A Patient Counseling Guide for Reproductive Educational content provided by
Table of contents 3 12 37 44 51 54 57 This Counseling Guide is intended to offer health care providers basic information on genetic counseling and is for general educational purposes only. The guide is not intended to be used to substitute for the exercise of the health care provider s professional judgment in providing professional services. 2
3
Cells, chromosomes, and DNA Human Nucleus DNA Base pairs A T G C Cell US National Library of Medicine. Help Me Understand : Cells and DNA. https://ghr.nlm.nih.gov/primer/basics.pdf. Published May 30, 2016. Accessed June 6, 2016. 4
Cells, chromosomes, and DNA The human body is made up of trillions of cells. Inside the nucleus of cells, are structures called chromosomes. s are made up of genes. Genes are individual instructions that tell the body how to develop and function. The four bases of DNA (A,T,G,C) are the building blocks of genes. The order of these bases determines how genes instruct our bodies. Human Nucleus DNA Base pairs A T G C US National Library of Medicine. Help Me Understand : Cells and DNA. https://ghr.nlm.nih.gov/primer/basics.pdf. Published May 30, 2016. Accessed June 6, 2016. Cell 5 5
Human chromosomes From Mother From Father 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 or 19 20 21 Autosomes 22 X X X Y Female Male 23 Sex s Image adapted from Gardner RJM, Sutherland GR, Schaffer LG. Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; 2012. 6
Human chromosomes Humans typically have 23 pairs of chromosomes (for a total of 46 chromosomes). Half of the chromosomes come from the mother and the other half from the father. The first 22 pairs are the same whether you are male or female. These are called autosomes. The last pair of chromosomes are called sex chromosomes. Females typically have two copies of the X chromosome and males typically have one X and one Y chromosome. From Mother From Father 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 or 19 20 21 22 Gardner RJM, Sutherland GR, Schaffer LG. Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; 2012. Autosomes X X X Y Female Male 23 Sex s 7 7
Cell division in primary germ cells (meiosis) Primary germ cell s copied 1st Meiosis 2nd Meiosis Gametes (sperm/egg) 8
Cell division in primary germ cells (meiosis) The human gametes are sperm and eggs. Each gamete typically has only one set of chromosomes (23 total). At fertilization/conception, the father s sperm joins with the mother s egg to form a zygote, which becomes an embryo (with 46 chromosomes). Primary germ cell s copied 1st Meiosis 2nd Meiosis Gardner RJM, Sutherland GR, Schaffer LG. Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; 2012. Gametes (sperm/egg) 9 9
Nondisjunction an error in cell division Typical meiosis Nondisjunction Sperm Eggs Fertilization Trisomy Monosomy 10
Nondisjunction an error in cell division Aneuploidy: an incorrect number of chromosomes Trisomy: three copies of a specific chromosome Monosomy: one copy of a specific chromosome Aneuploidy can lead to: Failure of an embryo to implant in the uterus Pregnancy loss/miscarriage Birth of a baby with a chromosome condition (eg., trisomy 21, which is also known as Down syndrome) Typical meiosis Nondisjunction Sperm Eggs Fertilization Gardner RJM, Sutherland GR, Schaffer LG. Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; 2012. Trisomy Monosomy 11 11
12
Trisomy 21 (Down syndrome) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X X 13
Trisomy 21 (Down syndrome) Trisomy 21 is the most common chromosome condition in live births. Trisomy 21 occurs in approximately 1 in every 660 live births. Common characteristics of trisomy 21: Intellectual disability Heart problems Low or poor muscle tone Characteristic facial features 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 Jones KL, Jones MC, del Campo M. Smith s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; 2013. 19 20 21 22 X X 14 14
Trisomy 18 (Edwards syndrome) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y 15
Trisomy 18 (Edwards syndrome) Trisomy 18 occurs in approximately 1 in every 3,333 live births. Severe chromosome condition; life expectancy usually less than 1 year. Common characteristics of trisomy 18: Intrauterine growth retardation Unusual positioning of the hands and/or feet Severe al and intellectual disabilities 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 Jones KL, Jones MC, del Campo M. Smith s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; 2013. 19 20 21 22 X Y 16 16
