that can provide answers to researchers faster, more efficiently, and more affordably. One area of industry where high-throughput genotyping solutions is especially applicable is agricultural biotechnology, in which a molecular breeding revolution has begun to replace traditional breeding methods. Using genetic analysis approaches such as single nucleotide polymorphism (SNP) genotyping, millions of plant samples are screened annually to select and maintain desired genotypic markers correlated to phenotypic traits. Ultimately, this goal of increasing crop yields has fueled innovations in genetic analysis platforms that are robust, scalable, and automated. In July 2012, Douglas Scientific and Life Technologies agreed to work together to optimize the TaqMan Assay chemistry offered by Life Technologies for the Douglas Figure 1. An Array Tape array, a thin and flexible microplate replacement. Scientific Array Tape platform. This partnership brought together two industry-leading technologies: TaqMan Assays, the gold standard for realtime quantitative PCR (qpcr), and Array Tape arrays, made up of a continuous polymer strip embossed with miniaturized reaction wells (Figure 1), and supporting instruments. TaqMan 5 nuclease chemistry has a longstanding reputation for exceptional quality and performance in qpcr applications such as SNP genotyping, gene expression analysis, copy number variation, and somatic mutation detection. The Douglas Scientific Array Tape platform is a breakthrough solution for highthroughput automated genotyping applications. The system allows researchers to process hundreds of thousands of data points per day with a high amount

2 of flexibility, data reproducibility, and automation. The embossed wells on Array Tape arrays are miniaturized versions of standard microtiter plate wells, enabling users to achieve reagent utilization and cost efficiencies through a reduction in reaction volumes of up to 80 90% of that typical in standard microtiter plates. Combined with the robustness of TaqMan SNP Assays, these two technologies are a natural fit to provide researchers a completely integrated end-to-end solution for highthroughput genotyping applications. This application note describes the results from the collaborative effort between Douglas Scientific and Life Technologies to optimize TaqMan chemistry on the Array Tape platform. Liquid class verification, thermal cycling reaction conditions, and scanner settings were fine-tuned to achieve high-quality performance. Data showed highly robust SNP allele discrimination in maize and soy samples, with data comparable to those obtained with standard realtime PCR instruments. Assay design Five SNPs were randomly selected for the validation and optimization of TaqMan chemistry on the Douglas Scientific Array Tape platform. The context sequence for each assay was selected from published literature and is shown in Table 1. Table 1. TaqMan Assay context sequences. Crop Marker Context sequence locus Maize ae1.7 GCAGGACTGTTCGCATGATAATAGGCCATATTC[a/g] TTCTCGGTTTATACACCAAGYAGAACATGTGTCG TCTATGCTCC Maize PZA GTTCGGTGTGACTGCATAAGTGCATCTGGTTGCTT GA[c/t]GCGCAGCTTTGCTTGCGCTAATGTGAAGT Maize PZA GCTGCTGGGAACCTATTCGTGCTGGTTCATTTATAT GTGAGTATGC[c/t]GTGAGGTYATTGATGAGCTCAAA TTTAATTTGAATGATAGTGAAGATGATTACATTTTTC AAACTGTATGCCCTGG Maize PZA CCTTGGAGGGTAGAGCATTGAGGCGGGGTTATGAGT AGAACCGTCGC[a/g]GATTAAATGATTATGACCGTG TTTCTTTACGCAATTTCTTCGTGCTATTGGTACTTA TACACTGCTCTCCTCTGC Soy rs GAAAGCATTGATGAGGCGAACTTGGGATA[c/t]AGC TACAGCGTGGTTGGGGGTGCTGCATTGCCAGACA CGGC Custom TaqMan SNP Genotyping Assays were then designed using the Custom TaqMan Assay Design Tool, which generated five TaqMan Assays, each comprised of a forward primer, a reverse primer, a FAM dyelabeled probe specific to one allele, and a VIC dyelabeled probe targeting the other allele. Four of those assays targeted 4 mutations in the maize genome, while one was selected for soy. Sample preparation The Sample-to-SNP Kit was used to extract DNA from 21 maize and 22 soy seed varieties. This kit provides DNA Extract All reagents for efficient cell lysis with a fast five-minute protocol and was developed to work in conjunction with TaqMan GTXpress Master Mix (provided in the Sample-to-SNP Kit) and with TaqMan SNP Assays. One seed from each variety was chipped (2 3 mm) and placed into a 96-well PCR plate. DNA lysis solution (50 µl) was added to each sample in the plate. The plate was then sealed and incubated at 95 C using a 9700 thermal cycler. After incubation, the seal was removed and 50 µl of stabilizing solution was added to each sample. The plate was then sealed, gently vortexed, and stored at 4 C for later use. Liquid class optimization The Nexar liquid handling instrument was optimized for the TaqMan SNP Assays by adjusting liquid class and dispense settings for both dispense quality and efficiency (Table 2). Table 2. Nexar instrument settings. Setting Value Aspirate velocity 40 cycles Air gap volume 15,000 nl Extra dispense volume 12% Dispense pressure 1.1 psi Dispense valve open width 41 Dispense wash cycles 80 Dispense velocity 100 mm PCR on Array Tape arrays For PCR, the maize and soy samples were first diluted 2 to 5 in 1x TE buffer and transferred into a Corning 96-well plate. Reaction mixes for each assay were assembled into a separate 96-well plate according to the quantities shown in Table 3. The plates were then loaded onto the Nexar liquid handling instrument, where the 96-tip, parallel channel contact-dispensing head transferred 800 nl from the sample source plate into one quadrant of an empty 384- well Array Tape array. Next, the Array Tape arrays automatically advanced to the four channel, non-contact dispense jet, which transferred 800 nl from the reaction mix source plate to the appropriate wells of the Array Table 3. Reaction mix setup. Item Stock 1 rxn 120 rxns GTXpress master 2x 0.76 μl 91.2 μl mix Assay 40x 0.04 μl 4.8 μl

