RNA Isolation for Frozen Mouse Livers and Reverse Transcription

Size: px
Start display at page:

Download "RNA Isolation for Frozen Mouse Livers and Reverse Transcription"

Transcription

1 RNA Isolation for Frozen Mouse Livers and Reverse Transcription I. Introduction RNA is typically isolated from tissue or cells based on the procedure originally described by Chomczynski and Sacchi in In this method tissue or cells are disrupted in a solution containing guanidinium thiocyanate, a strong chaotropic denaturant, which lyses cells and inactivates cellular RNases. The sample lysate was then mixed with a sodium acetate, ph 4, water saturated phenol and chloroform:isoamyl alcohol (49:11 v/v) solution. After subsequent cooling and centrifugation, the RNA was removed from the aqueous phase whereas DNA and protein were present in the interphase and phenol phase. The RNA was then precipitated with isopropanol, reprecipitated, washed and finally solubilized in 0.5% SDS. Recent technologies have allowed for RNA isolations based on the silica-based filters, thus avoiding the use of organic solvents required for the extraction step. We will be using Ambion s RNAqueous -4PCR Kit. After mixing the lysate with ethanol the resulting solution is added to the silica filter that selectively binds mrna and larger 18S and 28S ribosomal RNAs; very small RNAs such as trna and 5S ribosomal RNA are not quantitatively bound. The filter is then washed to remove DNA, protein, and other contaminants. The RNA is then eluted in nuclease-free water containing a trace amount of EDTA to chlelate heavy metals. To ensure that there is no trace DNA contamination that may produce a false positive for a reverse transcriptase PCR (RT-PCR), the eluted RNA may be treated with DNase 1. If the RNA has been treated with DNase 1, it, and divalent cations, must be removed for further downstream applications. The concentration of RNA is determined, after diluting the recovered RNA with T.E (10mM Tris, 0.1 mm EDTA, ph 8), using the following equation: [RNA], µg/ml = A 260 x dilution factor x 40 µg/ml Though yields will vary according to type and amount of sample, 1-10 µg per mg tissue are expected. Purity of the RNA is indicated by A 260 /A 280 ratio values in the range of

2 Though freshly dissected tissues give the best yields, tissues treated with a tissue storage/rna stabilization solution, such as Ambion s RNAlater TM can be used with very good results. Additionally, as RNases are much more resilient than DNases, special care must be made to ensure an RNase free work environment. Thus, RNase decontamination solutions such as Ambion s RNaseZap will be used to inactivate RNases on work surfaces and on equipment. As PCR requires a DNA template to amplify DNA with DNA polymerases, RNA cannot be used directly as a template. With the discovery of the enzyme reverse transcriptase in the late 1980s, it is now possible to copy RNA into its complementary DNA sequence (cdna). The process of subjecting RNA to reverse transcription followed by PCR is commonly known as RT-PCR and can be used to generate inserts for cloning into plasmid vectors, to make templates for in vitro transcription, or to assess the mutational status of expressed sequences. There are a couple of ways in which to generate cdna with the reverse transcriptase; one with oligo (dt) 18 primers that correspond to the 3 poly(a) tails of mrna and the other with random decamers which is useful if the mrna template is partially degraded and lacking the poly(a) tails. Appropriate controls are required to detect the presence of genomic DNA in the RNA isolation. II. Materials 1. Frozen mouse liver, ~ 75 mg 2. Ambion Ambion s RNaseZap 3. Ambion RNAqueous -4PCR Kit containing various components 4. Kinematica AG Polytron PT1200CL tissue homogenizer with a 7 mm generator 5. Digital Pipets and tips % EtOH 7. T.E Buffer: (10mM Tris, 0.1 mm EDTA, ph 8) o C, 44 o C, 80 o C and 92 o C water baths

3 9. Tabletop Centrifuge: Eppendorf Model 5415C 10. Microfuge tubes: 2.0 ml and 1.5 ml capped polypropylene tubes 11. Beckman DU-640 spectrophotometer and UV microcuvettes 12. Ambion RETROscript TM First Strand Synthesis Kit for RT-PCR 13. Ambion SuperTaq TM recombinant thermostable DNA polymerase, 5 U/µL 14. Thermal Cycler: Eppendorf Mastercycler gradient 15. Agarose: Cambrex Bio Sciences SeaKem LE agarose 16. 1X TBE Buffer: 90 mm Tris, 90 mm boric acid, 0.2 mm Na 2 EDTA, ph ~ Gel Star nucleic acid gel stain: BioWhittaker Molecular Applications 18. Nanofuge: National Labnet Co. Model C-1200 mini centrifuge 19. DNA MW standard: New England Biolabs bp, 100 bp step ladder 20. Horizontal gel electrophoresis apparatus: Fotodyne X Gel loading buffer: 80% (v/v) glycerol, 100 mm Na 2 EDTA, 1% (w/v) SDS, 0.1% (w.v) bromophenol blue, 0.1% (w/v) xylene cyanol FF III. Methods 1. Wear gloves for the entire procedure. 2. Obtain a frozen mouse liver sample, previously treated with Ambion s RNAlater TM, from your instructor; the sample has been pre-weighed and the mass written on the 2.0 ml microfuge tube. Record the mass. 3. Estimate the tissue volume and add volumes of the Lysis/Binding Solution; consult with your instructor 4. Carefully, homogenize the tissue with the Polytron homogenizer. 5. Centrifuge the lysate at 11,000 rpm for 1 min to clarify the lysate. Carefully transfer the supernatant to a clean sterile 2.0 ml microfuge tube. Estimate the volume and add an equal volume of 64% ethanol. Mix thoroughly by vortex mixing.