Trisomy 13 (Patau syndrome) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X X 17
Trisomy 13 (Patau syndrome) Trisomy 13 occurs in approximately 1 in every 5,000 live births. Severe chromosome condition; life expectancy usually less than 1 year. Common characteristics of trisomy 13: Heart, brain, kidney abnormalities Incomplete fusion of the lip and/or palate (clefting) Severe al and intellectual disabilities 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 Jones KL, Jones MC, del Campo M. Smith s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; 2013. 19 20 21 22 X X 18 18
Monosomy X (Turner syndrome) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X 19
Monosomy X (Turner syndrome) Monosomy X occurs in 1-1.5% of pregnancies. However, most (~99%) of these pregnancies do not survive to term. Monosomy X occurs in approximately 1 in every 2,000 female live births Common characteristics of monosomy X: Heart defects Shorter than average height Delayed puberty Infertility 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 Hook EB, Warburton D. Hum Genet. 2014;133(4):417-424. Jones KL, Jones MC, del Campo M. Smith s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; 2013. 19 20 21 22 X 20 20
47,XXX (Triple X syndrome) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X X X 21
47,XXX (Triple X syndrome) 47,XXX occurs in approximately 1 in every 1,000 female live births. Many females with 47,XXX do not have any visible characteristics. Variable characteristics of 47,XXX: Taller than average height Learning difficulties, speech, and language delays Delayed of motor skills Behavioral and emotional difficulties 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 Jones KL, Jones MC, del Campo M. Smith s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; 2013. 19 20 21 22 X X X 22 22
47,XXY (Klinefelter syndrome) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X X Y 23
47,XXY (Klinefelter syndrome) Klinefelter syndrome occurs in approximately 1 in every 500 male live births. Many males with 47,XXY do not have any visible characteristics. Variable characteristics of Klinefelter syndrome: Speech and/or learning difficulties Tall stature Small testes Infertility 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 Jones KL, Jones MC, del Campo M. Smith s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; 2013. 19 20 21 22 X X Y 24 24
47,XYY (Jacobs syndrome) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y Y 25
47,XYY (Jacobs syndrome) 47,XYY occurs in approximately 1 in every 840 male live births. Many males with 47,XYY do not have any visible characteristics. Variable characteristics of 47,XYY: Delayed of speech and language skills Learning disabilities Autism spectrum disorder 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 Jones KL, Jones MC, del Campo M. Smith s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; 2013. 19 20 21 22 X Y Y 26 26
deletions and microdeletions Telomere Telomere Telomere p arm p arm p arm p arm Centromere Centromere Centromere Centromere q arm q arm q arm q arm Telomere Telomere Telomere Telomere Normal Deletion Normal Microdeletion 27 27
deletions and microdeletions Deletions and mircodeletions are caused by missing pieces of chromosome material. Microdeletions are smaller than deletions and cannot be seen under a microscope. deletions and microdeletions may result in intellectual disability, al disabilities, and/or birth defects. Telomere Telomere Telomere p arm p arm p arm p arm Centromere Centromere Centromere Centromere q arm q arm q arm q arm Telomere Telomere Telomere Telomere Gardner RJM, Sutherland GR, Schaffer LG. Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; 2012. Normal Deletion Normal Microdeletion 28 28
duplications and microduplications Telomere Telomere Telomere p arm p arm p arm p arm Centromere Centromere Centromere Centromere q arm q arm q arm q arm Telomere Telomere Telomere Telomere Normal Duplication Normal Microduplication 29 29
duplications and microduplications Duplications and mircoduplications are caused by extra pieces of chromosome material. Microduplications are smaller than duplications and cannot be seen under a microscope. duplications and microduplications may result in intellectual disability, al disabilities, and/or birth defects. Telomere Telomere Telomere p arm p arm p arm p arm Centromere Centromere Centromere Centromere q arm q arm q arm q arm Gardner RJM, Sutherland GR, Schaffer LG. Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; 2012. Telomere Telomere Telomere Normal Duplication Normal Microduplication Telomere 30 30