3 Tape array. The combined volume of the assay was 1.6 µl. The Array Tape tape moved inline to the sealing module, where a continuous cover seal was applied and the assays were fed into an output reel in preparation for PCR thermal cycling. The automated inline process continued until all arrays were processed. The completed assays were then transferred to the Soellex water bath thermal cycler. The default cycling protocol (condition 1) is shown in Table 4. After approximately 75 minutes of cycling, the entire reel of tape was transferred to the Araya fluorescence scanning instrument for detection. The automated tape scanner measures FAM, VIC, and ROX dye fluorescence for an entire 384-well array in 28 seconds. The scanned data was then imported into the proprietary Douglas Scientific Intellics genotyping software for calling and clustering. The Douglas Scientific Array Tape platform is shown in Figure 2. Gain optimization After thermal cycling, the Array Tape was fed through the Araya detection instrument. The Araya reader has two photomultiplier tubes (PMTs) to read fluorescence from FAM, VIC, and ROX dyes. With gain fixed for PMT1, the tapes were scanned with PMT2 at 0.22, 0.39, 0.44, and 0.66 to determine the optimal setting for PMT2 gain. The raw data were then fed into Douglas Scientific Intellics software to make allelic calls as well as to generate 2-D cluster plots. These results showed that the cluster plot quality was not significantly affected by gain settings between 0.22 and However, the highest PMT2 gain setting (0.66) caused an increase in background signal, which resulted in visualization of unfilled wells within the 2-D cluster plot (Figure 3). Table 4. Soellex water bath thermal cycling conditions. Condition Initial hold Denature Extension No. cycles 1 (default) 60 sec sec 90 sec 60 sec Araya detection instrument Soellex water bath thermal cycler Nexar liquid handling instrument Figure 2. The Douglas Scientific Array Tape Platform.

4 A. Gain = 0.22 B. Gain = 0.39 A. Condition 1 B. Condition 2 C. Gain = 0.44 D. Gain = 0.66 C. Condition 3 D. Condition 4 Unfilled wells Figure 3. Cluster plots generated from different PMT2 gain settings. Thermal cycling optimization Various thermal cycling protocols were also tested to determine the optimal cycling parameters shown in Table 4. Three additional sets of arrays were assembled to compare conditions 2 4 with the default settings (condition 1). For condition 2, the numbers of cycles was changed from 40 to 50 while the rest of the protocol matched the default parameters. In Table 4, parameters changed for each condition are marked in red. The extension time for condition 3 was lengthened by 30 seconds while condition 4 tested reducing the number of cycles from 40 to 35. The results showed that data quality was unaffected by changing the number of cycles or by lengthening the extension time (Figure 4). This confirmed that the default condition 1 was sufficient to produce accurate genotyping calls and clusters. Additionally, the number of cycles could be reduced to from 40 to 35 without compromising the data quality. Figure 4. Array Tape platform cluster plots for each cycling condition shown in Table 4. Concordance with the ViiA 7 system The previous experiments were repeated on an ViiA 7 Real-Time PCR System to validate TaqMan chemistry on the Douglas Scientific Array Tape platform. Reactions of 5 µl were prepared in 384-well plates using reagent and template concentrations identical to the Array Tape platform reactions. Likewise, the same default cycling protocol used on the Array Tape platform was applied to the ViiA 7 system runs. The ViiA 7 system software was used to make calls and generate cluster plots, which were compared with the corresponding Array Tape platform data to evaluate concordance (Figure 5). Figure 4 shows the ROX dye-normalized 2-D cluster plots for locus PZA (maize) and rs (soy) on both platforms. Samples that were homozygous for allele 2 only emit FAM dye fluorescence and were clustered along the y-axis (blue for the ViiA 7 system and red on the Array Tape platform). Homozygous allele 1 samples were plotted along the horizontal x-axis because they only emit VIC dye fluorescence. The clustering of homozygous allele 1, homozygous allele 2, and heterozygous alleles on the Array Tape platform was virtually identical to that of the ViiA 7 system plots. The same trend was observed for the three assays not shown. Furthermore, the calls were recorded for all 5 assays and 100% concordance was observed between the two platforms.

