Supporting Information for. Flow cytometer-based high throughput screening system for accelerated directed evolution of P450 monooxygenases

Transcription

1 Supporting Informtion for Flow cytometer-bsed high throughput screening system for ccelerted directed evolution of P450 monooxygenses Ann Joelle Ruff 1#, Alexnder Dennig 1#, Georgette Wirtz 1, Miln Blnus 2, Ulrich Schwneberg 1* # Both uthors contributed eqully *Corresponding uthor: E-Mil: u.schwneberg@biotec.rwth-chen.de 1 Lehrstuhl für Biotechnologie, RWTH Achen University, Worringerweg 1, Achen, Germny 2 School of Engineering nd Science, Jcobs University Bremen, Cmpus Ring 1, Bremen, Germny Jcobs University Experimentl All chemicls were of nlyticl grde or higher qulity nd purchsed from Sigm-Aldrich Chemie (Steinheim, Germny), AppliChem (Drmstdt, Germny), nd Crl Roth (Krlsruhe, Germny). Oligonucleotides were purchsed from Eurofins MWG Operon (Ebersberg, Germny) in slt-free form nd diluted in milli-q wter to finl concentrtion of 100 µm. All primers used re summrized in Supplementry Tble S1. Restriction enzymes nd nucleotides were purchsed from Ferments (St. Leon-Rot, Germny) nd polymerses from New Englnd Biolbs (Frnkfurt, Germny). PCRs were performed in 0.2 ml thin-wlled PCR tubes from Srstedt (Nuembrecht, Germny) employing Mstercycler Grdient PCR-mchine from Eppendorf (Hmburg, Germny). DNA ws quntified by NnoDrop photometer from NnoDrop Technologies (Wilmington, DE, USA). DNAsequencing ws performed t GATC Biotech (Konstnz, Germny) nd Eurofins MWG-Operon (Ebersberg, Germny). Anlysis of obtined sequencing dt ws performed using the Clone Mnger 9 Professionl Edition Softwre (Scientific & Eductionl Softwre, Cry, NC, USA). EpPCR librry genertion (0.05 mm, 0.1 mm, 0.2 mm MnCl 2 ) EpPCR-librries of P450 BM3 were constructed ccording with vrible MnCl 2 concentrtions 0.05 mm, 0.1 mm, 0.2 mm. 1 Gene specific primers P1 nd P2 (see supplementry tble S1) were used for insert mplifiction. A stndrd EpPCR mster mix of 50 µl contined: Templte plsmid DNA 1 ng/µl, Tq-buffer 1x, dntps 0.2 mm, Tq-polymerse 5 U, ech primer 0.3 pmol/µl, MnCl mm. EpPCR protocol: 94 C for 30 sec (1 cycle); 94 C for 30 sec, 60 C for 1 min, 72 C for 1 min/kb (30 cycles); 72 C for 10 min (1 cycle). For vector mplifiction the primers P3 nd P4 (see supplementry tble S1) were used. The PCR products were DpnI digested (20 U; 37 C, 3 h) nd purified using the Nucleospin Extrct II kit (Mcherey Ngel, Dueren, Germny). Vector-PCR (50 µl) contined: Templte DNA 50 ng/µl, HF-Buffer 1x, dntps 0.2 mm, Phusion High-Fidelity DNA Polymerse (NEB) 5 U, ech S 1

