Blend Taq / Blend Taq -Plus-

Similar documents
SYBR Green Realtime PCR Master Mix -Plus-

PrimeSTAR HS DNA Polymerase

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.

PicoMaxx High Fidelity PCR System

Herculase Hotstart DNA Polymerase

BacReady TM Multiplex PCR System

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)

Taq98 Hot Start 2X Master Mix

Terra PCR Direct Polymerase Mix User Manual

CompleteⅡ 1st strand cdna Synthesis Kit

MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C

ab Hi-Fi cdna Synthesis Kit

PrimeScript High Fidelity RT-PCR Kit

Table of Contents. I. Description II. Kit Components III. Storage IV. 1st Strand cdna Synthesis Reaction... 3

GenScript BloodReady TM Multiplex PCR System

RevertAid Premium First Strand cdna Synthesis Kit

RT rxns. RT rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl

PCR Instruments and Consumables

RT-PCR: Two-Step Protocol

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

HiPer RT-PCR Teaching Kit

First Strand cdna Synthesis

Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr

Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Real-time quantitative RT -PCR (Taqman)

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube

RIBOPROTECT. RNase Inhibitor RT33-020, RT33-100

TaqMan Fast Advanced Master Mix. Protocol

Path-ID Multiplex One-Step RT-PCR Kit

Troubleshooting for PCR and multiplex PCR

mircute mirna qpcr Detection Kit (SYBR Green)

360 Master Mix. , and a supplementary 360 GC Enhancer.

1/12 Dideoxy DNA Sequencing

Global MicroRNA Amplification Kit

Reverse Transcription System

Technical Manual No Update Date

All-in-One First-Strand cdna Synthesis Kit

Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit

Highly specific and sensitive quantitation

DyNAmo cdna Synthesis Kit for qrt-pcr

Mir-X mirna First-Strand Synthesis Kit User Manual

AffinityScript QPCR cdna Synthesis Kit

Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541

PfuTurbo DNA Polymerase

Fast PCR: General Considerations for Minimizing Run Times and Maximizing Throughput

Essentials of Real Time PCR. About Sequence Detection Chemistries

Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.

Application Guide... 2

POLYMERASES & AMPLIFICATION. OneTaq RT-PCR Kit. Instruction Manual. NEB #E5310S 30 reactions

PCR Reagents. The Highest Level of PCR Performance. PCR Enzymes RT-PCR Reagents QPCR and QRT-PCR Reagents dntps

Real-Time Quantitative PCR Instruments and Consumables

biotechrabbit Product Catalog

High-Capacity cdna Reverse Transcription Kits For 200 and 1000 Reactions

MagExtractor -Genome-

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011

ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas

All-in-One mirna qrt-pcr Detection System Handbook

QIAGEN OneStep RT-PCR Handbook

Cloning GFP into Mammalian cells

PCR & DNA Sequencing. PCR= Polymerase Chain Reaction. PCR applications

DNA Core Facility: DNA Sequencing Guide

Řekněte si o vzorky zdarma!

amplification tech Optical Design of CFX96 Real-Time PCR Detection System Eliminates the Requirement of a Passive Reference Dye

FastLine cell cdna Kit

Real-Time PCR Vs. Traditional PCR

Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR

Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit

qstar mirna qpcr Detection System

Taq PCR Handbook. Sample & Assay Technologies. Taq DNA Polymerase Taq PCR Core Kit Taq PCR Master Mix Kit

SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit

QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.

Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid

Hepatitis B Virus Genemer Mix

MMLV High Performance Reverse Transcriptase

Profiling of microrna in Blood Serum/Plasma. Guidelines for the mircury LNA TM Universal RT microrna PCR System

Absolute Quantification Getting Started Guide

PfuTurbo C x Hotstart DNA Polymerase

SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products

Megaplex Pools For microrna Expression Analysis

Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280.

Updated: July ' End label RNA markers (18mer) and (24mer) with Kinase and 32P-gamma-ATP. Gel purify labeled markers.