translocation: Reciprocal Balanced translocation carrier parent Non-carrier parent Possible gametes from carrier parent Gamete from non-carrier parent Fertilization Possible zygotes Non-carrier Balanced translocation carrier Partial trisomy + partial monosomy Partial trisomy + partial monosomy 31
translocation: Reciprocal A reciprocal translocation is the result of two chromosomes exchanging segments. Reciprocal translocations are present in approximately 1 in 500 individuals. Most individuals who carry a reciprocal translocation do not have any visible characteristics. Carriers of a reciprocal translocation may be at risk for: Infertility Recurrent pregnancy loss Balanced translocation carrier parent Babies with birth defects and/or intellectual disabilities Possible gametes from carrier parent Non-carrier parent Gamete from non-carrier parent Fertilization Possible zygotes Gardner RJM, Sutherland GR, Schaffer LG. Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; 2012. Non-carrier Balanced translocation carrier Partial trisomy + partial monosomy Partial trisomy + partial monosomy 32 32
translocation: Robertsonian Balanced translocation carrier parent Non-carrier parent Possible gametes from carrier parent Gamete from non-carrier parent Fertilization Possible zygotes Non-carrier Translocation carrier Trisomy Monosomy Trisomy Monosomy 33
translocation: Robertsonian A Robertsonian translocation happens when two certain chromosomes (13, 14, 15, 21, 22) join together. Robertsonian translocations are present in approximately 1 in every 1,000 individuals. Most individuals who carry a Robertsonian translocation do not have any visible characteristics. Carriers of a Robertsonian translocation may be at risk for: Infertility Recurrent pregnancy loss Babies with birth defects and/or intellectual disabilities Possible gametes from carrier parent Balanced translocation carrier parent Non-carrier parent Gamete from non-carrier parent Fertilization Possible zygotes Gardner RJM, Sutherland GR, Schaffer LG. Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; 2012. Non-carrier Translocation carrier Trisomy Monosomy Trisomy Monosomy 34 34
Mosaicism (an error in cell division causing cells with a genetic change) Fertilization Embryo Somatic cell division (mitosis) Mosaic Normal cells Cells with genetic change Adapted from: Campbell IM, Shaw CA, Stankiewicz P, Lupski JR. Somatic mosaicism: implications for disease and transmission genetics. Trends Genet. 2015;31(7):382-392. 35
Mosaicism (an error in cell division causing cells with a genetic change) Mosaicism is the presence of two or more cell lines with different genetic make-ups. It is caused by an error during cell division (mitosis). The proportion of each cell line is variable. The clinical impact of mosaicism on an individual varies depending on the number and type of cells affected. Fertilization Embryo Somatic cell division (mitosis) Mosaic Normal cells Cells with genetic change U.S. National Library of Medicine. Medical Encyclopedia: Mosaicism. https:// www.nlm.nih.gov/medlineplus/ency/article/001317.htm Updated May 3, 2016. Accessed June 3, 2016. 36 36
37
Autosomal dominant Parents mutation normal Affected Unaffected Children Affected (50%) Unaffected (50%) 38
Autosomal dominant With autosomal dominant, only one copy of a mutated gene is necessary for the condition to be present. An affected parent has the following reproductive risks per pregnancy: 50% chance to have a fetus affected with the condition 50% chance to have a fetus without the condition (unaffected) Males and females are at equal risk Parents mutation normal Affected Unaffected Children US National Library of Medicine. Help Me Understand : Inheriting Genetic Conditions. https://ghr.nlm.nih.gov/primer/.pdf. Published June 6, 2016. Accessed June 7, 2016. Affected (50%) Unaffected (50%) 39 39
Autosomal recessive Parents mutation mutation normal normal Carrier Carrier Children Affected (25%) Carrier (50%) Unaffected non-carrier (25%) 40
Autosomal recessive With autosomal recessive, two copies of a mutated gene are necessary for the condition to be present. Individuals with only one copy of a mutated gene are called carriers and are typically unaffected. If both parents are carriers of the same condition, they have the following reproductive risks per pregnancy: 25% chance to have a fetus affected with the condition 50% chance to have a fetus who is a carrier of the condition 25% chance to have a fetus without the condition and a non-carrier (unaffected noncarrier) Males and females are at equal risk Parents Children mutation normal Carrier mutation normal Carrier US National Library of Medicine. Help Me Understand : Inheriting Genetic Conditions. https://ghr.nlm.nih.gov/primer/.pdf. Published June 6, 2016. Accessed June 7, 2016. Affected (25%) Carrier (50%) Unaffected non-carrier (25%) 41 41