2 primer 0.5 pmol/µl. PCR protocol: 98 C for 30 sec (1 cycle); 98 C for 10 sec, 55 C for 30 sec, 72 C for 1 min/kb (25 cycles); 72 C for 5 min (1 cycle). PCR products were hybridized by using the PLICing cloning method. 2 Expression of P450 BM3 muteins P450 BM-3 mutein expression in flsks nd in deep-well microtiterpltes ws crried out s performed s described previously by Nzor et l.. 3 Flow cytometry ssy with whole cells Cell popultions subjected to be nlyzed by flow cytometry were expressed in flsks. As control, cells expressing the empty vector were used s negtive control. After centrifugtion of the culture (4000 rpm, 20 min, 4 C), cells were wshed in PBS-Buffer nd the pellet ws resuspended in sterile PBS-buffer (in 1/10 of the culture volume). Rection mixture (300 µl) contined, 25 µl resuspended cells, 1 µl BCCE (200 mm in DMSO), PBS-buffer (0.03 M NCl, 2.7 mm KCl, 0.01 M N 2 HPO 4, 1.8 mm KH 2 PO 4, ph 7.4 djusted with HCl) nd ws incubted 90 min. The rection mixture ws diluted 1:10 in PBS-buffer nd filled in 3.5 ml nlysis tubes (Srstedt, Nümbrecht, Germny). The prepred cells were nlyzed in CyFlow Spce flowcytometer (Prtec, Münster, Germny) t liquid flow-speed of 5 µl/min, using PBS-buffer s sheet fluid. Dt of SSC, FSC nd UV-lser emission (FL3: λ Ex 350 nm nd λ Em 450 nm) were recorded. Sorting of desired popultions occurred under size triggering nd gting the UV-lser emission response with trigger dely of 2, pulse of 10 nd sorting speed of events/sec. Sorted cells were collected, plted on LB kn (50 µg/ml) gr pltes nd incubted overnight t 37 C. Enriching for ctive clones ws chieved by wshing sorted nd recovered colonies from gr pltes nd expressing them in flsks followed by nother round of sorting. BCCE ctivity ssy in 96-well plte formt The ssy ws performed nlog to the MTP-ssy described by Nzor 3 with minor modifictions. The hrvested cells in deep-well pltes were resuspended in 300 µl Tris/HCl-buffer (0.1 M, ph 8.2). After ddition of 5 µl polymyxin B sulfte (3.6 mm), the 96-well pltes were incubted for 15 min t RT t 1000 rpm. 100 µl of the lyste were pipetted into blck flt bottom 96well MTP (Greiner Bio-one, Frickenhusen, Germny ) nd incubted for 5 min (700 rpm shking) with 2 µl of BCCE (2 mm in DMSO). The conversion of BCCE ws initited by ddition of 50 µl NADPH (1 mm). The fluorescent signl ws recorded for X min (λ Ex : 400 nm, λ Em : 440 nm) using n Infinite M1000 microtiter plte reder (Tecn Group, Männedorf, Switzerlnd). Protein purifiction P450 BM3 vrints were purified ccording to published protocol 4 by nion-exchngechromtogrphy using n ÄKTAprime plus pumping system (GE Helthcre, München, Germny) nd Kronlb ECOplus TAC 15/125PE5-AB-2 column (YMC Europe, Dinslken, Germny) pcked with Toyo Perl 650 S-DEAE Sephrose Mtrix (Tosoh bioscience, Tokyo, Jpn). The collected frctions were nlyzed on 10 % SDS-PAGE for protein purity. Frctions contining the highest mount of pure P450 BM3 monooxygense were recombined nd concentrted using n Amicon Centrifugl Filter S 2

3 Units (30 kd cut-off membrne; Millipore, Billeric, USA). Deslting of the purified BM3 vrints ws crried using PD-10 Deslting Column (GE Helthcre) equilibrted in Tris/HCl buffer (0.1 M, ph 7.8). Protein solutions were frozen in liquid nitrogen before lyophiliztion for 48 h in Christ ALPHA 1-2LD plus lyophilistor (Christ, Osterode m Hrz, Germny). Kinetic Chrcteristion of P450 BM3 vrints The P450 concentrtion in solution ws determined by crbonmonoxide (CO)-gssing. 5 For kinetic chrcteriztion rection mixture in blck flt bottom MTP contined: 196 µl tris/hcl-buffer (0.1 M, ph 7.8, nm purified enzyme, 2 µl of BCCE nd 5 µl ctlse (12000 U/ml). Estimtion of km nd Vmx were chieved by vrying BCCE concentrtions from 0 to 20 mm. The MTP ws incubted for 15 min t 800 rpm, before rection ws strted by ddition of 50 µl NADPH (1 mm). The fluorescent signl (λ Ex : 400 nm, λ Em : 440 nm) ws recorded using n Infinite M1000 microtiter plte reder (Tecn Group, Männedorf, Switzerlnd). All mesurements were done in triplictes. Concentrtion of the product ws clculted from stndrd curve obtined for 7-hydroxy-3-crboxy coumrin ethyl ester (3-CCE). Fitting of kinetic prmeters ws chieved using Origin 7.0 softwre (OriginLb Corportion, Northmpton, MA, USA). Substrte synthesis 6,7 Step 1 Synthesis of 3-crboxy-coumrin ethyl ester (3-CCE) 8.4 g (60.82 mmol) of 2,4-dihydroxybenzldehyde ws dissolved in 45 ml of nhydrous methnol. Solution ws stirred nd 8.7 g (54.32 mmol) of diethyl mlonte ws supplemented nd refluxed. 450 mg (5.16 mmol) of morpholin nd 150 mg (2.49 mmol) of cetic cid were supplemented to 2 ml of methnol nd stirred until the precipitte fully dissolved. This solution ws subsequently trnsferred to the refluxed rection mixture nd reflux ws continued for nother 3 hours. After cooling, the product ws filtered nd re-crystllized from boiling methnol (~300 ml). Step 2 Preprtion of sodium slt 3-crboxy-coumrin For this step, 1.5 g (6.81 mmol) of 3-CC ethyl ester were dissolved toluene (50 ml), stirred nd heted (120 C) nd concentrted by evportion to 5 ml (30-60 minutes). After cooling the mixture to room temperture, 0.5 g (10.84 mmol) of NH ws supplemented. The mixture ws heted to 120 C nd stirred until toluene evported (1-2 hours). The obtined slt ws dried in vcuum overnight. S 3

