IGF-1R: A key linker between chemoresistance and cancer stem cells in epithelial ovarian cancer cells Ram Kumar Singh, Ankit Jinager, Ajit Dhadwe, Abhijit De and Pritha Ray* Advanced Centre for Treatment Research and Education in Cancer, Tata Memorial Centre, Navi Mumbai, India 5 th Asia Pacific Summit on Cancer Therapy, 20 th 22 nd July 2015
Ovarian Cancer Ovarian cancer (OC) is the 4 th leading cause of gynecological deaths around the world. (Siegel et al., Cancer J Clin, 2012) As per the Tata Memorial Center, Mumbai s registry India, it is the third most lethal cancer amongst women. Types Germ cell OC (3-5%) Epithelial OC (85-90%) Sex-cord stromal cell OC (5-7%) Chemotherapy Platinum (cisplatin and carboplatin) Taxane (paclitaxel) Subtypes: Epithelial Ovarian Carcinoma Though the patients show response to 1 st line therapy, 50-60 % ultimately exhibit recurrence and finally succumb to the disease.
Key players behind drug resistance There are subset of cells within the heterogeneous tumor designated as cancer stem cells. These CSCs have high DNA repair efficiency and chemo resistance property.
Ovarian cancer and chemoresistance Ovarian cancer-stem-like side population cells are tumorigenic and chemoresistant. (Hu et. al., British Journal of cancer, 2010) In vivo and in vitro studies have showed the role of Insulin Growth Factor -1Receptor (IGF-1R) cross-talk in chemoresistance and have proven that IGF-1R inhibitors can overcome cytotoxic resistance. (Wong et. al., Gynecologic Oncology, 2012).
Neoadjuvent therapy Debulking Surgery Adjuvant Chemotherapy Tumor Relapse Chemo resistance Tumor Relapse Early detection of Chemo resistance Chemo resistance Targeting Right population Cancer Stem Cells IGF-1R Axis
Schematic representation of development of cellular resistant models in A2780 cells
Understanding the role of the biological and molecular players during induction of drug resistance CSC characterization SP assay Biomarker assay Spheroid assay Tumor xenograft assay Cell line used A2780/APFT OAW42 SKOV3 Hey
Side population assay Cisplatin Model Paclitaxel Model Combination Model 2 5 p = 0.0 0 0 2 P e rc e n t S id e P o p u la tio n 2 0 1 5 1 0 5 p = 0.0 0 5 4 p < 0.0 0 0 1 p = 0.0 0 0 4 p = 0.0 0 0 2 p < 0.0 0 0 1 0 A P F T C IS -E R C IS -L R P A C -E R P A C -L R C O M B I-E R C O M B I-L R
Self Renewal and Chemoresistance Property P e r c e n t V ia b ility A A 2 7 8 0 S PN u m b e r o f s p h e ro id s 1 1 0 1 0 0 9 0 8 0 7 0 6 0 5 0 4 0 3 0 2 0 1 0 0 * * * = P < 0.0 0 1 * * * A 2 7 8 0 N S P C IS E R S P * * * * * * C IS E R N S P C IS L R S P C IS L R N S P P A C E R S P * * * * * * P A C E R N S P P A C L R S P * * * * * * P A C L R N S P C O M B I E R S P C O M B I E R N S P C O M B I L R S P C O M B I L R N S P Number of spheroids B 110 100 90 80 70 60 50 40 30 20 10 0 A2780 P=0.0014 P=0.0093 P=0.0008 P=0.0082 CIS ER CIS LR P=0.0004 P=0.0005 PAC ER PAC LR COMB ER COMB LR C 1 0 0 8 0 * * * * M P S P N S P 6 0 4 0 2 0 0 A P F T C IS -L R P A C -L R C O M B I-L R
Stemness gene expression across the resistant models Relative gene expression (2 - ct ) 0.020 APFT CIS-ER CIS-LR PAC-ER *** PAC-LR 0.015 *** COMBI-ER COMBI-LR 0.010 0.005 0.000 * * ** * OCT4A *** * SOX2 ** ** Pluripotent Genes ns ns NANOG ** * ns
Biomarker analysis across the resistant models
Knock down of Oct4 gene using pll3.7 lentilox vector Oct4 target Sequence adapted from Zaheres et al, Stem Cells, 2005 +1 I Sense Loop antisense Terminator TAACATGTGTAAGCTGCGGCCCTTCAAGAGAGGGCCGCAGCTTACACATGTTTTTTTTGC ATTGTACACATTCGACGCCGGGAAGTTCTCTCCCGGCGTCGAATGTGTACAAAAAAAACGCCGG