Speed Matters - Fast ways from template to result

TIANquick Mini Purification Kit

Stratagene QPCR Mouse Reference Total RNA

PCR* Kits For DNA Ladder Assay (Cat. #: APO-DNA1)

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website

Dengue Virus subtypes 1,2 3 and 4. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... 3 Untranslated Region (3 UTR) 150 tests

restriction enzymes 350 Home R. Ward: Spring 2001

IMBB Genomic DNA purifica8on

5PCR, real-time PCR, reverse transcription, and cloning

PNA BRAF Mutation Detection Kit

STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR)

Validating Microarray Data Using RT 2 Real-Time PCR Products

Transcription:

Instruction manual Blend Taq and Blend Taq -Plus- 0810 F0938K Blend Taq / Blend Taq -Plus- <Blend Taq > BTQ-101 250 U 200 reactions <Blend Taq -Plus-> BTQ-201 250 U 200 reactions Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products [6] Protocol 1. Standard reaction setup 2. Cycling conditions [7] Examples [8] Troubleshooting [9] Related products [10] References Store at -20 C CAUSION All reagents in this kit are intended for research purposes. Do not use for diagnosis or clinical purposes. Please observe general laboratory precaution and utilize safety while using this kit. - Blend Taq is a registered trademark of Toyobo Co., Ltd. in Japan. 1

[ 1 ] Introduction Description Blend Taq and Blend Taq -Plus- are highly efficient Taq-based s developed based on the Barns method. 1) This method uses a which lacked exonuclease (proofreading) activity (e.g., Taq ) and a small amount of an archaeal with proofreading activity. Because the proofreading activity repairs misincorporated nucleotide bases causing the termination of the polymerase reaction, PCR with a mixed enzyme solution enables highly efficient amplification. The enzyme solution of Blend Taq -Plus- contains anti-taq antibodies that inhibit polymerase activity, allowing for Hot Start PCR. Blend Taq and Blend Taq -Plus- generate da overhang-ended PCR products. Therefore, the PCR products can be cloned using a standard TA-cloning method. Features -This enzyme is effective for the amplification of various targets from small template amounts. The elongation ability of this enzyme is much greater than that of the normal Taq. -Hot Start technology using anti-taq antibodies results in highly efficient amplification. <Blend Taq (Code No. BTQ-101) does not use hot start> -The PCR error ratio of this enzyme is approximately 3-4 times less than that of Taq. (lacking proofreading activity) missincorporation pausing (lacking proofreading activity) repairing (having proofreading activity) (lacking proofreading activity) Fig. 1. The principles of the Barns technology. [ 2 ] Components <Blend Taq > <Blend Taq -Plus-> The provided reagents include the following components for 200 reactions: Blend Taq (2.5 U/μl) 100 μl 10x PCR Buffer for Blend Taq 1.0 ml 2 mm dntps 1.0 ml Blend Taq -Plus- (2.5 U/μl)* 100 μl 10x PCR Buffer for Blend Taq 1.0 ml 2 mm dntps 1.0 ml *This enzyme solution contains anti-taq antibodies. 1

[ 3 ] Quality Testing Quality check was performed by amplifying the human β-globin gene (17.5 kb). [ 4 ] Primer Design [ 5 ] Cloning of PCR products PCR primers should be designed according to general guidelines. For the amplification of a long target ( 6 kb), the melting temperature (Tm) of the primers should be set over 70 C. The PCR products of Blend Taq and Blend Taq -Plus- can be cloned according to a standard TA-cloning method. [ 6 ] Protocol 1. Standard reaction setup The following procedures are designed to be used with the components provided in this kit. Before preparing the reaction mixture, all components should be completely thawed, except for the enzyme solution. Notes: Component Volume Final Concentration 10x Buffer 5 μl 1 x 2 mm dntps* 5 μl 0.2 mm each 10 pmol/μl Primer #1 1 μl 0.2 μm 10 pmol/μl Primer #2 1 μl 0.2 μm Genomic DNA 10-1000 ng/50 μl Template DNA X μl Plasmid DNA 1-50 ng/50 μl cdna 200 ng (RNA equiv.)/50 μl E. coli cells (small amount) PCR grade water Y μl Blend Taq (2.5 U/μl) or 0.5 μl 1.25 U / 50 μl Blend Taq -Plus (2.5 U/μl) Total reaction volume 50 μl * Do not use dntps from other kits or companies. -Thin-wall tubes are recommended for PCR use. A total reaction volume of 50 μl is recommended. -For amplification of a long target ( 10 kb), the final concentration of dntps should be 0.3-0.4 mm. 2