4 6. Pipet no more than 700 µl of the lysate/ethanol mixture onto the RNAqueous Filter Cartridge in a collection tube. Centrifuge at 13,000 rpm (do not exceed this limit as filter can become damaged!) until the lysate/ethanol solution has passed through the filter (1 min, possibly more); discard the eluate and reuse the collection tube. Repeat this process with the remainder of the lysate/ethanol mixture with the same filter (do not exceed 700 µl); discard the eluate. If needed repeat with the remainder of the lysate/ethanol solution; discard the eluate and reuse the collection tube. 7. Apply 700 µl of Wash Solution #1 to the filter cartridge and centrifuge at 13,000 rpm until all the wash solution is through the filter (1 min, possibly more); discard the eluate and reuse the collection tube. 8. Add 500 µl of Wash Solution #2/3 to the filter cartridge and centrifuge at 13,000 rpm until all the wash solution is through the filter (1 min, possibly more); discard the eluate and reuse the collection tube. Repeat with an additional aliquot of Wash Solution #2/3. After discarding the second wash solution centrifuge for an additional 1 min to remove the last traces of the wash solution. Put the filter cartridge into a new collection tube. 9. Add 50 µl of 80 o C Elution Solution to the filter and quickly centrifuge at 13,000 rpm. Using the same collection tube add a second 10 µl aliquot of 80 o C Elution Solution to the filter and quickly centrifuge at 13,000 rpm. Save the eluate and discard the filter. 10. To ensure that there is no DNA contamination the isolated RNA will be treated with DNase. Add 6 µl of 10X DNase 1 buffer and 1 µl of 2 U/µL DNase I. Mix gently and place in a 37 o C water bath for 20 min. 11. Resuspend the DNase Inactivation Reagent by vortex mixing. Remove the sample from the water bath and add 7 µl of the re-suspended DNase Inactivation Reagent to it. Flick the tube gently to disperse the DNase Inactivation Reagent. Incubate at room temperature for 2 min, flicking the tube one more time at the 1 min mark. 12. Centrifuge at 11,000 rpm (10,000 x g) for 1 min and carefully transfer the supernatant to a clean sterile 1.5 ml microfuge tube. Label your RNA sample appropriately and keep on ice. 13. Take the A 260, A 280 and A 320 absorbance readings of a 1:40 diluted (2 µl RNA sample plus 78 µl T.E buffer) RNA sample using a Elution Solution diluted in the same manner as the blank. The A 260 reading should be between 0.1 and 1.0. Consult with your instructor if it is not. Subtract the A 320 value from the A 260 and A 280 values. Determine the RNA concentration (µg/µl) for your undiluted sample using the equation in the introduction. Determine the total µg of RNA recovered from you tissue sample. Estimate the volume of your

5 undiluted sample with a pipet, try an initial setting of 60 µl. Calculate the µg RNA/mg tissue. 14. Using your calculated RNA concentration determine the volume required for 1-2 µg of RNA. Show this to your instructor. Depending on its value (it should not exceed 10 µl) you may have to concentrate the RNA following a protocol provided by your instructor. Note- a minimum concentration would be [RNA] = 0.1 µg/µl. 15. If your RNA is of suitable concentration perform a Two-Step RT-PCR with heat denaturation RETROScript protocol for reverse transcription reactions using two samples; one with the Oligo (dt) and the other with Random Decamers. 16. To three separate, sterile 1.5 ml microfuge tubes, one labeled dt, one labeled RD, and the third labeled RT, add the appropriate volume of your RNA sample to give 1 2 µg of RNA. To the sample labeled dt add 2 µl of the 50 µm Oligo (dt) primers solution; to the sample labeled RD add 2 µl of the 50 µm Random Decamers solution. To each of these samples add an appropriate volume of nuclease-free water so that the final volume is 12 µl. To the sample labeled RT add an appropriate volume of nuclease-free water so that the final volume is 20 µl; this will serve as a negative control for the subsequent PCR to show if there were any genomic DNA contamination in your RNA sample. Mix and nanofuge these samples briefly and place in the 80 o C water bath for 3 min to denature the RNA. 17. Remove the three samples and place on ice for 1 min. Nanofuge briefly and place back on ice. To only the samples labeled dt and RD add 8 µl of the Reverse Transcriptase Master Mix prepared by your instructor in the following manner: 2 µl 10X RT Buffer (500 mm Tris-HCl, ph 8.3, 750 mm KCl, 30 mm MgCl 2, 50 mm DTT) 4 µl dntp mixture (2.5 mm each dntp) 1 µl 10 U/µL Placenta RNase Inhibitor 1 µl 100 U/µL MMLV-Reverse Transcriptase Your instructor will prepare two positive RT controls with 1 µg of control mouse liver template RNA; one with the oligo (dt) primers and one with the random decamer (RD) primers. 18. Mix gently, nanofuge briefly, and incubate these samples as well as the RT sample at 44 o C for 1 hour. The reverse transcriptase is inactivated by incubating the samples at 92 o C for 10 min. The samples are placed on ice and can now be stored at -20 o C or subjected to PCR.

