Optimizing TaqMan Assays for highthroughput genotyping applications on the Douglas Scientific Array Tape platform

Transcription

1 APPLICATION NOTE TaqMan Assays Optimizing TaqMan Assays for highthroughput genotyping applications on the Douglas Scientific Array Tape platform Introduction A growing demand for genetic marker screening has led to a greater need for high-throughput genotyping technologies that can provide answers to researchers faster, more efficiently, and more affordably. One area of industry where high-throughput genotyping solutions is especially applicable is agricultural biotechnology, in which a molecular breeding revolution has begun to replace traditional breeding methods. Using genetic analysis approaches such as single nucleotide polymorphism (SNP) genotyping, millions of plant samples are screened annually to select and maintain desired genotypic markers correlated to phenotypic traits. Ultimately, this goal of increasing crop yields has fueled innovations in genetic analysis platforms that are robust, scalable, and automated. In July 2012, Douglas Scientific and Life Technologies agreed to work together to optimize the TaqMan Assay chemistry offered by Life Technologies for the Douglas Figure 1. An Array Tape array, a thin and flexible microplate replacement. Scientific Array Tape platform. This partnership brought together two industry-leading technologies: TaqMan Assays, the gold standard for realtime quantitative PCR (qpcr), and Array Tape arrays, made up of a continuous polymer strip embossed with miniaturized reaction wells (Figure 1), and supporting instruments. TaqMan 5 nuclease chemistry has a longstanding reputation for exceptional quality and performance in qpcr applications such as SNP genotyping, gene expression analysis, copy number variation, and somatic mutation detection. The Douglas Scientific Array Tape platform is a breakthrough solution for highthroughput automated genotyping applications. The system allows researchers to process hundreds of thousands of data points per day with a high amount

2 of flexibility, data reproducibility, and automation. The embossed wells on Array Tape arrays are miniaturized versions of standard microtiter plate wells, enabling users to achieve reagent utilization and cost efficiencies through a reduction in reaction volumes of up to 80 90% of that typical in standard microtiter plates. Combined with the robustness of TaqMan SNP Assays, these two technologies are a natural fit to provide researchers a completely integrated end-to-end solution for highthroughput genotyping applications. This application note describes the results from the collaborative effort between Douglas Scientific and Life Technologies to optimize TaqMan chemistry on the Array Tape platform. Liquid class verification, thermal cycling reaction conditions, and scanner settings were fine-tuned to achieve high-quality performance. Data showed highly robust SNP allele discrimination in maize and soy samples, with data comparable to those obtained with standard realtime PCR instruments. Assay design Five SNPs were randomly selected for the validation and optimization of TaqMan chemistry on the Douglas Scientific Array Tape platform. The context sequence for each assay was selected from published literature and is shown in Table 1. Table 1. TaqMan Assay context sequences. Crop Marker Context sequence locus Maize ae1.7 GCAGGACTGTTCGCATGATAATAGGCCATATTC[a/g] TTCTCGGTTTATACACCAAGYAGAACATGTGTCG TCTATGCTCC Maize PZA GTTCGGTGTGACTGCATAAGTGCATCTGGTTGCTT GA[c/t]GCGCAGCTTTGCTTGCGCTAATGTGAAGT Maize PZA GCTGCTGGGAACCTATTCGTGCTGGTTCATTTATAT GTGAGTATGC[c/t]GTGAGGTYATTGATGAGCTCAAA TTTAATTTGAATGATAGTGAAGATGATTACATTTTTC AAACTGTATGCCCTGG Maize PZA CCTTGGAGGGTAGAGCATTGAGGCGGGGTTATGAGT AGAACCGTCGC[a/g]GATTAAATGATTATGACCGTG TTTCTTTACGCAATTTCTTCGTGCTATTGGTACTTA TACACTGCTCTCCTCTGC Soy rs GAAAGCATTGATGAGGCGAACTTGGGATA[c/t]AGC TACAGCGTGGTTGGGGGTGCTGCATTGCCAGACA CGGC Custom TaqMan SNP Genotyping Assays were then designed using the Custom TaqMan Assay Design Tool, which generated five TaqMan Assays, each comprised of a forward primer, a reverse primer, a FAM dyelabeled probe specific to one allele, and a VIC dyelabeled probe targeting the other allele. Four of those assays targeted 4 mutations in the maize genome, while one was selected for soy. Sample preparation The Sample-to-SNP Kit was used to extract DNA from 21 maize and 22 soy seed varieties. This kit provides DNA Extract All reagents for efficient cell lysis with a fast five-minute protocol and was developed to work in conjunction with TaqMan GTXpress Master Mix (provided in the Sample-to-SNP Kit) and with TaqMan SNP Assays. One seed from each variety was chipped (2 3 mm) and placed into a 96-well PCR plate. DNA lysis solution (50 µl) was added to each sample in the plate. The plate was then sealed and incubated at 95 C using a 9700 thermal cycler. After incubation, the seal was removed and 50 µl of stabilizing solution was added to each sample. The plate was then sealed, gently vortexed, and stored at 4 C for later use. Liquid class optimization The Nexar liquid handling instrument was optimized for the TaqMan SNP Assays by adjusting liquid class and dispense settings for both dispense quality and efficiency (Table 2). Table 2. Nexar instrument settings. Setting Value Aspirate velocity 40 cycles Air gap volume 15,000 nl Extra dispense volume 12% Dispense pressure 1.1 psi Dispense valve open width 41 Dispense wash cycles 80 Dispense velocity 100 mm PCR on Array Tape arrays For PCR, the maize and soy samples were first diluted 2 to 5 in 1x TE buffer and transferred into a Corning 96-well plate. Reaction mixes for each assay were assembled into a separate 96-well plate according to the quantities shown in Table 3. The plates were then loaded onto the Nexar liquid handling instrument, where the 96-tip, parallel channel contact-dispensing head transferred 800 nl from the sample source plate into one quadrant of an empty 384- well Array Tape array. Next, the Array Tape arrays automatically advanced to the four channel, non-contact dispense jet, which transferred 800 nl from the reaction mix source plate to the appropriate wells of the Array Table 3. Reaction mix setup. Item Stock 1 rxn 120 rxns GTXpress master 2x 0.76 μl 91.2 μl mix Assay 40x 0.04 μl 4.8 μl