X-linked recessive Parents mutation normal X Y X X Unaffected Carrier Children X Y X X X X X Y Unaffected (25%) Unaffected non-carrier (25%) Carrier (25%) Affected (25%) 42
X-linked recessive X-linked involves a mutated gene that occurs on the X chromosome. Males who have a mutated gene on their X chromosome are affected with the condition. Females who have a mutated gene on one of their two X chromosomes are called carriers of the condition. Female carriers are typically unaffected; however, some female carriers may display characteristics of the condition. Females who carry an X-linked recessive condition have the following reproductive risks per pregnancy: 25% chance of having a son who is not affected with the condition 25% chance of having a daughter Parents who is not a carrier of the condition 25% chance of having a daughter who is a carrier of the condition 25% chance of having a son who Unaffected Carrier Children is affected with the condition mutation normal X Y X X US National Library of Medicine. Your guide to understanding genetic : What are the different ways in which a genetic condition can be inherited? https://ghr.nlm.nih.gov/primer//patterns. Published May 31, 2016. Accessed June 3, 2016. X Y X X X X X Y Unaffected (25%) Unaffected non-carrier (25%) Carrier (25%) Affected (25%) 43 43
44
In vitro fertilization (IVF) Uterus Ovary 1 Ovarian stimulation and egg retrieval 3 Embryo transfer 2 Fertilization 45
In vitro fertilization (IVF) There are 3 main steps in an IVF cycle: 1. Ovarian stimulation and egg retrieval 2. Fertilization sperm and egg are combined in the laboratory to form an embryo 3. Embryo transfer into the uterus or frozen for future use Uterus Ovary 1 Ovarian stimulation and egg retrieval 3 Embryo transfer 2 Fertilization 46 46
Percentage of embryos with a chromosome abnormality (aneuploidy) increases with maternal age 90 % of Embryos With Aneuploidy 80 70 60 50 40 30 20 10 0 <35 35-37 38-40 41-42 >42 Maternal Age Harton GL, et al. Fertil Steril. 2013;100(6):1695-1703. 47
Percentage of embryos with a chromosome abnormality (aneuploidy) increases with maternal age Aneuploid embryos can occur in women of all ages, but the risk increases with maternal age. Risks associated with an aneuploid embryo: Implantation failure Miscarriage Babies born with birth defects/intellectual disabilities 90 % of Embryos With Aneuploidy 80 70 60 50 40 30 20 10 Harton GL, et al. Fertil Steril. 2013;100(6):1695-1703. Scott RT Jr., et al. Fertil Steril. 2012;97(4):870-875. 0 <35 35-37 38-40 41-42 >42 Maternal Age Harton GL, et al. Fertil Steril. 2013;100(6):1695-1703. 48 48
Stages of embryo 2-cell stage 8-cell stage (cleavage stage) Blastocyst (100+ cells) Inner cell mass Outer layer (Trophectoderm) Fertilization Day 2 Day 3 Day 5 49
Stages of embryo Following egg retrieval, fertilization occurs in the laboratory. Cell division occurs in the days following fertilization. By day 5, a blastocyst has formed with an outer layer and an inner cell mass. 2-cell stage 8-cell stage (cleavage stage) Blastocyst (100+ cells) Inner cell mass Outer layer (Trophectoderm) Fertilization Day 2 Day 3 Day 5 Harton GL, et al. Fertil Steril. 2013;100(6):1695-1703. 50 50
51
Embryo unlikely to have aneuploidy Embryo likely to have aneuploidy 1 2 3 Embryo Biopsy Screening Embryo Transfer 52
PGS process: 1. Embryo Biopsy: One or more cells from each embryo is removed for screening 2. Screening: Biopsied cells are screened for aneuploidy (too many or too few chromosomes) 3. Embryo Transfer: Embryos that are unlikely to have aneuploidy are available for transfer into the uterus or can be frozen for future use Potential benefits: Increased implantation, pregnancy, and live birth rates Decreased miscarriage rates Selection of most viable embryo for single embryo transfer Limitations: PGS only screens for aneuploidy PGS does not screen for other PGS is not 100% accurate Forman EJ, et al. Fertil Steril. 2013;100(1):100-107. Scott RT Jr, et al. Fertil Steril. 2013;100(3):697-703. Harton GL, et al. Fertil Steril. 2013;100(6):1695-1703. Dahdouh EM, et al. J Obstet Gynaecol Can. 2015;37(5):451-63. Embryo unlikely to have aneuploidy Embryo likely to have aneuploidy 1 2 3 Embryo Biopsy Screening Embryo Transfer 53 53