6 19. The PCR of any cdna produced by the RT reaction will use the RETROscript kit s Positive Control PCR Primer mixture and should yield a 361 bp segment of a conserved housekeeping gene rig/s15 which encodes a small ribosomal subunit protein. The sequence of the primers are: Forward primer: 5 - TTCCGCAAGTTCACCTACC Reverse primer: 5 - CGGGCCGGCCATGCTTTACG 20. To three separate PCR tubes add 2.5 µl of your dt, RD and RT samples, respectively. To each sample add 22.5 µl of a PCR master mix that has been prepared in the following manner: 2.5 µl 10X PCR buffer (100 mm Tris-HCl, ph 8.3, 500 mm KCl, 15 mm MgCl 2 ) 1.25 µl dntp mixture (2.5 mm each dntp) 1.25 µl Positive Control PCR primer mixture (5 µm each primer) 0.4 µl 5U/µL Ambion SuperTaq 17,1 µl sterile molecular biology grade water 21. The PCR is performed as follows: (Program RIGS15) Denature at 95 o C for Denature at 94 o C for: Anneal at 55 o C for : Extend at 72 o C for: 1 min, followed by 30 cycles of 30 sec 30 sec 30 sec After 30 cycles an additional Extension at 72 o C for 5 min Storage at 4 o C followed by storage at 80 o C. Freeze your various, labeled samples 22. The following week prepare a 2.0% (0.60g agarose/30 ml TBE) agarose gel in the usual way with a 8-tooth comb. 23. Recover your PCR samples, thaw and keep on ice. Remove 10 µl of each to separate 1.5 ml microfuge tubes and add 2 µl of the Ambion High Resolution Gel Loading Solution to each. Vortex briefly and spin down for 10 sec. 24. Load 12 µl of your three samples, 12 µl of a positive control sample (provided by the instructor), and 3 µl of the 100 bp DNA ladder into separate wells. Run at 100 V until the blue tracking dye is ~ 1.5 cm from the end of the gel.

7 25. Photo-document your gel. Measure the distance, in mm, from the well to each band of the standards as well as the distance for the samples. 26. Construct a log bp versus distance standard curve and determine the number of bp for each amplified product. Evaluate your results in context of the expected results and use of the various controls. III. Points for Discussion: What was the mass of the mouse liver tissue? What was the concentration (µg/µl) of your isolated RNA solution? What was the A 260 /A 280 ratio and its meaning? What was the µg RNA/mg tissue and how does it compare with what was expected? What volume was required to give 1-2 µg RNA for the RT reaction? Was the RT successful? What was the size of the PCR products for the positive control, your dt and random decamer samples? Compare these to the expected value. Also compare the intensities of the these bands with one another and discuss the significance. Was there any DNA contamination in your RNA sample? IV. References: Chelly, J., Concordet, J., Kaplan, J., and Hahn, A. (1989) Illegitimate transcription: transcription of any gene in any cell type. Proc. Natl. Acad. Sci. USA, 8, Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytica Biochemistry, 162, Inoue, C., Shiga, K., Takasawa, S., Kitagawa, M., Yamamoto, H., and Okamoto, H. (1987) Evolutionary conservation of the insulinoma gene rig and its possible function. Proc. Natl. Acad. Sci, 84, Kitagawa, M., Takasawa, S. Kikuchi, N., Itoh, T., Teraoka, H., Yamamoto, H., and Okamoto, H. (1991) Rig encodes ribosomal protein S15; The primary structure of mammalian ribosomal protein S15. FEBS, 283, RETROscript TM First Strand Synthesis Kit for RT-PCR instruction manual, Version 0011, Ambion, Austin, TX RNAqueous -4PCR Kit instruction manual, Version 0304, Ambion, Austin, TX

