REFERENCE PROTOCOL NAKTUINBOUW



Similar documents
REFERENCE PROTOCOL NAKTUINBOUW

RealLine HCV PCR Qualitative - Uni-Format

Real-time quantitative RT -PCR (Taqman)

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube

ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas

Mir-X mirna First-Strand Synthesis Kit User Manual

mircute mirna qpcr Detection Kit (SYBR Green)

CompleteⅡ 1st strand cdna Synthesis Kit

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna

STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY REAL-TIME POLYMERASE CHAI REACTIO (PCR)

Genomic DNA Extraction Kit INSTRUCTION MANUAL

RealStar HBV PCR Kit /2012

TaqMan Fast Advanced Master Mix. Protocol

HBV Quantitative Real Time PCR Kit

FastLine cell cdna Kit

Genomic DNA detection assay

RevertAid Premium First Strand cdna Synthesis Kit

ab Hi-Fi cdna Synthesis Kit

All-in-One First-Strand cdna Synthesis Kit

Detection of PepMV and ringtest results

Essentials of Real Time PCR. About Sequence Detection Chemistries

Application Guide... 2

Quantitative Real Time PCR Protocol. Stack Lab

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

RT rxns. RT rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl

EXPERIMENT 6 RNA ISOLATION AND RT-PCR ANALYSIS (GENE TWO)

MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C

FOR REFERENCE PURPOSES

Procedure for RNA isolation from human muscle or fat

Reconstituting and Diluting Primers and TaqMan Probes

Human Herpes Virus 4 (Epstein Barr)

Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene. genesig Advanced Kit. DNA testing

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR

ncounter Gene Expression Assay Manual Total RNA and Cell Lysate Protocols

RNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr)

Taqman TCID50 for AAV Vector Infectious Titer Determination

Path-ID Multiplex One-Step RT-PCR Kit

Dengue Virus subtypes 1,2 3 and 4. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... 3 Untranslated Region (3 UTR) 150 tests

Quantification of Mycobacterium Tuberculosis. 150 tests

qpcr Quantification Protocol Guide

RT-PCR: Two-Step Protocol

Creatine Kinase (CK) Enzymatic Assay Kit Manual Catalog #:

MMLV High Performance Reverse Transcriptase

AffinityScript QPCR cdna Synthesis Kit

PNA BRAF Mutation Detection Kit

Epstein Barr Virus (Human Herpes virus 4) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...

Blood Collection and Processing SOP

NimbleGen DNA Methylation Microarrays and Services

First Strand cdna Synthesis

Recommended Procedures for the Extraction of RNA. Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010

Stratagene QPCR Mouse Reference Total RNA

UltraClean PCR Clean-Up Kit

Plant Genomic DNA Extraction using CTAB

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products

Human Free Testosterone(F-TESTO) ELISA Kit

RIBOPROTECT. RNase Inhibitor RT33-020, RT33-100

Introduction To Real Time Quantitative PCR (qpcr)

Agencourt RNAdvance Blood Kit for Free Circulating DNA and mirna/rna Isolation from μL of Plasma and Serum

Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR

Plexor Systems Instrument Setup and Data Analysis for the Applied Biosystems 7300 and 7500 Real-Time PCR Systems

Detailed protocol: Combined method for RNA isolation. from cartilage

How To Make A Tri Reagent

Human Herpes Virus 1 (Herpes simplex type 1) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...

ZR DNA Sequencing Clean-up Kit

All-in-One mirna qrt-pcr Detection System Handbook

HBV PCR detection Kit USER MANUAL

RayBio Creatine Kinase (CK) Activity Colorimetric Assay Kit

Hepatitis B Virus. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... Core Protein Region. 150 tests.

DyNAmo cdna Synthesis Kit for qrt-pcr

Concert Plant RNA Reagent

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476

Transformation Protocol

Lyme Disease. RecA gene. 150 tests. Quantification of Lyme Disease genomes. Advanced kit handbook HB

UltraClean Forensic DNA Isolation Kit (Single Prep Format)

Aurora Forensic Sample Clean-up Protocol

QuantiNova Reverse Transcription Kit Handbook

SYBR Green Realtime PCR Master Mix -Plus-

Factors Influencing Multiplex Real-Time PCR

Troubleshooting Sequencing Data

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr

ONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue

QIAGEN Supplementary Protocol

Applied Biosystems KRAS Mutation Analysis Reagents. Protocol

Quantification of Propionibacterium acnes. Standard kit 150 tests

Quantification of Hepatitis B Virus. Core Protein Region. 150 tests

User Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse)

Klebsiella oxytoca. Outer membrane protein II (ompa) gene. 150 tests. Quantification of Klebsiella oxytoca genomes. Advanced kit handbook HB10.03.