Effect of oct4 KD on its self renewal and drug resistance N u m b e r o f s e r ia l p a s s a g e A Spheroid formation assay B Spheroid formation at multiple passage Number of spheroids 80 60 40 20 * P<0.05 ** P<0.005 *** P<0.0005 ** *** ** ** *** 8 6 4 2 * * * * * * * * * * * * * = P < 0.0 1 * * * = P < 0.0 0 1 0 0 A2780 Oct4-KD CIS ER Oct4-KD CIS LR Oct4-KD PAC ER Oct4-KD PAC LR Oct4-KD A P F T A P F T -s h O C T 4 C IS -E R C IS -E R s h O C T 4 C IS -L R C IS -L R s h O C T 4 P A C -E R P A C -E R s h O C T 4 P A C -L R P A C -L R s h O C T 4 C Oct4 KD and SP phenotype D MTT assay to monitor drug resistance E Oct4 KD and P-AKT 100 Percent Viability 80 60 40 20 0 APFT APFT OCT4 KD CISLR CISLR OCT4 KD PAC LR PACLR OCT4 KD
p /s /c m ²/s r T u m o r V o lu m e (c m 3 ) In vivo imaging of PAC ER SP/NSP cells for tumor formation 1 0 1 2 S P 1 0 1 0 N S P 3.0 2.5 1 0 8 2.0 1 0 6 1.5 1.0 1 0 4 0.5 D a y 0 D a y 1 5 D a y 2 5 D a y 4 0 0.0 D A y 1 5 D a y 2 5 D a y 4 0
In vivo imaging of PAC LR SP/NSP cells for tumor formation p/s/cm²/sr p/s/cm²/sr 1.00E+05 SP Tumor Xenograft 1.00E+08 NSP Tumor Xenograft 1.00E+07 1.00E+04 1.00E+03 Day 0 Day 25 Day 40 Day 60 Day 80 Mouse1 Mouse2 Mouse3 1.00E+06 1.00E+05 1.00E+04 Day 0 Day 25 Day 40 Day 60 Day 80 Mouse 1 Mouse 2 Mouse 3
p /s /c m ²/s r T u m o r V o lu m e (c m 3 ) In vivo imaging of CIS LR SP/NSP cells for tumor formation 1 0 1 4 S P N S P 1 0 1 2 1 0 1 0 1 0 8 1 0 6 1 0 4 3.0 SP 2.5 2.0 1.5 1.0 0.5 1 0 2 D a y 0 D a y 2 0 D a y 3 0 D a y 5 0 D a y 8 0 D a y 9 0 D a y 1 0 0 D a y 1 1 0 0.0 D a y 8 0 D a y 9 0 D a y 1 0 0 D a y 1 1 0
IGF Signaling in ovarian follicular development IGF-1 -/- : Small Ovaries IGF1-R -/- : Infertile Joanne s. Richards et al., Recent Prog Horm Res. 2002 The insulin-like growth factor (IGF) family is an essential growth factor system in the development of tissues or organs and postnatal growth, and maintenance of normal function of many cell types of the body (Li and Geng, 2010). IGF may sustain the stem cell's capacity of self-renewal and differentiation, promote their survival and migration, and prevent senescence acting downstream to PI3K pathway (Li and Geng, 2010). Is IGF-1R crucial for initiation and maintenance of resistance and stemness phenotype in ovarian cancer?
Elevated expression of IGF-1R at early stages of drug resistance A B C D Singh et. al., Cancer Letters, 2014
Inhibition of IGF-1R signaling with PPP C PPP is a small molecule that selectively inhibits IGF-1R kinase activity without showing any effect against Insulin receptor and other RTKs. Singh et. al., Cancer Letters, 2014
Potentiation of cytotoxicity using picropodophylin (PPP) Cisplatin Model Paclitaxel Model Combination Model Singh et. al., Cancer Letters, 2014
Effect of IGF-1R inhibition on long term survival of cells through clonogenic assay A B Singh et. al., Cancer Letters, 2014
N u m b e r o f s p h e r o id s Correlation between IGF-1R signaling and stemness phenotype 1 1 0 1 0 0 9 0 8 0 7 0 6 0 5 0 4 0 3 0 2 0 * * * = P < 0.0 0 1 * * = P < 0.0 1 * * * * * * * * * * * * * * * * * * * Fold change (2 - ct ) 1.5 1.0 0.5 PAC-ER PAC-ER PPP *** *** *** Fold change (2 - ct ) 1.5 1.0 0.5 PAC-LR PAC-LR + PPP ** *** * 1 0 0 A 2 7 8 0 P P P C IS E R P P P C IS L R P P P P A C E R P P P P A C L R P P P C O M B I-E R P P P C O M B I-L R P P P 0.0 OCT4 SOX2 NANOG 0.0 OCT4 SOX2 NANOG How do late resistant cells maintain their resistant and stemness phenotype?
Effect of AKT inhibition on stemness property
Regulation of stemness and chemoresistance at early and late resistant stage Early resistant stage IGF-1R Active IGF-1R signalling Late resistant stage IGF-1R Suppressed IGF-1R signalling AKT AKT Oct4 mrna Stemness/Chemoresistance Stemness/Chemoresistance
Acknowledgement ACTREC and UGC for Funding UGC Fellowship 25