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

RevertAid Premium First Strand cdna Synthesis Kit

RevertAid Premium First Strand cdna Synthesis Kit RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent

More information

RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl

RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl

More information

SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual

SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual Toll Free: 866-252-7771 752A Lincoln Blvd. Phone: 732-469-7771 Fax: 732-469-7782 Middlesex, NJ 08846 Web: www.purebiotechllc.com SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual Product: SOLIDscript

More information

Procedure for RNA isolation from human muscle or fat

Procedure for RNA isolation from human muscle or fat Procedure for RNA isolation from human muscle or fat Reagents, all Rnase free: 20% SDS DEPC-H2O Rnase ZAP 75% EtOH Trizol Chloroform Isopropanol 0.8M NaCitrate/1.2M NaCl TE buffer, ph 7.0 1. Homogenizer-probe

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

ab185916 Hi-Fi cdna Synthesis Kit

ab185916 Hi-Fi cdna Synthesis Kit ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1

More information

Plant Genomic DNA Extraction using CTAB

Plant Genomic DNA Extraction using CTAB Plant Genomic DNA Extraction using CTAB Introduction The search for a more efficient means of extracting DNA of both higher quality and yield has lead to the development of a variety of protocols, however

More information

UltraClean Soil DNA Isolation Kit

UltraClean Soil DNA Isolation Kit PAGE 1 UltraClean Soil DNA Isolation Kit Catalog # 12800-50 50 preps New improved PCR inhibitor removal solution (IRS) included Instruction Manual (New Alternative Protocol maximizes yields) Introduction

More information

RNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr)

RNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr) RNA Extraction and Quantification, Reverse Transcription, and Real-time Preparation of Samples Cells: o Remove media and wash cells 2X with cold PBS. (2 ml for 6 well plate or 3 ml for 6cm plate) Keep

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

All-in-One First-Strand cdna Synthesis Kit

All-in-One First-Strand cdna Synthesis Kit All-in-One First-Strand cdna Synthesis Kit For reliable first-strand cdna synthesis from all RNA sources Cat. No. AORT-0020 (20 synthesis reactions) Cat. No. AORT-0050 (50 synthesis reactions) User Manual

More information

How To Make A Tri Reagent

How To Make A Tri Reagent TRI Reagent For processing tissues, cells cultured in monolayer or cell pellets Catalog Number T9424 Store at room temperature. TECHNICAL BULLETIN Product Description TRI Reagent is a quick and convenient

More information

HiPer Total RNA Extraction Teaching Kit

HiPer Total RNA Extraction Teaching Kit HiPer Total RNA Extraction Teaching Kit Product Code: HTBM012 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1 hour Agarose Gel Electrophoresis: 1 hour Storage Instructions:

More information

Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3

Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3 Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA

More information

CompleteⅡ 1st strand cdna Synthesis Kit

CompleteⅡ 1st strand cdna Synthesis Kit Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:

More information

Real-time quantitative RT -PCR (Taqman)

Real-time quantitative RT -PCR (Taqman) Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR

More information

NimbleGen DNA Methylation Microarrays and Services

NimbleGen DNA Methylation Microarrays and Services NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the

More information

TRI Reagent Solution. A. Product Description. RNA / DNA / Protein Isolation Reagent Part Number AM9738 100 ml

TRI Reagent Solution. A. Product Description. RNA / DNA / Protein Isolation Reagent Part Number AM9738 100 ml TRI Reagent Solution RNA / DNA / Protein Isolation Reagent Part Number AM9738 100 ml A. Product Description TRI Reagent * solution is a complete and ready-to-use reagent for the isolation of total RNA

More information

QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.

QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency. QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and

More information

Reverse Transcription System

Reverse Transcription System TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/

More information

Application Guide... 2

Application Guide... 2 Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied

More information

POLYMERASES & AMPLIFICATION. OneTaq RT-PCR Kit. Instruction Manual. NEB #E5310S 30 reactions

POLYMERASES & AMPLIFICATION. OneTaq RT-PCR Kit. Instruction Manual. NEB #E5310S 30 reactions POLYMERASES & AMPLIFICATION OneTaq RT-PCR Kit Instruction Manual NEB #E5310S 30 reactions ISO 9001 Registered Quality Management ISO 14001 Registered Environmental Management ISO 13485 Registered Medical

More information

RIBOPROTECT. RNase Inhibitor RT33-020, RT33-100

RIBOPROTECT. RNase Inhibitor RT33-020, RT33-100 RIBOPROTECT RT33-020, RT33-100 RT33-020, RT33-100 RIBOPROTECT The RIBOPROTECT is a recombinant protein isolated and purified from Escherichia coli. It inhibits ribonuclease (RNase) activity of enzymes

More information

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011 Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)

