LifeSpan Rudi Westendorp - LUMC Bas Zwaan Institute of Biology, Leiden
improved survival Oeppen&Vaupel, Science 2002
environmental factors 1 survival 0.8 0.6 0.4 0.2 0 0 10 20 30 40 50 60 70 80 90 100 age (years) 1861 1901 1921 1951 2001
selective survival 1 survival 0.8 0.6 0.4 0.2 0 0 10 20 30 40 50 60 70 80 90 100 age (years) 1861 1901 1921 1951 2001
nowadays environment Finch & Grimmins. Science 2004; 305:1736
early environment Finch & Grimmins. Science 2004; 305:1736
call text SIXTH FRAMEWORK PROGRAMME PRIORITY [LSH-2005-2.1.4] [Studying human development and the ageing process] Call text LSH-2005-2.1.4-1: Integration of research in development and ageing - NETWORK OF EXCELLENCE. The aim of the project is to determine the influence of genetic, environmental, and stochastic effects during development on the ageing process. The project should integrate the corresponding research in invertebrate and vertebrate model systems and their application in humans
models humans LifeSpan research field development ageing LifeSpan organisms humans models development ageing
world leaders No. Participant organisation name short name Scientific team leaders 1 Leiden University Medical LUMC R. Westendorp Center, Dept. of Gerontology & E. Slagboom Geriatrics (coordinator) J. Ton 2 Institute of Biology Leiden, section of Evolutionary Biology 3 Austrian Academy of Sciences, Institute for Biomedical Ageing Research 4 University of Tartu, Institute of Molecular and Cell Biology 5 1) Erasmus University Rotterdam, Dept. of Genetics and Cell Biology 6 INSERM U515, Hopital Saint- Antoine 7 University of Lausanne, Department of Ecology and Evolution 8 Eberhard-Karls-Universität Tübingen, Tübingen Ageing and Tumour Immunology Group 9 Albert-Ludwigs University of Freiburg, Bio 3, Bioinformatics and Molecular Genetics 10 University of Newcastle, Institute for Ageing and Health 11 University of Southern Denmark, Institute of Epidemiology and Public Health 12 Karolinska Institutet, Department of Medical Epidemiology and Biostatistics 13 Norwegian University of Life Sciences, Department of Animal and Aquacultural Sciences 14 University College London, Dept. of Biology IBL OEAW B. Zwaan P. Brakefield E. de Pauw B.Grubeck- Loebenstein Town Leiden Leiden Innsbruck Country Netherlands Netherlands Austria IMCB A. Metspalu Tartu Estonia EUR J. Hoeijmakers Rotterdam Netherlands INSERM M. Holzenberger Paris France U515 DEE L. Keller Lausanne Switzerland UT G. Pawelec Tübingen Germany ALU.FR M. Hertweck R. Baumeister Freiburg Germany UNEW T. Kirkwood Newcastle UK upon Tyne SDU K. Christensen Odense Denmark KI S. Cnattingius Stockholm Sweden UMB UCL R. Aamodt S. Omholt D. Gems L. Partridge Aas London Norway 15 1) DNage DNage J. Hoeijmakers Rotterdam Netherlands 16 Leiden/Amsterdam Center for LACDR R. de Rijk Leiden Netherlands Drug Research, Dept. of Medical Pharmacology R. de Kloet 17 OSAÜHING BioData BioData M. Remm Tartu Estonia 18 PANATecs GmbH PANATECS T. Flad Tübingen Germany UK
instruments Caenorhabditis elegans Drosophila melanogaster Apis mellifera Solenopsis invicta Bicyclus anynana Homo sapiens Mus musculus Classical models - genetics, general tools, knowledge base Social insects - huge variation in life span, sociality, gene modulation Phenotypic plasticity - Seasonal forms, natural selection, selection lines Old-age cohorts & Twins - Genetic association, gene search, biological parameters -epigenetics
life history regulation Gluckman & Hanson. Science 2004; 305:1733
early adverse Barker hypothesis 1985-1995 Dutch hunger winter 44-45 Metabolic Syndrome; premature death
modern affluent males females log log mortality(q) Zwaan et al. Unpublished
life history regulation Gluckman & Hanson. Science 2004; 305:1733
environmental chance Traditional focus Future focus conception birth reproduction longevity Environment Adaptation
imprinting Epigenetics, genetic variation, GxE Physiology, hormones Life-long immunity, disease cttattatacccacagacgaag aagaattgatgacgtactataa tccaagagccatggaagaag aaacttaagaaccgttcatct Genotype Phenotype Early life Late life
twin studies Genes Immunity 2005;6:167-170
life history regulation Gluckman & Hanson. Science 2004; 305:1733
experiment and observation Bicyclus anynana Drosophila melanogaster Homo sapiens study natural variation and experimental manipulation provide candidate genes test candidate genes Model organisms cover the full range from genotype to phenotype
private and public Private survival Public reproduction
gene mapping LINKAGE mapping: uses a single generation of lab recombination to map differences between parental lines ASSOCIATION mapping: relies on many generations of recombination to map variation in large populations
different environments
LifeSpan General public Health-care professional Networks Scientists & Industry