54
Embryo likely to be unaffected Embryo likely to be affected 1 2 3 Embryo Biopsy Genetic Testing Embryo Transfer 55
PGD process: 1. Embryo Biopsy: One or more cells from each embryo is removed for testing 2. Genetic Testing: Biopsied cells are tested for the inherited condition of interest 3. Embryo Transfer: Embryos that are likely to be unaffected with the condition are available for transfer to the uterus or can be frozen for future use Benefits: Reduced risk of having a baby with an inherited condition Limitations: PGD does not test for all possible PGD is not 100% accurate Embryo likely to be unaffected Embryo likely to be affected Practice Committee of Society for Assisted Reproductive Technology; Practice Committee of American Society for Reproductive Medicine. Fertil Steril. 2008;90(5 Suppl):S136-143. Dahdouh EM, et al. J Obstet Gynaecol Can. 2015;37(5):451-463. 1 2 3 Embryo Biopsy Genetic Testing Embryo Transfer 56 56
and diagnostic 57
* Patient counseled and elects prenatal testing NO YES Serum screening cfdna screening Diagnostic 10 0/7 weeks - 22 6/7 weeks of pregnancy 10 weeks of pregnancy until delivery CVS/Amniocentesis CVS: 10-13 weeks of pregnancy Amniocentesis: typically 15-20 weeks of pregnancy YES Is the result positive for a chromosome condition? Is the result positive for a chromosome condition? YES Offer further counseling testing NO NO Patient and provider to discuss next steps Patient and provider to discuss next steps Patient and provider to discuss next steps ACOG Practice Bulletins Prenatal Diagnostic Testing for Genetic Disorders. Obstet Gynecol. 2016;127:e108 e122. ACOG Practice Bulletins Screening for Fetal Aneuploidy. Obstet Gynecol. 2016;127:e123 e137. *Typical in USA but may differ by country. 58
* Prenatal aneuploidy screening assesses a woman s risk of carrying a fetus with certain chromosome. If a screening result is positive, further counseling and diagnostic testing should be offered Diagnostic testing can provide definitive information about: Certain genetic Patient counseled and elects prenatal testing NO YES Serum screening cfdna screening Diagnostic 10 0/7 weeks - 22 6/7 weeks of pregnancy 10 weeks of pregnancy until delivery CVS/Amniocentesis CVS: 10-13 weeks of pregnancy Amniocentesis: typically 15-20 weeks of pregnancy YES Is the result positive for a chromosome condition? Is the result positive for a chromosome condition? YES Offer further counseling testing ACOG Practice Bulletins Prenatal Diagnostic Testing for Genetic Disorders. Obstet Gynecol. 2016;127:e108 e122. ACOG Practice Bulletins Screening for Fetal Aneuploidy. Obstet Gynecol. 2016;127:e123 e137. *Typical in USA but may differ by country. NO Patient and provider to discuss next steps NO Patient and provider to discuss next steps Patient and provider to discuss next steps 59 59
Cell-free DNA (cfdna) screening Unaffected pregnancy Affected pregnancy CCCTTAGCGCTTTAACGTACGTAAAACCCTT AACGTACGTAAAAACGGGGTCAAAGGTTCCC GACTTAAAATCGGAATCGATGCCCAAACTT AATCGATGCCCAAACGGGGTCAAAGTTCCC Maternal cfdna Fetal cfdna 1 2 3 Maternal blood draw and isolation of cfdna Sequencing of cfdna Analysis via counting 60
Cell-free DNA (cfdna) screening cfdna screening process: 1. Blood is drawn from pregnant woman s arm at 10 weeks of gestation or greater. cfdna is isolated from the maternal blood in the laboratory. 2. cfdna is sequenced to determine chromosome of origin 3. Sequenced cfdna is counted to screen for chromosome Benefits: High detection rates for tested Very low false positive rates Fewer patients will need to have follow-up diagnostic testing compared with serum screening Limitations: Not diagnostic (false positives and false negatives can occur) In some instances, results may represent a maternal, rather than fetal, condition Maternal cfdna Fetal cfdna CCCTTAGCGCTTTAACGTACGTAAAACCCTT AACGTACGTAAAAACGGGGTCAAAGGTTCCC GACTTAAAATCGGAATCGATGCCCAAACTT AATCGATGCCCAAACGGGGTCAAAGTTCCC Unaffected pregnancy Affected pregnancy Gil MM, et al. Ultrasound Obstet Gynecol. 2015;45(3):249-266. ACOG Practice Bulletins Screening for Fetal Aneuploidy. Obstet Gynecol. 2016;127:e123 e137. 1 2 3 Maternal blood draw and isolation of cfdna Sequencing of cfdna Analysis via counting 61 61
Classification of cfdna screening results Negative cfdna results Positive cfdna results True negatives True positives False positives and false negatives 62