5 A. ViiA 7 system B. Array Tape system C. ViiA 7 system: soy D. Array Tape system: soy Figure 5. Array Tape platform concordance with the ViiA 7 Real-Time PCR System. Discussion We have optimized the performance of TaqMan genotyping reagents on the Douglas Scientific Array Tape platform to provide robust data quality for the needs of researchers performing ultrahigh-throughput genotyping. Three unique areas of system performance that we investigated and optimized were: In addition, Array Tape technology combined with TaqMan reagents for SNP genotyping has specific workflow advantages to help increase throughput while minimizing hands-on time. The workflow starts with a simple, fiveminute DNA extraction step provided by the DNA Extract All component of the TaqMan Sample-to-SNP Kit, which produces a lysate that can be added directly into the PCR mixture. The assembly of sample and reaction mix source plates could be integrated into the Array Tape platform to provide a seamless workflow. An entire reel of Array Tape tape can then be cycled on the Soellex thermal cycler in under 75 minutes, while scanning on the Araya scanner takes about 28 seconds for each 384-well array. Additionally, our data suggest that the number of cycles of PCR can be modestly reduced by at least five cycles in order to save more time without impacting data quality. Overall, 800 microplate equivalents (307,200 data points) can be processed by one technician in a workday. Douglas Scientific provides its Intellics and SNP analysis software for seamless data analysis and integration, including instrument monitoring, easy, flexible assay setup, and template selection and SNP scoring. By working together, Life Technologies and Douglas Scientific have optimized a solution for high-throughput genotyping applications to enable researchers to significantly scale up their operations an throughput while simultaneously maximizing their data quality and cost efficiencies. 1. Liquid handling of TaqMan reagents on the Nexar liquid handling system. 2. Araya scanner gain settings. 3. Thermal cycling protocols on the Soellex water bath thermal cycler. Our data demonstrate that the use of TaqMan Assays and reagents on the Array Tape platform yields results similar to those obtained on standard real-time PCR instruments. Moreover, with the miniaturization of reaction volumes a capability of the Array Tape platform users can realize increased efficiencies and gains in throughput and reagent utilization. Preoptimized conditions for TaqMan chemistry minimize setup time on the Array Tape platform and provide high-quality data with highly repeatable results.

6 Learn more at lifetechnologies.com/qtl For Research Use Only. Not for use in diagnostic procedures Life Technologies Corporation. All rights reserved. The trademarks mentioned herein are the property of Life Technologies Corporation and/or its affiliate(s) or their respective owners. TaqMan is a registered trademark of Roche Molecular Systems Inc., used under permission and license. Araya, Nexar, and Soellex are registered trademarks and Array Tape and Intellics are trademarks of Douglas Scientific. CO

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to

More information

Application Guide... 2

Application Guide... 2 Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied

More information

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of

More information

A guide to the analysis of KASP genotyping data using cluster plots

A guide to the analysis of KASP genotyping data using cluster plots extraction sequencing genotyping extraction sequencing genotyping extraction sequencing genotyping extraction sequencing A guide to the analysis of KASP genotyping data using cluster plots Contents of

More information

Single Nucleotide Polymorphisms (SNPs)

Single Nucleotide Polymorphisms (SNPs) Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded

More information

AxyPrep TM Mag PCR Clean-up Protocol

AxyPrep TM Mag PCR Clean-up Protocol AxyPrep TM Mag PCR Clean-up Protocol Intro The AxyPrep Mag PCR Clean-up kit utilizes a unique paramagnetic bead technology for rapid, high-throughput purification of PCR amplicons. Using this kit, PCR

More information

MLX BCG Buccal Cell Genomic DNA Extraction Kit. Performance Characteristics

MLX BCG Buccal Cell Genomic DNA Extraction Kit. Performance Characteristics MLX BCG Buccal Cell Genomic DNA Extraction Kit Performance Characteristics Monolythix, Inc. 4720 Calle Carga Camarillo, CA 93012 Tel: (805) 484-8478 monolythix.com Page 2 of 9 MLX BCG Buccal Cell Genomic

More information

Real-time PCR: Understanding C t

Real-time PCR: Understanding C t APPLICATION NOTE Real-Time PCR Real-time PCR: Understanding C t Real-time PCR, also called quantitative PCR or qpcr, can provide a simple and elegant method for determining the amount of a target sequence