More information

AffinityScript QPCR cdna Synthesis Kit

AffinityScript QPCR cdna Synthesis Kit AffinityScript QPCR cdna Synthesis Kit INSTRUCTION MANUAL Catalog #600559 Revision C.01 For In Vitro Use Only 600559-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this

More information

ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas

ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas ExpressArt Bacterial H-TR cdna synthesis kit With extreme selectivity against rrnas suitable for 2 to 4 µg total RNA Catalogue No. 8004-A30 (30 rxns) Reagents Materials are provided for 30 cdna synthesis

More information

Terra PCR Direct Polymerase Mix User Manual

Terra PCR Direct Polymerase Mix User Manual Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain

More information

DNA Isolation Kit for Cells and Tissues

DNA Isolation Kit for Cells and Tissues DNA Isolation Kit for Cells and Tissues for 10 isolations of 00 mg each for tissue or 5 x 10 7 cultured cells Cat. No. 11 81 770 001 Principle Starting material Application Time required Results Benefits

More information

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally

More information

ReliaPrep RNA Tissue Miniprep System

ReliaPrep RNA Tissue Miniprep System TECHNICAL MANUAL ReliaPrep RNA Tissue Miniprep System Instructions for Use of Products Z6110, Z6111 and Z6112 Revised 2/16 TM394 ReliaPrep RNA Tissue Miniprep System All technical literature is available

More information

Global MicroRNA Amplification Kit

Global MicroRNA Amplification Kit Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in

More information

DyNAmo cdna Synthesis Kit for qrt-pcr

DyNAmo cdna Synthesis Kit for qrt-pcr DyNAmo cdna Synthesis Kit for qrt-pcr Instruction manual F- 470S Sufficient for 20 cdna synthesis reactions (20 µl each) F- 470L Sufficient for 100 cdna synthesis reactions (20 µl each) Description...

More information

RiboZol RNA Extraction Reagents

RiboZol RNA Extraction Reagents RiboZol RNA Extraction Reagents Code Description Size N580-30ML-SAMPLE Ribozol TM RNA Extraction Reagent 30 ml N580-30ML Ribozol TM RNA Extraction Reagent 30 ml N580-100ML Ribozol TM RNA Extraction Reagent

More information

Kevin Bogart and Justen Andrews. Extraction of Total RNA from Drosophila. CGB Technical Report 2006-10 doi:10.2506/cgbtr-200610

Kevin Bogart and Justen Andrews. Extraction of Total RNA from Drosophila. CGB Technical Report 2006-10 doi:10.2506/cgbtr-200610 Kevin Bogart and Justen Andrews Extraction of Total RNA from Drosophila CGB Technical Report 2006-10 doi:10.2506/cgbtr-200610 Bogart K and Andrews J. 2006. Extraction of Total RNA from Drosophila. CGB

More information

Agencourt RNAdvance Blood Kit for Free Circulating DNA and mirna/rna Isolation from 200-300μL of Plasma and Serum

Agencourt RNAdvance Blood Kit for Free Circulating DNA and mirna/rna Isolation from 200-300μL of Plasma and Serum SUPPLEMENTAL PROTOCOL WHITE PAPER Agencourt RNAdvance Blood Kit for Free Circulating DNA and mirna/rna Isolation from 200-300μL of Plasma and Serum Bee Na Lee, Ph.D., Beckman Coulter Life Sciences Process

More information

PureZOL RNA Isolation Reagent Instruction Manual Catalog #732-6890

PureZOL RNA Isolation Reagent Instruction Manual Catalog #732-6890 PureZOL RNA Isolation Reagent Instruction Manual Catalog #732-6890 For technical support, call your local Bio-Rad office, or in the US, call 1-800-4BIORAD (1-800-424-6723) Table of Contents Section 1 Introduction...1

More information

GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps)

GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps) 1 GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps) (FOR RESEARCH ONLY) Sample : Expected Yield : Endotoxin: Format : Operation Time : Elution Volume : 50-400 ml of cultured bacterial

More information

Mir-X mirna First-Strand Synthesis Kit User Manual

Mir-X mirna First-Strand Synthesis Kit User Manual User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System)

More information

50 g 650 L. *Average yields will vary depending upon a number of factors including type of phage, growth conditions used and developmental stage.