2. Cycling conditions The following cycling steps are recommended. (1) Cycling conditions for < 6kb targets. < 3-step cycle > Pre-denaturation 94 C, 2 min Denaturation 94 C, 30 sec. Annealing Tm-[5-10] o C*, 30 sec. Extension 72 C, 1 min/kb *Tm value of the primer minus 5 C-10 C 25-35 cycles (2) Cycling conditions for 6kb products. < 2-step cycle > Pre-denaturation Denaturation Extension 94 C, 2 min 94 C, 30 sec. 68 C, 1 min/kb 25-35 cycles Note: If the Tm value of the primer is under 73 C, the 3-step cycle is recommended. Notes: -Extension time should be set at 1min per 1 kb of target length. -For colony-direct PCR, the pre-denaturation step should be set for 4 min. [ 7 ] Examples Example 1.Comparison of the sensitivity of PCR with a Taq-based PCR enzyme. Blend Taq -Plus- Taq-based PCR enzyme (company A) 1 2 3 4 5 1 2 3 4 5 Template: Human Genomic DNA Target: β-globin 3.6 kb Lane 1: 0 ng human genomic DNA Lane 2: 5 ng human genomic DNA Lane 3: 10 ng human genomic DNA Lane 4: 20 ng human genomic DNA Lane 5: 40 ng human genomic DNA 3

Example 2.Colony-direct PCR using E. coli cells. 4.5 kb M 1 2 3 4 Template: Small amount of E. coli cells (JM109) from colonies Insert: Transferrin receptor 4.5 kb Vector: pbluescript II PCR cycling condition: Lane 1: Insert (+) Lane 2: Insert (+) Lane 3: Insert (-) Lane 4: Insert (+) 94 4 min. 98 30 sec. 55 30 sec. 30 cycles 72 4.5 min. F primer: TCGAGGTCGACGGTATCGAT (20mer GC=55%) R primer: CGCTCTAGAACTAGTGGATC (20mer GC=50%) *The primers are designed on the vector. [ 8 ] Troubleshooting Symptoms Cause Solution Cycling conditions are not optimal Lower annealing temperature increments to a maximum of Tm-5 C. Increase the number of cycles by 2-5 cycles. No PCR product / low yield Primers are not good Check the design and/or quality of primers. Smearing / extra band(s) Too much E. coli cells (Colony direct PCR) Cycling conditions are not optimal Decrease the amount of E. coli cells from colonies. Decrease the number of cycles by 2-5 cycles. [ 9 ] Related products [ 10 ] References Product name Package Code No. Highly efficient cdna synthesis kit 100 rxns FSK-101 ReverTra Ace -α- Highly efficient reverse transcriptase 10,000 U TRT-101 ReverTra Ace RNase inhibitor (Recombinant type) 2,500 U SIN-201 High Speed PCR enzyme 200 U x1 LDP-101 KOD Dash High fidelity PCR enzyme 200 U x1 KOD-201 KOD -Plus- Highly reliable PCR enzyme KOD FX 200 U x1 KFX-101 1) Barns WM, Proc. Natl. Acad. Sci. USA, 91: 2216-2220 (1994) 4

NOTICE TO PURCHASER: LIMITED LICENSE Use of this product is covered by one or more of the following US patents and corresponding patent claims outside the US: 5,079,352, 5,789,224, 5,618,711, 6,127,155 and claims outside the US corresponding to US Patent No. 4,889,818. The purchase of this product includes a limited, non-transferable immunity from suit under the foregoing patent claims for using only this amount of product for the purchaser s own internal research. No right under any other patent claim (such as the patented Nuclease Process claims in US Patents Nos. 5,210,015 and 5,487,972), no right to perform any patented method, and no right to perform commercial services of any kind, including without limitation reporting the results of purchaser's activities for a fee or other commercial consideration, is conveyed expressly, by implication, or by estoppel. This product is for research use only. Diagnostic uses under Roche patents require a separate license from Roche. Further information on purchasing licenses may be obtained by contacting the Director of Licensing, Applied Biosystems, 850 Lincoln Centre Drive, Foster City, California 94404, USA. 5