More information

BacReady TM Multiplex PCR System

BacReady TM Multiplex PCR System BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental

More information

Human Herpes Virus 4 (Epstein Barr)

Human Herpes Virus 4 (Epstein Barr) Techne qpcr test Human Herpes Virus 4 (Epstein Barr) nonglycosylated membrane protein (BNRF1) gene 150 tests For general laboratory and research use only 1 Introduction to Human Herpes Virus 4 (Epstein

More information

TaqMan Fast Advanced Master Mix. Protocol

TaqMan Fast Advanced Master Mix. Protocol TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED

More information

GenScript BloodReady TM Multiplex PCR System

GenScript BloodReady TM Multiplex PCR System GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI

More information

Highly specific and sensitive quantitation

Highly specific and sensitive quantitation PRODUCT ULLETIN SYR Select Master Mix SYR Select Master Mix Highly specific and sensitive quantitation SYR Select Master Mix offers advanced performance at an affordable price. SYR Select Master Mix is

More information

amplification tech Optical Design of CFX96 Real-Time PCR Detection System Eliminates the Requirement of a Passive Reference Dye

amplification tech Optical Design of CFX96 Real-Time PCR Detection System Eliminates the Requirement of a Passive Reference Dye amplification tech note 6047 Optical Design of CFX96 Real-Time PCR Detection System Eliminates the Requirement of a Passive Reference Dye Liz Jordan and Richard Kurtz, Gene Expression Division, io-rad

More information

Real-Time PCR Vs. Traditional PCR

Real-Time PCR Vs. Traditional PCR Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives

More information

RealStar HBV PCR Kit 1.0 11/2012

RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 For research use only! (RUO) Product No.: 201003 96 rxns INS-201000-GB-02 Store at -25 C... -15 C November 2012 altona Diagnostics GmbH Mörkenstraße

More information

TaqMan Genotyper Software v1.0.1 TaqMan Genotyping Data Analysis Software

TaqMan Genotyper Software v1.0.1 TaqMan Genotyping Data Analysis Software TaqMan Genotyper Software v1.0.1 TaqMan Genotyping Data Analysis Software March 2011 Product Overview TaqMan Genotyper Software TaqMan Genotyper Software Standalone data analysis software for Applied Biosystems

More information

Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene. genesig Advanced Kit. DNA testing

Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene. genesig Advanced Kit. DNA testing TM Primerdesign Ltd TM Primerdesign Ltd Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere...

More information

Path-ID Multiplex One-Step RT-PCR Kit

Path-ID Multiplex One-Step RT-PCR Kit USER GUIDE Path-ID Multiplex One-Step RT-PCR Kit TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets Catalog Numbers 4428206, 4428207, 4440022 Publication Part Number 4440907

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

LightCycler 480 Real-Time PCR System

LightCycler 480 Real-Time PCR System Roche Applied Science LightCycler 480 Real-Time PCR System Planned introduction of the LightCycler 480 System: September 2005 Rapid by nature, accurate by design The LightCycler 480 Real-Time PCR System

More information

Speed Matters - Fast ways from template to result

Speed Matters - Fast ways from template to result qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges

More information

Epstein Barr Virus (Human Herpes virus 4) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...

Epstein Barr Virus (Human Herpes virus 4) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... TM Primerdesign Ltd TM Primerdesign Ltd Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere...

More information

The GeneAmp PCR System 9700. Results you can trust. A PCR platform you can grow with. GeneAmp. PCR System 9700

The GeneAmp PCR System 9700. Results you can trust. A PCR platform you can grow with. GeneAmp. PCR System 9700 The GeneAmp PCR System 9700 Results you can trust. A PCR platform you can grow with. GeneAmp PCR System 9700 The GeneAmp PCR System 9700 fits your lab bench, your applications and your budget. The GeneAmp

More information

KASP genotyping chemistry User guide and manual

KASP genotyping chemistry User guide and manual KASP genotyping chemistry User guide and manual KASP manual content 1. Introduction 3 2. Principal of the KASP genotyping assay 3 2.1 Mechanism of KASP chemistry 4 3. The KASP reaction component 5 3.1

More information

Application Note. Single Cell PCR Preparation

Application Note. Single Cell PCR Preparation Application Note Single Cell PCR Preparation From Automated Screening to the Molecular Analysis of Single Cells The AmpliGrid system is a highly sensitive tool for the analysis of single cells. In combination

More information

Factors Influencing Multiplex Real-Time PCR

Factors Influencing Multiplex Real-Time PCR APPLICATION NOTE Multiplex Real-Time PCR Factors Influencing Multiplex Real-Time PCR Introduction Multiplex PCR is the simultaneous amplification of more than one target sequence in a single reaction [1].

More information

TaqMan OpenArray Genotyping. Getting Started Guide

TaqMan OpenArray Genotyping. Getting Started Guide TaqMan OpenArray Genotyping Getting Started Guide For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.