50 g 650 L. *Average yields will vary depending upon a number of factors including type of phage, growth conditions used and developmental stage. 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] Phage DNA Isolation Kit Product # 46800, 46850 Product Insert

More information

Genomic DNA Extraction Kit INSTRUCTION MANUAL

Genomic DNA Extraction Kit INSTRUCTION MANUAL Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview

More information

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination

More information

STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR)

STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR) STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR) [email protected] Av/ Puerta de Hierro s/n. 28040 Madrid. Tel: (34) 913944082

More information

All-in-One mirna qrt-pcr Detection System Handbook

All-in-One mirna qrt-pcr Detection System Handbook All-in-One mirna qrt-pcr Detection System Handbook For quantitative detection of mature mirna All-in-One mirna First-Strand cdna Synthesis Kit Cat. No. AMRT-0020 (20 mirna reverse transcription reactions)

More information

UltraClean Forensic DNA Isolation Kit (Single Prep Format)

UltraClean Forensic DNA Isolation Kit (Single Prep Format) UltraClean Forensic DNA Isolation Kit (Single Prep Format) Catalog No. Quantity 14000-10 10 preps 14000-S 1 prep Instruction Manual Please recycle Version: 10302012 1 Table of Contents Introduction...

More information

Arcturus PicoPure RNA Isolation Kit. User Guide

Arcturus PicoPure RNA Isolation Kit. User Guide Arcturus PicoPure RNA Isolation Kit User Guide For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.

More information

In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab)

In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab) In vitro analysis of pri-mirna processing by Drosha-DGCR8 complex (Narry Kim s lab) 1-1. Preparation of radiolabeled pri-mirna transcript The RNA substrate for a cropping reaction can be prepared by in

More information

EZ Load Molecular Rulers. Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass

EZ Load Molecular Rulers. Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass EZ Load Molecular Rulers Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass EZ Load Molecular Rulers Quantity DNA sufficient for 100

More information

GenElute Mammalian Total RNA Miniprep Kit

GenElute Mammalian Total RNA Miniprep Kit User Guide Catalog Nos. RTN10 RTN70 RTN350 GenElute Mammalian Total RNA Miniprep Kit sigma.com Ordering Information Catalog No. Product Description Pkg Size RTN10 GenElute Mammalian Total RNA Miniprep

More information

Chromatin Immunoprecipitation (ChIP)

Chromatin Immunoprecipitation (ChIP) Chromatin Immunoprecipitation (ChIP) Day 1 A) DNA shearing 1. Samples Dissect tissue (One Mouse OBs) of interest and transfer to an eppendorf containing 0.5 ml of dissecting media (on ice) or PBS but without

More information

MasterPure RNA Purification Kit

MasterPure RNA Purification Kit Cat. No. MCR85102 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 114 6/2012 1 EPILIT114 Rev. A

More information

Classic Immunoprecipitation

Classic Immunoprecipitation 292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.

More information

Recommended Procedures for the Extraction of RNA. Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010

Recommended Procedures for the Extraction of RNA. Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010 Recommended Procedures for the Extraction of RNA Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010 RNA Extraction Isolates RNA from other cellular components in the

More information

UltraClean PCR Clean-Up Kit

UltraClean PCR Clean-Up Kit UltraClean PCR Clean-Up Kit Catalog No. Quantity 12500-50 50 Preps 12500-100 100 Preps 12500-250 250 Preps Instruction Manual Please recycle Version: 02212013 1 Table of Contents Introduction... 3 Protocol

More information

The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade plasmid DNA.

The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade plasmid DNA. INSTRUCTION MANUAL ZymoPURE Plasmid Gigaprep Kit Catalog Nos. D4204 (Patent Pending) Highlights The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade

More information

ISOLATE II PCR and Gel Kit. Product Manual

ISOLATE II PCR and Gel Kit. Product Manual ISOLATE II PCR and Gel Kit Product Manual 2 Product Manual www.bioline.com/isolate PCR and Gel Kit ISOLATE II PCR and Gel Kit ISOLATE II PCR and Gel Kit 1 Kit contents 04 2 Description 04 3 Storage 04

More information

RNA PowerSoil Total RNA Isolation Kit Sample (Catalog No. 12866-S) Information for Ordering Product Catalog No. Quantity 12866-25 25 Preps

RNA PowerSoil Total RNA Isolation Kit Sample (Catalog No. 12866-S) Information for Ordering Product Catalog No. Quantity 12866-25 25 Preps RNA PowerSoil Total RNA Isolation Kit Sample (Catalog No. 12866-S) Information for Ordering Product Catalog No. Quantity 12866-25 25 Preps Instruction Manual New protocol instructions: (Steps 3-5) Phenol:chloroform:isoamyl

More information

Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity

Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity Today you analyze the results of your bacterial transformation from last week and determine the efficiency

More information

DNA: A Person s Ultimate Fingerprint

DNA: A Person s Ultimate Fingerprint A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)

More information

Aurora Forensic Sample Clean-up Protocol

Aurora Forensic Sample Clean-up Protocol Aurora Forensic Sample Clean-up Protocol 106-0008-BA-D 2015 Boreal Genomics, Inc. All rights reserved. All trademarks are property of their owners. http://www.borealgenomics.com [email protected]

More information

IMBB 2013. Genomic DNA purifica8on

IMBB 2013. Genomic DNA purifica8on IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),

More information

qstar mirna qpcr Detection System

qstar mirna qpcr Detection System qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr

More information

TaqMan Fast Advanced Master Mix. Protocol

TaqMan Fast Advanced Master Mix. Protocol TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED

More information

Validating Microarray Data Using RT 2 Real-Time PCR Products

Validating Microarray Data Using RT 2 Real-Time PCR Products Validating Microarray Data Using RT 2 Real-Time PCR Products Introduction: Real-time PCR monitors the amount of amplicon as the reaction occurs. Usually, the amount of product is directly related to the

More information

DNA SPOOLING 1 ISOLATION OF DNA FROM ONION

DNA SPOOLING 1 ISOLATION OF DNA FROM ONION DNA SPOOLING 1 ISOLATION OF DNA FROM ONION INTRODUCTION This laboratory protocol will demonstrate several basic steps required for isolation of chromosomal DNA from cells. To extract the chromosomal DNA,

More information

Troubleshooting Guide for DNA Electrophoresis

Troubleshooting Guide for DNA Electrophoresis Troubleshooting Guide for Electrophoresis. ELECTROPHORESIS Protocols and Recommendations for Electrophoresis electrophoresis problem 1 Low intensity of all or some bands 2 Smeared bands 3 Atypical banding

More information

Detailed protocol: Combined method for RNA isolation. from cartilage

Detailed protocol: Combined method for RNA isolation. from cartilage Detailed protocol: Combined method for RNA isolation from cartilage REAGENTS - chloroform - DNase (RNase-free DNase Set, cat.no. 79254, Qiagen, Hilden, Germany) - 80 % Ethanol (in DEPC-treated water) -

More information

STABILITY: TRI REAGENT is stable at 25 C for at least two years from the date of purchase (3).

STABILITY: TRI REAGENT is stable at 25 C for at least two years from the date of purchase (3). PRODUCT: TRI REAGENT - RNA / DNA / PROTEIN ISOLATION REAGENT May 2014 Cat. No: TR 118 Storage: Store at 4-25 C PRODUCT DESCRIPTION TRI REAGENT is a complete and ready-to-use reagent for the isolation of

More information

FOR REFERENCE PURPOSES

FOR REFERENCE PURPOSES BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit

More information

Hepatitis B Virus Genemer Mix

Hepatitis B Virus Genemer Mix Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For

More information

DP419 RNAsimple Total RNA Kit. RNAprep pure Series. DP501 mircute mirna Isolation Kit. DP438 MagGene Viral DNA / RNA Kit. DP405 TRNzol Reagent

DP419 RNAsimple Total RNA Kit. RNAprep pure Series. DP501 mircute mirna Isolation Kit. DP438 MagGene Viral DNA / RNA Kit. DP405 TRNzol Reagent Overview of TIANGEN Products DP419 RNAsimple Total RNA Kit DP430 RNAprep pure Kit(For Cell/Bacteria) DP315/DP315-R TIANamp Virus DNA/RNA Kit DP431 RNAprep pure Kit (For Tissue) Silica-membrane Technology

More information

MagExtractor -Genome-

MagExtractor -Genome- Instruction manual MagExtractor-Genome-0810 F0981K MagExtractor -Genome- NPK-101 100 preparations Store at 4 C Contents [1] Introduction [2] Components [3] Materials required [4] Protocol 1. Purification

More information

Dynabeads mrna DIRECT Micro Kit

Dynabeads mrna DIRECT Micro Kit USER GUIDE Dynabeads mrna DIRECT Micro Kit Catalog Number 61021 Revision 004 Revision Date 14 May 2012 For Research Use Only. Not for human or animal therapeutic or diagnostic use. For Research Use Only.

More information

Chromatin Immunoprecipitation

Chromatin Immunoprecipitation Chromatin Immunoprecipitation A) Prepare a yeast culture (see the Galactose Induction Protocol for details). 1) Start a small culture (e.g. 2 ml) in YEPD or selective media from a single colony. 2) Spin

More information

RNA Fragment DeepSeq Library Preparation Protocol

RNA Fragment DeepSeq Library Preparation Protocol RNA Fragment DeepSeq Library Preparation Protocol I) LIGATION Recommended input: RNA between 0.05-2 pmol; must have 3' OH 1. Thaw 10X T4 RNA Ligase Reaction Buffer, 50% PEG8000, 20 mm DTT, 7 um App Adaptor

More information

MMLV High Performance Reverse Transcriptase

MMLV High Performance Reverse Transcriptase MMLV High Performance Reverse Transcriptase Cat. Nos. RT80110K and RT80125K Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio).

More information

GENOTYPING ASSAYS AT ZIRC

GENOTYPING ASSAYS AT ZIRC GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed

More information

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B

More information

LAB 11 PLASMID DNA MINIPREP

LAB 11 PLASMID DNA MINIPREP LAB 11 PLASMID DNA MINIPREP STUDENT GUIDE GOAL The objective of this lab is to perform extraction of plasmid DNA and analyze the results. OBJECTIVES After completion, the student should be able to: 1.