Classification of cfdna screening results True positive: a positive result, and the fetus has the condition False positive: a positive result, but the fetus does not have the condition True negative: a negative result, and the fetus does not have the condition False negative: a negative result, but the fetus has the condition Negative cfdna results Positive cfdna results True negatives True positives False positives and false negatives 63 63
cfdna: Negative results Negative cfdna results Fetuses who have the condition (false negatives) 64
cfdna: Negative results The chance that the fetus does not have the condition is greater than 99%. False negatives do occur rarely The results apply only to the tested. No additional screening tests for aneuploidy should be offered as this will increase the potential for a false positive result. Negative cfdna results ACOG Practice Bulletins Screening for Fetal Aneuploidy. Obstet Gynecol. 2016;127:e123 e137. Gil MM, et al. Ultrasound Obstet Gynecol. 2015;45(3):249-266. Fetuses who have the condition (false negatives) 65 65
cfdna: Positive results No additional risk factors present Additional risk factor(s) present All positive cfdna results Fetuses who have the condition 66
cfdna: Positive results A positive result means the fetus has an increased chance of having a chromosome condition. The overall chance for the condition depends on a combination of the cfdna result and any additional risk factors, including: Maternal age Ultrasound results Serum screening results Family history of chromosome condition Further counseling and diagnostic testing should be offered. No additional risk factors present All positive cfdna results Additional risk factor(s) present Fetuses who have the condition ACOG Practice Bulletins Screening for Fetal Aneuploidy. Obstet Gynecol. 2016;127:e123 e137. 67 67
Diagnostic testing: chorionic villus sampling (CVS) Placenta Ultrasound probe Placenta Ultrasound probe Chorionic villi Chorionic villi Transcervical CVS Transabdominal CVS 68
Diagnostic testing: chorionic villus sampling (CVS) Can determine, with as much certainty as is possible, whether a chromosome condition is present. Additional genetic testing can be performed if indicated Involves testing of cells collected from the placenta. Typically performed between 10 weeks and 13 weeks of pregnancy Has a risk of miscarriage. Placenta Ultrasound probe Placenta Ultrasound probe Chorionic villi Chorionic villi Transcervical CVS Transabdominal CVS ACOG Practice Bulletins Prenatal Diagnostic Testing for Genetic Disorders. Obstet Gynecol. 2016;127:e108 e122. 69 69
Diagnostic testing: Amniocentesis Ultrasound probe Amniotic fluid Uterine wall 70
Diagnostic testing: Amniocentesis Can determine, with as much certainty as is possible, whether a chromosome condition is present. Additional genetic testing can be performed if indicated Involves testing of fetal cells collected from fluid surrounding the fetus (amniotic fluid). Typically performed between 15 weeks and 20 weeks of pregnancy Has a risk of miscarriage. Ultrasound probe Amniotic fluid Uterine wall ACOG Practice Bulletins Prenatal Diagnostic Testing for Genetic Disorders. Obstet Gynecol. 2016;127:e108 e122. 71 71
Types of fetal chromosomal mosaicism Normal cells Chromosomally abnormal cells Generalized mosaicism Confined placental mosaicism Fetal mosaicism Kalousek DK. Pediatr Pathol. 1990;10(1-2):69-77. Kalousek DK. Pediatr Pathol. 1990;10(1-2):69-77. 72
Types of fetal chromosomal mosaicism Generalized mosaicism: presence of two or more chromosomally different cell lines in both the placenta and the fetus. Can lead to a false positive or a false negative cfdna result Confined placental mosaicism: presence of two or more chromosomally different cell lines in the placenta, but not the fetus. Can lead to a false positive cfdna result Fetal mosaicism: presence of two or more chromosomally different cell lines that are present in the fetus, but not the placenta. Can lead to a false negative cfdna result Normal cells Chromosomally abnormal cells Generalized mosaicism Confined placental mosaicism Fetal mosaicism Grati FR. J Clin Med. 2014;3(3):809-837. Van Opstal D, et al. PLoS One. 2016;11(1):e0146794. Kalousek DK. Pediatr Pathol. 1990;10(1-2):69-77. 73 73
This Counseling Guide is intended to offer health care providers basic information on genetic counseling and is for general educational purposes only. The guide is not intended to be used to substitute for the exercise of the health care provider s professional judgment in providing professional services. 2016 Illumina, Inc. All rights reserved.