More information

Automated Nucleic Acid Extraction WorkStation Faster, cleaner,

Automated Nucleic Acid Extraction WorkStation Faster, cleaner, Automated Nucleic Acid Extraction WorkStation Faster, cleaner, more consistent nucleic acid extraction The Thermo Scientific Automated Nucleic Acid Extraction WorkStation is a turn-key solution that provides

More information

Quantitative PCR Systems

Quantitative PCR Systems QUANTITATIVE PCR Quantitative PCR Systems Our QPCR systems meet your current research needs, offer flexibility for future research goals, and match your budget. HIGH-PERFORMANCE FULL-FEATURED FLEXIBLE

More information

2.500 Threshold. 2.000 1000e - 001. Threshold. Exponential phase. Cycle Number

2.500 Threshold. 2.000 1000e - 001. Threshold. Exponential phase. Cycle Number application note Real-Time PCR: Understanding C T Real-Time PCR: Understanding C T 4.500 3.500 1000e + 001 4.000 3.000 1000e + 000 3.500 2.500 Threshold 3.000 2.000 1000e - 001 Rn 2500 Rn 1500 Rn 2000

More information

A complete workflow for pharmacogenomics using the QuantStudio 12K Flex Real-Time

A complete workflow for pharmacogenomics using the QuantStudio 12K Flex Real-Time Application NOte QuantStudio 12K Flex Real-Time PCR System A complete workflow for pharmacogenomics using the QuantStudio 12K Flex Real-Time PCR System Introduction Pharmacogenomics (PGx) is the study

More information

Illumina Sequencing Technology

Illumina Sequencing Technology Illumina Sequencing Technology Highest data accuracy, simple workflow, and a broad range of applications. Introduction Figure 1: Illumina Flow Cell Illumina sequencing technology leverages clonal array

More information

QuantStudio 12K Flex Real-Time PCR System. The all-in-one qpcr instrument

QuantStudio 12K Flex Real-Time PCR System. The all-in-one qpcr instrument QuantStudio 12K Flex Real-Time PCR System The all-in-one qpcr instrument Expand the boundaries of your research Life Technologies is taking qpcr to the next level. Designed for maximum throughput, flexibility,

More information

StepOne and StepOnePlus Real-Time PCR Systems

StepOne and StepOnePlus Real-Time PCR Systems PRODUCT BROCHURE Real-Time PCR Systems StepOne and StepOnePlus Real-Time PCR Systems Remarkably Simple Systems. Simply Remarkable Results. Step Up To High Performance Real-Time PCR Remarkably Simple Systems

More information

MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C

MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr

More information

RNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr)

RNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr) RNA Extraction and Quantification, Reverse Transcription, and Real-time Preparation of Samples Cells: o Remove media and wash cells 2X with cold PBS. (2 ml for 6 well plate or 3 ml for 6cm plate) Keep

More information

Human Herpes Virus 1 (Herpes simplex type 1) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...

Human Herpes Virus 1 (Herpes simplex type 1) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... TM Primerdesign Ltd TM Primerdesign Ltd Human Herpes Virus 1 (Herpes simplex type 1) Capsid assembly and DNA maturation gene genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere...

More information

Consistent Assay Performance Across Universal Arrays and Scanners

Consistent Assay Performance Across Universal Arrays and Scanners Technical Note: Illumina Systems and Software Consistent Assay Performance Across Universal Arrays and Scanners There are multiple Universal Array and scanner options for running Illumina DASL and GoldenGate

More information

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of

More information

HBV Quantitative Real Time PCR Kit

HBV Quantitative Real Time PCR Kit Revision No.: ZJ0002 Issue Date: Aug 7 th, 2008 HBV Quantitative Real Time PCR Kit Cat. No.: HD-0002-01 For Use with LightCycler 1.0/LightCycler2.0/LightCycler480 (Roche) Real Time PCR Systems (Pls ignore

More information

Artisan Scientific is You~ Source for: Quality New and Certified-Used/Pre:-awned ECJuiflment

Artisan Scientific is You~ Source for: Quality New and Certified-Used/Pre:-awned ECJuiflment Looking for more information? Visit us on the web at http://www.artisan-scientific.com for more information: Price Quotations Drivers Technical Specifications. Manuals and Documentation Artisan Scientific

More information

SEQUENCING. From Sample to Sequence-Ready

SEQUENCING. From Sample to Sequence-Ready SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major

More information

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally

More information

DNA Sequencing Setup and Troubleshooting

DNA Sequencing Setup and Troubleshooting DNA Sequencing Setup and Troubleshooting Lara Cullen, PhD Scientific Applications Specialist Australia and New Zealand Reviewing Sequencing Data Review the Electropherogram Review the Raw Data (Signal

More information

Hepatitis B Virus. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... Core Protein Region. 150 tests.