More information

QuickZyme Soluble Collagen Assay

QuickZyme Soluble Collagen Assay QuickZyme Soluble Collagen Assay Version June 2012 FOR RESEARCH USE ONLY NOT FOR USE IN DIAGNOSTIC PROCEDURES This package insert must be read in its entirety before using this product. Introduction Collagen

More information

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)

More information

MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C

MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr

More information

Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.

Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers. Unzipping Genes MBPCR014 Beta-Thalassemia Detection Kit P r o d u c t I n f o r m a t i o n Description: Thalassemia is a group of genetic disorders characterized by quantitative defects in globin chain

More information

EZ-RNA II. Instructions for Use. Total RNA Isolation Kit (Without Chloroform) Product Description. Kit Reagent. Reagents Required But Not Supplied

EZ-RNA II. Instructions for Use. Total RNA Isolation Kit (Without Chloroform) Product Description. Kit Reagent. Reagents Required But Not Supplied Molecular Biology EZ-RNA II Total RNA Isolation Kit (Without Chloroform) Cat. No.: 20-410-100 Store at: 2-8 C Instructions for Use Protocol for RNA Isolation Protocol for DNA Isolation Protocol for Protein

More information

Technical Manual No. 0173 Update Date 10112010

Technical Manual No. 0173 Update Date 10112010 TissueDirect TM Multiplex PCR System Technical Manual No. 0173 Update Date 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed

More information

BacReady TM Multiplex PCR System

BacReady TM Multiplex PCR System BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental

More information

EXPERIMENT 6 RNA ISOLATION AND RT-PCR ANALYSIS (GENE TWO)

EXPERIMENT 6 RNA ISOLATION AND RT-PCR ANALYSIS (GENE TWO) EXPERIMENT 6 RNA ISOLATION AND RT-PCR ANALYSIS (GENE TWO) Purpose: To determine the mrna accumulation pattern of the gene of interest in wild type and mutant Arabidopsis siliques. OVERVIEW OF RT-PCR STRATEGY

More information

Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit

Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit USER GUIDE Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit Catalog Number 4368577, 4367659, 4367660, 4368706, 4368702, 4368708 (Master Mix) and 4368711 (RT-PCR Reagents Kit) Publication

More information

RevertAid First Strand cdna Synthesis Kit (#K1621 for 10 reactions) COMPONENTS OF THE KIT

RevertAid First Strand cdna Synthesis Kit (#K1621 for 10 reactions) COMPONENTS OF THE KIT 3 RevertAid First Strand cdna Synthesis Kit (#K1621 for 10 reactions) Kit is designed for preparation of full-length fi rst strand cdna from RNA templates. The RevertAid fi rst strand cdna synthesis kit

More information

PowerFecal DNA Isolation Kit

PowerFecal DNA Isolation Kit PowerFecal DNA Isolation Kit Catalog No. Quantity 12830-50 50 Preps Instruction Manual Inhibitor Removal Technology (IRT) is a registered trademark of MO BIO Laboratories, Inc. and is covered by the following

More information

Troubleshooting Sequencing Data

Troubleshooting Sequencing Data Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page

More information

MasterPure Complete DNA and RNA Purification Kit

MasterPure Complete DNA and RNA Purification Kit MasterPure Complete DNA and RNA Purification Kit Cat. Nos. MC85200 and MC89010 The MasterPure Complete DNA and RNA Purification Kit provides all of the reagents nec essary to recover nucleic acid from

More information

Electrophoresis, cleaning up on spin-columns, labeling of PCR products and preparation extended products for sequencing

Electrophoresis, cleaning up on spin-columns, labeling of PCR products and preparation extended products for sequencing Electrophoresis, cleaning up on spin-columns, labeling of PCR products and preparation extended products for sequencing PAGE electrophoresis Polyacrylamide gel electrophoresis (PAGE) is used for separating

More information

How To Get Rid Of Small Dna Fragments

How To Get Rid Of Small Dna Fragments AxyPrep TM Mag FragmentSelect-I Protocol (Fragment Size Selection for Illumina Genome Analyzer and Life Technologies SoLiD) Introduction The AxyPrep Mag FragmentSelect-I purification kit utilizes a unique

More information

SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit

SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit USER GUIDE SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit Catalog Number 4309155 (Master Mix) and 4306736 (RT-PCR Reagents Kit) Publication Part Number 4310251 Rev. G Revision Date September

More information

Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual

Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual I. Purpose...1 II. Introduction...1 III. Inhibition of Bacterial Growth Protocol...2 IV. Inhibition of in vitro

More information

PicoMaxx High Fidelity PCR System

PicoMaxx High Fidelity PCR System PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED

More information