Validating Microarray Data Using RT 2 Real-Time PCR Products

Relative Quantification Applied Biosystems 7300/7500 Real Time PCR System

Rat creatine kinase MM isoenzyme (CK-MM) ELISA Kit

Sanger Sequencing: Sample Preparation Guide

One Shot TOP10 Competent Cells

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053

Lyme Disease RecA gene. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere tests. Primerdesign Ltd.

User Bulletin #2 ABI PRISM 7700 Sequence Detection System

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

HighPure Maxi Plasmid Kit

Creatine Kinase Activity Assay Kit (Colorimetric)

Kevin Bogart and Justen Andrews. Extraction of Total RNA from Drosophila. CGB Technical Report doi: /cgbtr

Transcription:

REFERENCE PROTOCOL NAKTUINBOUW Real-time RT-PCR (RT TaqMan PCR) for pospiviroids (CEVd, CLVd, MPVd, PCFVd, PSTVd, TASVd, TCDVd and TPMVd) on seeds of pepper (Capsicum annuum) Protocol number: SPN-V044e Version: v1.1 Date: 01-08-2014 Validation: Under validation This protocol is a translation of the Dutch protocol SPN-V044. In case of discrepancies between the English and Dutch text, the Dutch text prevails. This protocol is made available without any warranty. Naktuinbouw cannot guarantee that the results obtained by laboratories that follow this protocol are accurate and representative. Many factors (e.g. personnel skills, lab conditions, quality of reagents, sampling methods etc.) can influence the results. Consequently, Naktuinbouw will not accept any liability with respect to the use of this protocol.

1. Objective To detect the absence or presence of potentially relevant pospiviroidae (CEVd, CLVd, MPVd, PCFVd, PSTVd, TASVd, TCDVd and TPMVd) in pepper seeds by isolation of RNA followed by TaqMan RT PCR. 2. Principle RNA from seed extract of pepper is isolated and purified with a Qiagen RNeasy mini plant kit. The possible presence of viroid RNA is demonstrated by means of RT TaqMan PCR using selective sets of primers and labeled TaqMan probes. Each subsample is spiked with DLVd as an internal amplification control (IAC) to monitor the performance of RNA extraction and RT Taqman PCR. 3. Abbreviations cdna Complementary DNA CEVd Citrus exocortis viroid CLVd Columnea latent viroid Ct-value Cycle threshold value (number of PCR cycli till reaching the threshold) DLVd Dahlia latent viroid (spike viroid) GH+ buffer Guanidine hydrochloride extraction buffer IAC Internal amplification control MPVd Mexican papita viroid NC seed Negative control pepper seeds (process control) PC seed Positive control TASVd contaminated pepper seed lot (process control) PCFVd Pepper chat fruit viroid PSTVd Potato spindle tuber viroid RT Taqman Reverse transcriptase Taqman TASVd Tomato apical stunt viroid TCDVd Tomato chlorotic dwarf viroid TPMVd Tomato planta macho viroid 4. Materials Biorad CFX 96 PCR apparatus DLVd stock GH+ buffer (see appendix) Grinding bags 100 ml (Interscience BagPage) Hard Shell PCR plates (Biorad, Catalog no. HSP9645) Interscience BagMixer 100 Positive RNA controls RNase-free water RNeasy plant mini kit (Qiagen) Taqman RNA-to-Ct 1 step kit (Applied Biosystems, productno. 4392938/4392656) Thermoshaker Naktuinbouw 2/9 SPN-V044e v1.1