Hepatitis B Virus. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... Core Protein Region. 150 tests. TM Primerdesign Ltd TM Primerdesign Ltd Hepatitis B Virus Core Protein Region genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research use

More information

Reconstituting and Diluting Primers and TaqMan Probes

Reconstituting and Diluting Primers and TaqMan Probes Reconstituting and Diluting Primers and TaqMan Probes Introduction TaqMan primers are commonly shipped in a lyophilized state. TaqMan probes are sometimes shipped in the lyophilized state, but more often

More information

Automated Library Preparation for Next-Generation Sequencing

Automated Library Preparation for Next-Generation Sequencing Buyer s Guide: Automated Library Preparation for Next-Generation Sequencing What to consider as you evaluate options for automating library preparation. Yes, success can be automated. Next-generation sequencing

More information

Terra PCR Direct Polymerase Mix User Manual

Terra PCR Direct Polymerase Mix User Manual Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain

More information

Genomic DNA detection assay

Genomic DNA detection assay Genomic DNA detection assay Detection of genomic DNA by real-time PCR Contents CTRL Internal controls and gdna detection Contents Kit Contents 3 Reagents and Equipment to Be Supplied by User 3 Kit Storage

More information

Reagent Guide. Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems

Reagent Guide. Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Reagent Guide Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Reagent Guide Copyright 2008, 2010 Applied Biosystems. All

More information

Sequencing Library qpcr Quantification Guide

Sequencing Library qpcr Quantification Guide Sequencing Library qpcr Quantification Guide FOR RESEARCH USE ONLY Introduction 3 Quantification Workflow 4 Best Practices 5 Consumables and Equipment 6 Select Control Template 8 Dilute qpcr Control Template

More information

StepOne and StepOnePlus Real-Time PCR Systems. Remarkably Simple Systems. Simply Remarkable Results.

StepOne and StepOnePlus Real-Time PCR Systems. Remarkably Simple Systems. Simply Remarkable Results. StepOne and StepOnePlus Real-Time PCR Systems Remarkably Simple Systems. Simply Remarkable Results. Step Up to High-Performance Real-Time PCR Remarkably Simple Systems Applied Biosystems, a leader in technology

More information

High-quality genomic DNA isolation and sensitive mutation analysis

High-quality genomic DNA isolation and sensitive mutation analysis Application Note High-quality genomic DNA isolation and sensitive mutation analysis Izabela Safin, Ivonne Schröder-Stumberger and Peter Porschewski Introduction A major objective of cancer research is

More information

Quantification of Mycobacterium Tuberculosis. 150 tests

Quantification of Mycobacterium Tuberculosis. 150 tests Quantification of Mycobacterium Tuberculosis rep 13E12 For general laboratory and research use only 150 tests Introduction to Mycobacterium Tuberculosis Mycobacterium tuberculosis is the bacterium that

More information

SYBR Green Realtime PCR Master Mix -Plus-

SYBR Green Realtime PCR Master Mix -Plus- Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction

More information

Optimizing Performance of the Transcreener ADP Assay for the BioTek Synergy 2 and 4 Multi-Mode Microplate Readers

Optimizing Performance of the Transcreener ADP Assay for the BioTek Synergy 2 and 4 Multi-Mode Microplate Readers Optimizing Performance of the Transcreener ADP Assay for the BioTek Synergy 2 and 4 Multi-Mode Microplate Readers Brad Larson 1, Karen Kleman-Leyer 1, Xavier Amouretti 2 1 BellBrook Labs, Madison, WI,

More information

Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR

Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.

More information

Proto col. GoClone Repor ter Construc ts: Sample Protocol for Adherent Cells. Tech support: 877-994-8240. Luciferase Assay System

Proto col. GoClone Repor ter Construc ts: Sample Protocol for Adherent Cells. Tech support: 877-994-8240. Luciferase Assay System Luciferase Assay System Proto col GoClone Repor ter Construc ts: Sample Protocol for Adherent Cells LightSwitch Luciferase Assay System GoClone Reporter Assay Workflow Step 1: Seed cells in plate format.

More information

Accurate and sensitive mutation detection and quantitation using TaqMan Mutation Detection Assays for disease research

Accurate and sensitive mutation detection and quantitation using TaqMan Mutation Detection Assays for disease research PPLICTION NOTE Mutation Detection ssays ccurate and sensitive mutation detection and quantitation using Mutation Detection ssays for disease research In this research study, we addressed the feasibility

More information

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B

More information

TaqMan Mutation Detection Assay

TaqMan Mutation Detection Assay PROTOCOL TaqMan Mutation Detection Assay Competitive Allele-Specific TaqMan PCR Publication Part Number 4467011 Rev. B Revision Date April 2012 For Research Use Only. Not intended for any animal or human