3 Tape array. The combined volume of the assay was 1.6 µl. The Array Tape tape moved inline to the sealing module, where a continuous cover seal was applied and the assays were fed into an output reel in preparation for PCR thermal cycling. The automated inline process continued until all arrays were processed. The completed assays were then transferred to the Soellex water bath thermal cycler. The default cycling protocol (condition 1) is shown in Table 4. After approximately 75 minutes of cycling, the entire reel of tape was transferred to the Araya fluorescence scanning instrument for detection. The automated tape scanner measures FAM, VIC, and ROX dye fluorescence for an entire 384-well array in 28 seconds. The scanned data was then imported into the proprietary Douglas Scientific Intellics genotyping software for calling and clustering. The Douglas Scientific Array Tape platform is shown in Figure 2. Gain optimization After thermal cycling, the Array Tape was fed through the Araya detection instrument. The Araya reader has two photomultiplier tubes (PMTs) to read fluorescence from FAM, VIC, and ROX dyes. With gain fixed for PMT1, the tapes were scanned with PMT2 at 0.22, 0.39, 0.44, and 0.66 to determine the optimal setting for PMT2 gain. The raw data were then fed into Douglas Scientific Intellics software to make allelic calls as well as to generate 2-D cluster plots. These results showed that the cluster plot quality was not significantly affected by gain settings between 0.22 and However, the highest PMT2 gain setting (0.66) caused an increase in background signal, which resulted in visualization of unfilled wells within the 2-D cluster plot (Figure 3). Table 4. Soellex water bath thermal cycling conditions. Condition Initial hold Denature Extension No. cycles 1 (default) 60 sec sec 90 sec 60 sec Araya detection instrument Soellex water bath thermal cycler Nexar liquid handling instrument Figure 2. The Douglas Scientific Array Tape Platform.