5. Method 5.1 Safety and warnings Disinfection of seeds with hypochlorite and / or trisodium phosphate strongly decreases the sensitivity of this assay. Viroids can be present in very high concentrations in plant tissue and cross-contamination is a possibility. Accuracy of operations is important to reduce the chance of cross-contamination. Wear gloves and use pipets with filter tips at all times. 5.2 Execution 5.2.1 Preparation of pepper seed samples 1. Weigh from each sample (3.000 or 20.000 seeds) 3 subsamples of 1000 or 50 subsamples of 400 seeds and transfer each subsample to a grinding bag (Interscience BagPage 100ml). 2. Calculate the required amount of GH+ extraction buffer based on the total number of subsamples. Dilute the DLVd spike 10x. Add 10 μl diluted DLV spike for each 100 ml GH+ extraction buffer as internal amplification control (IAC). 3. Add to each bag with 1,000 or 400 seeds respectively 20 or 12 ml GH+ extraction buffer including the DLVd IAC. 4. Soak the seeds for 30-60 minutes at room temperature. 5. Extract the subsamples for 4 minutes using the Interscience BagMixer (position 4). 6. Preheat thermoshaker (setting: 65 C, 850 rpm). 7. Transfer 1.5 ml of seed extract per subsample gently into 1.5 ml tube. 8. Include a TASVd-contaminated subsample (PC pepper seed with a Ct of about 20-23) and a negative control (NC pepper seed with a Ct > 37) per sample series. 9. Incubate in thermoshaker for 15 minutes (setting: 65 C, 850 rpm). 10. Centrifuge the tubes for 10 minutes at 16,000 g. NB. Handle the PC seed as the last subsample in order to minimize the chance of cross-contamination. 5.2.2 RNA isolation 1. Use RNeasy plant mini kit for the isolation of RNA. 2. Transfer 750 µl supernatant into QIAshredder-spin-column (purple). 3. Centrifuge tubes for 2 minutes at 16,000 g. 4. Store leftover of supernatant at -20 C until the test is completed. 5. Transfer 600 µl supernatant (avoid pellet) to new 1,5 ml tube with 300 µl ethanol (96-100%). 6. Mix well by pipetting up en down. 7. Transfer 700 µl of extract into RNeasy-mini-column (pink). 8. Centrifuge 1 minute at 16,000 g. 9. Transfer filter to new collection tube. 10. Add 700 μl RW1-wash buffer to RNeasy-mini-column. 11. Centrifuge 30 seconds at 16,000 g. 12. Place RNeasy-mini-column in new collection tube. 13. Transfer 500 μl RPE-wash buffer (including ethanol) to RNeasy-mini-column. 14. Centrifuge 30 seconds at 16.000 g. 15. Transfer filter to new collection tube. 16. Transfer 500 μl RPE-wasbuffer (including ethanol) to RNeasy-mini-column. 17. Centrifuge 2 minutes at 16,000 g to dry RNeasy-silicagel-membrane. 18. Place RNeasy-mini-column in new collection tube. 19. Transfer 75 µl RNase-free water to RNeasy-mini-column. 20. Incubate 1 minute. 21. Centrifuge 1 minute at 8,000 g. 22. Continue directly with PCR or store purified RNA at -20 C. 5.2.3 Taqman RT-PCR 1. Prepare Taqman RT-PCR mix (Table 4a, 4b, 4c and 4d). NB. Work on ice as much as possible and prevent prolonged exposure of probes to light. Wear clean lab coat and gloves to minimize the risk of cross-contamination. 2. Calculate the required amount of reaction mix based on the number of subsamples & controls + 2. 3. Transfer 19 µl mix into a strip of white PCR tubes or PCR plates with white bottom / green border. 4. Pipette 6 µl of the purified RNA sample in 19 µl mix. Naktuinbouw 3/9 SPN-V044e v1.1

5. Cover the strip / plate after adding the RNA. 6. In each run, include a no-template control and positive RNA controls (Table 3) giving a Ct value of approximately 30. 7. Run the Taqman RT PCRs according to the following program (Table 5). Table 3. Positive RNA controls per mix Mix Relevant RNA controls A PSTVd, TCDVd, MPVd, PCFVd and DLVd (IAC) B CEVd, CLVd and DLVd (IAC) C TPMVd and Nad5 D TASVd Table 4a. PCR mix PSTVd, TCDVd, MPVd (FAM), PCFVd (VIC) and DLVd (IAC)(Texas red) PCR mix 1 reaction RNase-free water 4,625 μl TaqMan RT-PCR Mix (2x) (Applied biosystems) 12,5 μl 10 µm Pospi A primer mix (351a) 0,75 μl 10 µm Pospi A probe mix (351b) 0,5 μl TaqMan RT Enzym Mix (40x) (Applied biosystems) 0,625 μl Subtotal 19 μl Sample (RNA) 6 μl Total 25 μl Table 4b. PCR mix CEVd, CLVd (FAM) and DLVd (IAC)(Texas red) PCR mix 1 reaction RNase-free water 4,625 μl TaqMan RT-PCR Mix (2x) (Applied biosystems) 12,5 μl 10 µm Pospi B primer mix (352a) 0,75 μl 10 µm Pospi B probe mix (352b) 0,5 μl TaqMan RT Enzym Mix (40x) (Applied biosystems) 0,625 μl Subtotal 19 μl Sample (RNA) 6 μl Total 25 μl Table 4c. PCR mix TPMVd (FAM) and Nad5 (IAC)(Texas red) PCR mix 1 reaction RNase-free water 4,625 μl TaqMan RT-PCR Mix (2x) (Applied biosystems) 12,5 μl 10 µm Pospi C primer mix (353a) 0,75 μl 10 µm Pospi C probe mix (353b) 0,5 μl TaqMan RT Enzym Mix (40x) (Applied biosystems) 0,625 μl Subtotal 19 μl Sample (RNA) 6 μl Total 25 μl Naktuinbouw 4/9 SPN-V044e v1.1