4 Step 3 Attching benzyl group to 3-CC ethyl ester 3 g (12.39 mmol) of prepred 3-CC methyl ester sodium slt ws dissolved in 200 ml DMF (dried with moleculr sieves). Mixture ws heted to 120 C. During heting, g (12.5 mmol) of benzyl bromide ws supplemented. Mixture ws stirred gently nd kept t 120 C for 2 hours. One g of benzyl bromide (5.85 mmol) ws supplemented nd conversion continued t 120 C for 4-6 hours nd the sme procedure ws repeted once more (supplementing of benzyl bromide 0.7 g, 4.09 mmol; 1 hrs 120 C). Subsequently the rection mixture ws cooled to room temperture nd poured into 400 ml of ice cold wter. After precipittion (30-60 min), the suspension ws filtered, rinsed with wter, dried nd re-dissolved in CH 2 Cl 2. The orgnic phse ws extrcted twice with wter, filtered, concentrted (Rotvp) nd the precipitte ws dried overnight in vcuum. The trgeted compounds were purified by chromtogrphy employing silic gel (DC60). Smple ws dissolved in CH 2 Cl 2 nd elution ws performed with n ethyl cette : CH 2 Cl 2 (1:20) mixture. Purity ws monitored on TLC using sme solvent system nd min frctions were pooled ccording to TLC. 13 C-NMR nd 1 H-NMR spectr were recorded using Bruker AV400 (Bruker, Mdison, WI, USA). 7-hydroxy-3-crboxy-coumrin ethyl ester (3-CCE): 1 H NMR (400 MHz, DMSO) δ 1.29 (t, 3H, J = 7.2 Hz, CH 3 ); 4.26 (q, 2H, J = 7.2 Hz, CH 2 ); 6.73 (s, 1H, ArH); 6.84 (d, 1H, J = 8.5 Hz, ArH); 7.75 (d, 1H, J = 8.8 Hz, ArH); 8.67 (s, 1H, ArH) ppm. 13 C NMR (400 MHz, DMSO) δ 14.09, 60.76, , , , , , , , , , ppm. 7-benzoxy-3-crboxy-coumrin ethyl ester (BCCE): 1 H NMR (400 MHz, CDCl 3 ) δ 1.32 (t, 3H, J = 7.0 Hz, CH 3 ); 4.31 (q, 2H, J = 7.0 Hz, CH 2 ); 5.07 (s, 2H, CH 2 ); 6.80 (d, 1H, J = 8.7 Hz, ArH); (m, 5H, Ph-Ring); 7.42 (d, 1H, J = 8.7 Hz, ArH); 8.41 (s, 1H, ArH) ppm. 13 C NMR (400 MHz, CDCl 3 ) δ 13.26, 60.69, 69.75, , , , , , , , , , , , , , , , ppm. S 4

5 Tble S1: Primer used in experimentl section Primer P1 Sequence (5-3 ) CATGGGCATGACAATTAAAGAAATGCCTCAG P2 CGACGGAGCTCGAATTCTTATTACCCAGC P3 CGAGCTCCGTCGACAAGCTTGCG P4 GTCATGCCCATGGTATATCTCCTTC bold letters represent phosphorothiolted nucleotides 1 b1 2 b2 Fig. S1: Phse contrst (1, b1) nd Fluorescence microscopy (2, b2) fter incubtion with BCCE nd whole cell expression using n empty vector () nd P450 BM3 F87A (b). S5

6 Fig. S2: Whole cell re-screening with BCCE fter sorting of mixed popultions of E. coli cells in rtios 1:1 nd 9:1 (ctive/inctive). 45 clones were tested for rtio 1:1 nd 15 clones for rtio 9:1. Threshold for inctive clones ws set ccording to cells not expressing P450 BM RFU [-] Time [s] BCCE [µm] Fig. S3: BCCE conversion with purified P450 BM3 M3 DM-1 (R47F F87A M354S D363H R471C N543S R255H) with vried concentrtion. S 6

7 Employed P450 BM3 vrints P450 M3: R47F F87A M354S D363H 3 ; P450 M3 DM: R47F F87A M354S D363H R471C N543S; P450 M3 DM-1: R47F F87A M354S D363H R471C N543S R255H; P450 M3 DM-2: R47F F87A M354S D363H R471C N543S R203H I401V F423L References (1) Cirino, P. C.; Myer, K. M.; Umeno, D. Methods Mol. Biol. (N. Y.). 2003, 231, 3-9. (2) Blnus, M.; Schenk, A.; Sdeghi, H.; Mrienhgen, J.; Schwneberg, U. Anl. Biochem. 2010, 406, (3) Nzor, J.; Dnnenmnn, S.; Adjei, R. O.; Fordjour, Y. B.; Ghmpson, I. T.; Blnus, M.; Rocctno, D.; Schwneberg, U. Protein Eng., Des. Sel. 2008, 21, (4) Schwneberg, U.; Spruer, A.; Schmidt-Dnnert, C.; Schmid, R. D. J. Chromtogr., A 1999, 848, (5) Omur, T.; Sto, R. J. Biol. Chem. 1964, (6) Chilvers, K. F.; Perry, J. D.; Jmes, A. L.; Reed, R. H. J. Appl. Microbiol. 2001, 91, (7) Sun Y.-F.; M S.-Y.; Zhng D.-D.; Cheng, X.-L. Imging Sci. Photochem. 2008, 26, S 7