More information

Stratagene QPCR Mouse Reference Total RNA

Stratagene QPCR Mouse Reference Total RNA Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY REAL-TIME POLYMERASE CHAI REACTIO (PCR)

STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY REAL-TIME POLYMERASE CHAI REACTIO (PCR) STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY REAL-TIME POLYMERASE CHAI REACTIO (PCR) jmvizcaino@vet.ucm.es Av/ Puerta de Hierro s/n. 28040 Madrid. Tel: (34) 913944082

More information

The AB7900Fast and Principles of Real Time PCR

The AB7900Fast and Principles of Real Time PCR The AB7900Fast and Principles of Real Time PCR Michael Tavaria, PhD Scientific Applications Specialist, Applied Biosystems, Australia and New Zealand Outline Chemistries 7900Fast Real Time PCR System Applications

More information

Real-time qpcr Assay Design Software www.qpcrdesign.com

Real-time qpcr Assay Design Software www.qpcrdesign.com Real-time qpcr Assay Design Software www.qpcrdesign.com Your Blueprint For Success Informational Guide 2199 South McDowell Blvd Petaluma, CA 94954-6904 USA 1.800.GENOME.1(436.6631) 1.415.883.8400 1.415.883.8488

More information

Mir-X mirna First-Strand Synthesis Kit User Manual

Mir-X mirna First-Strand Synthesis Kit User Manual User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

Gene Expression Assays

Gene Expression Assays APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency

More information

Taqman TCID50 for AAV Vector Infectious Titer Determination

Taqman TCID50 for AAV Vector Infectious Titer Determination Page 1 of 8 Purpose: To determine the concentration of infectious particles in an AAV vector sample. This process involves serial dilution of the vector in a TCID50 format and endpoint determination through

More information

QuantStudio 3D AnalysisSuite Software

QuantStudio 3D AnalysisSuite Software USER GUIDE QuantStudio 3D AnalysisSuite Software for use with QuantStudio 3D Digital PCR System Publication Number MAN0008161 Revision 1.0 For Research Use Only. Not for use in diagnostic procedures. For

More information

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR Page 1 of 5 Materials DNase digestion buffer [13 mm Tris-Cl, ph7,5 / 5 mm MgCl2 / 0,12 mm CaCl2] RSS plasmid ptr-uf11 SV40pA Forward primer (10µM) AGC AAT AGC ATC ACA AAT TTC ACA A SV40pA Reverse Primer

More information

LightCycler 480 Real-Time PCR System. High Resolution Melting: Optimization Strategies. Technical Note No. 1

LightCycler 480 Real-Time PCR System. High Resolution Melting: Optimization Strategies. Technical Note No. 1 LightCycler 480 Real-Time PCR System Technical Note No. 1 High Resolution Melting: Optimization Strategies High resolution melting (HRM) is a novel, closed-tube, post-pcr technique allowing genomic researchers

More information

Technical Note. Roche Applied Science. No. LC 19/2004. Color Compensation

Technical Note. Roche Applied Science. No. LC 19/2004. Color Compensation Roche Applied Science Technical Note No. LC 19/2004 Purpose of this Note Color The LightCycler System is able to simultaneously detect and analyze more than one color in each capillary. Due to overlap

More information

DNA Integrity Number (DIN) For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments

DNA Integrity Number (DIN) For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments DNA Integrity Number () For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments Application Note Nucleic Acid Analysis Author Arunkumar Padmanaban Agilent Technologies,

More information

Real-time quantitative RT -PCR (Taqman)

Real-time quantitative RT -PCR (Taqman) Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR

More information

Automation in genomics High-throughput management of biological samples and nucleic acids. Valentina Gualdi Operational Scientist PGP

Automation in genomics High-throughput management of biological samples and nucleic acids. Valentina Gualdi Operational Scientist PGP Automation in genomics High-throughput management of biological samples and nucleic acids Valentina Gualdi Operational Scientist PGP OVERVIEW PGP workflow and robots set-up Sample preparation Sample re-array

More information

Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra

Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra GM and non GM supply chains: Their CO EXistence and TRAceability Outcomes of Co Extra Comparison of different real time PCR chemistries and their suitability for detection and quantification of genetically

More information

Technical Manual No. 0173 Update Date 10112010

Technical Manual No. 0173 Update Date 10112010 TissueDirect TM Multiplex PCR System Technical Manual No. 0173 Update Date 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed

More information

GENOTYPING ASSAYS AT ZIRC

GENOTYPING ASSAYS AT ZIRC GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

How to Run the PacBio RS II Instrument. 1. Run Instrument. 1.1 How to Run the RS II Instrument

How to Run the PacBio RS II Instrument. 1. Run Instrument. 1.1 How to Run the RS II Instrument How to Run the PacBio RS II Instrument 100 338 600 01 1. Run Instrument 1.1 How to Run the RS II Instrument Welcome to Pacific Biosciences' How to Run the PacBio RS II Instrument training module. This