4 A. Gain = 0.22 B. Gain = 0.39 A. Condition 1 B. Condition 2 C. Gain = 0.44 D. Gain = 0.66 C. Condition 3 D. Condition 4 Unfilled wells Figure 3. Cluster plots generated from different PMT2 gain settings. Thermal cycling optimization Various thermal cycling protocols were also tested to determine the optimal cycling parameters shown in Table 4. Three additional sets of arrays were assembled to compare conditions 2 4 with the default settings (condition 1). For condition 2, the numbers of cycles was changed from 40 to 50 while the rest of the protocol matched the default parameters. In Table 4, parameters changed for each condition are marked in red. The extension time for condition 3 was lengthened by 30 seconds while condition 4 tested reducing the number of cycles from 40 to 35. The results showed that data quality was unaffected by changing the number of cycles or by lengthening the extension time (Figure 4). This confirmed that the default condition 1 was sufficient to produce accurate genotyping calls and clusters. Additionally, the number of cycles could be reduced to from 40 to 35 without compromising the data quality. Figure 4. Array Tape platform cluster plots for each cycling condition shown in Table 4. Concordance with the ViiA 7 system The previous experiments were repeated on an ViiA 7 Real-Time PCR System to validate TaqMan chemistry on the Douglas Scientific Array Tape platform. Reactions of 5 µl were prepared in 384-well plates using reagent and template concentrations identical to the Array Tape platform reactions. Likewise, the same default cycling protocol used on the Array Tape platform was applied to the ViiA 7 system runs. The ViiA 7 system software was used to make calls and generate cluster plots, which were compared with the corresponding Array Tape platform data to evaluate concordance (Figure 5). Figure 4 shows the ROX dye-normalized 2-D cluster plots for locus PZA (maize) and rs (soy) on both platforms. Samples that were homozygous for allele 2 only emit FAM dye fluorescence and were clustered along the y-axis (blue for the ViiA 7 system and red on the Array Tape platform). Homozygous allele 1 samples were plotted along the horizontal x-axis because they only emit VIC dye fluorescence. The clustering of homozygous allele 1, homozygous allele 2, and heterozygous alleles on the Array Tape platform was virtually identical to that of the ViiA 7 system plots. The same trend was observed for the three assays not shown. Furthermore, the calls were recorded for all 5 assays and 100% concordance was observed between the two platforms.

5 A. ViiA 7 system B. Array Tape system C. ViiA 7 system: soy D. Array Tape system: soy Figure 5. Array Tape platform concordance with the ViiA 7 Real-Time PCR System. Discussion We have optimized the performance of TaqMan genotyping reagents on the Douglas Scientific Array Tape platform to provide robust data quality for the needs of researchers performing ultrahigh-throughput genotyping. Three unique areas of system performance that we investigated and optimized were: In addition, Array Tape technology combined with TaqMan reagents for SNP genotyping has specific workflow advantages to help increase throughput while minimizing hands-on time. The workflow starts with a simple, fiveminute DNA extraction step provided by the DNA Extract All component of the TaqMan Sample-to-SNP Kit, which produces a lysate that can be added directly into the PCR mixture. The assembly of sample and reaction mix source plates could be integrated into the Array Tape platform to provide a seamless workflow. An entire reel of Array Tape tape can then be cycled on the Soellex thermal cycler in under 75 minutes, while scanning on the Araya scanner takes about 28 seconds for each 384-well array. Additionally, our data suggest that the number of cycles of PCR can be modestly reduced by at least five cycles in order to save more time without impacting data quality. Overall, 800 microplate equivalents (307,200 data points) can be processed by one technician in a workday. Douglas Scientific provides its Intellics and SNP analysis software for seamless data analysis and integration, including instrument monitoring, easy, flexible assay setup, and template selection and SNP scoring. By working together, Life Technologies and Douglas Scientific have optimized a solution for high-throughput genotyping applications to enable researchers to significantly scale up their operations an throughput while simultaneously maximizing their data quality and cost efficiencies. 1. Liquid handling of TaqMan reagents on the Nexar liquid handling system. 2. Araya scanner gain settings. 3. Thermal cycling protocols on the Soellex water bath thermal cycler. Our data demonstrate that the use of TaqMan Assays and reagents on the Array Tape platform yields results similar to those obtained on standard real-time PCR instruments. Moreover, with the miniaturization of reaction volumes a capability of the Array Tape platform users can realize increased efficiencies and gains in throughput and reagent utilization. Preoptimized conditions for TaqMan chemistry minimize setup time on the Array Tape platform and provide high-quality data with highly repeatable results.

6 Learn more at lifetechnologies.com/qtl For Research Use Only. Not for use in diagnostic procedures Life Technologies Corporation. All rights reserved. The trademarks mentioned herein are the property of Life Technologies Corporation and/or its affiliate(s) or their respective owners. TaqMan is a registered trademark of Roche Molecular Systems Inc., used under permission and license. Araya, Nexar, and Soellex are registered trademarks and Array Tape and Intellics are trademarks of Douglas Scientific. CO