More information

FastLine cell cdna Kit

FastLine cell cdna Kit 1. FastLine cell cdna Kit For high-speed preparation of first-strand cdna directly from cultured cells without RNA purification www.tiangen.com RT100701 FastLine cell cdna Kit Cat. no. KR105 Kit Contents

More information

Lyme Disease. RecA gene. 150 tests. Quantification of Lyme Disease genomes. Advanced kit handbook HB10.03.07

Lyme Disease. RecA gene. 150 tests. Quantification of Lyme Disease genomes. Advanced kit handbook HB10.03.07 Techne qpcr test Lyme Disease RecA gene 150 tests For general laboratory and research use only 1 Introduction to Lyme Disease Lyme disease is an infectious disease caused mainly by three species of bacteria

More information

RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl

RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl

More information

FULLY AUTOMATED AND VALIDATED HIGH VOLUME DNA EXTRACTION USING CHEMAGEN MAGNETIC BEADS BASED KITS

FULLY AUTOMATED AND VALIDATED HIGH VOLUME DNA EXTRACTION USING CHEMAGEN MAGNETIC BEADS BASED KITS FULLY AUTOMATED AND VALIDATED HIGH VOLUME DNA EXTRACTION USING CHEMAGEN MAGNETIC BEADS BASED KITS Tom Janssens & Ivo Salden UZ Gasthuisberg, Center for Human Genetics, Leuven Perkin Elmer Webinar 27th

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Automated Lab Management for Illumina SeqLab

Automated Lab Management for Illumina SeqLab Automated Lab Management for Illumina SeqLab INTRODUCTION Whole genome sequencing holds the promise of understanding genetic variation and disease better than ever before. In response, Illumina developed

More information

Quantifiler HP and Trio DNA Quantification Kits User Guide

Quantifiler HP and Trio DNA Quantification Kits User Guide USER GUIDE Quantifiler HP and Trio DNA Quantification Kits User Guide For use with: Quantifiler HP DNA Quantification Kit (Cat. no. 4482911) Quantifiler Trio DNA Quantification Kit (Cat. no. 4482910) Publication

More information

CompleteⅡ 1st strand cdna Synthesis Kit

CompleteⅡ 1st strand cdna Synthesis Kit Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:

More information

Troubleshooting Sequencing Data

Troubleshooting Sequencing Data Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page

More information

PicoMaxx High Fidelity PCR System

PicoMaxx High Fidelity PCR System PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED

More information

Absolute Quantification Getting Started Guide

Absolute Quantification Getting Started Guide 5 cdna Reverse Primer Oligo d(t) or random hexamer Synthesis of 1st cdna strand 3 5 cdna Applied Biosystems 7300/7500/7500 Fast Real-Time PCR System Absolute Quantification Getting Started Guide Introduction

More information

Plexor Systems Instrument Setup and Data Analysis for the Roche LightCycler 2.0 and LightCycler 1.5 Systems using LightCycler Software Version 4.

Plexor Systems Instrument Setup and Data Analysis for the Roche LightCycler 2.0 and LightCycler 1.5 Systems using LightCycler Software Version 4. TECHNICAL MANUAL Plexor Systems Instrument Setup and Data Analysis for the Roche LightCycler 2.0 and LightCycler 1.5 Systems using LightCycler Software Version 4.0 Instruc ons for use of Products A4011,

More information

Lyme Disease RecA gene. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... 150 tests. Primerdesign Ltd.

Lyme Disease RecA gene. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... 150 tests. Primerdesign Ltd. TM Primerdesign Ltd TM Primerdesign Ltd Lyme Disease RecA gene genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research use only 1 Introduction

More information

Dengue Virus subtypes 1,2 3 and 4. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... 3 Untranslated Region (3 UTR) 150 tests

Dengue Virus subtypes 1,2 3 and 4. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... 3 Untranslated Region (3 UTR) 150 tests TM Primerdesign Ltd TM Primerdesign Ltd Dengue Virus subtypes 1,2 3 and 4 3 Untranslated Region (3 UTR) genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

How To Get A Cell Print

How To Get A Cell Print QUICK CELL CAPTURE AND CHARACTERIZATION GUIDE FOR CELLSEARCH CUSTOMERS CellSave EDTA Blood sample Rare cell capture Enumeration Single protein marker Cell capture for molecular characterization CELLSEARCH

More information

ncounter Gene Expression Assay Manual Total RNA and Cell Lysate Protocols

ncounter Gene Expression Assay Manual Total RNA and Cell Lysate Protocols ncounter Gene Expression Assay Manual Total RNA and Cell Lysate Protocols v.20090807 For research use only. Not for use in diagnostic procedures. Limited License Subject to the terms and conditions of

More information