Table 4d. PCR mix TASVd (FAM) PCR mix 1 reaction RNase-free water 3,875 μl TaqMan RT-PCR Mix (2x) (Applied biosystems) 12,5 μl 10 µm Pospi TASVd-F2-200 (281a) 0,75 μl 10 µm Pospi TASVd-R2-269 (281b) 0,75 μl 10 µm Pospi TASVd-P2-228 (281c) 0,5 μl TaqMan RT Enzym Mix (40x) (Applied biosystems) 0,625 μl Subtotal 19 μl Sample (RNA) 6 μl Totaal 25 μl Table 5. RT-Taqman program CFX96 (version 2 or higher) for mixes Table 4a, 4b, 4c and 4d temperature time hold 48 C 15' 00" hold 95 C 10' 00" 40 cycli 95 C 0' 15" 60 C 1' 00" 6. Evaluation and interpretation 6.1 Evaluation test result Turn on FAM, VIC and TR signal for all 96 wells. Use single threshold setting (RFU 200). Turn on option "fluorescent drift correction". Check shape of curve (S-shape) for positive samples. Compare, if necessary, with PC seed. Please note that the TPMVd Taqman RT occasionally gives atypical planar curves (no S-shaped curve) that should be considered as noise. In case of doubt always check with responsible person. Monitor the performance of PCs to maintain the reliability of the test list and note the RFU value used per data set. See decision matrix (Table 6a, b, c, and d) for interpretation of the results of samples. Based on the signals in different channels, an indication of the identity of a viroid can be obtained. 6.2 Validity of test result Results may only be issued if the positive controls give a clear signal (Ct seed PC and RNA PC between 18-25 and 28-32, respectively). Results may only be issued if Ct in the negative control samples > 35. The Ct DLVd must be < 32. For the matrix pepper seeds the Ct values for the Nad5 IAC are less important since the reproducibility is not optimal. Also Nad5 degradation is much faster than viroid degradation and the quantity of Nad5 is variable per seed lot. For a subsample Nad5 Ct > 32 can be acceptable provided that the IAC DLVd is < 32 and the TPMVd PC is clearly positive. Contact the responsible person when the results differ from the expectations. Contact the responsible person when a seed sample is suspect. Naktuinbouw 5/9 SPN-V044e v1.1

6.3 Decision matrix (subsample level) Table 6a. Decision matrix PCR mix 4A: PSTVd, TCDVd, MPVd (FAM), PCFVd (VIC) and DLVd (IAC)(TR) Ct FAM Ct VIC Ct TR (IAC) >32 >32 <32 PSTVd, TCDVd, MPVd and PCFVd not detected >32 <32 <32 PSTVd, TCDVd and MPVd not detected PCFVd detected <32 >32 n.a. PSTVd and/or TCDVd and/or MPVd detected* PCFVd not detected <32 <32 n.a. PSTVd and or TCDVd and/or MPVd detected* PCFVd detected >32 >32 >32 Not valid/repeat (check other IACs) *if desired, perform sequence analysis to identify the specific pospiviroid Table 6b. Decision matrix for PCR mix 4B: CEVd, CLVd (FAM) and DLVd (IAC)(TR) Ct FAM Ct TR (IAC) >32 <32 <32 n.a. >32 >32 CEVd and CLVd not detected CEVd and/or CLVd detected Not valid/repeat (check other IACs) Table 6c. Decision matrix for PCR mix 4C: TPMVd (FAM) and Nad5 (TR) Ct FAM Ct TR (IAC) >32 <32 TPMVd not detected <32 n.a. >32 >32 Tabel 6d. Decision matrix for PCR mix 4D: TASVd (FAM) Ct FAM TASVd not detected >32 <32 TPMVd detected Check DLVd IACs (mix A and mix B) since IAC DLVd is more relevant. Check with responsible person. TASVd detected 7. Literature and instructions Literature: Boonham, N., L.. González-Pérez,,M.S. Mendez, E. Lilia Peralta, A. Blockley, K. Walsh, I. Barker & R.A. Mumford (2004) Development of a real-time RT-PCR assay for the detection of Potato spindle tuber viroid. Journal of Virological Methods 116:139-146. Botermans, M., van de Vossenberg, B. T. L. H., Verhoeven, J. Th. J.,Roenhorst, J. W., Hooftman, M., Dekter, R. & Meekes, E. T. M. (2013) Development and validation of a real-time RT-PCR assay for generic detection of pospiviroids. J. Virol. Methods 187, 43 50. Koenraadt, H., Jodlowska, A., van Vliet, A. & Verhoeven, K. (2009) Detection of TCDVd and PSTVd in seeds of tomato. Phytopathology 99, S66. Menzel, W., Jelkmann, W., and Maiss, E. (2002) Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mrna as internal control. J. Virol. Methods 99: 81-92. Monger, W., Tomlinson, J., Boonham, N., Marn, M.V., Plesko, I.M., Molinero-Demilly,V., Tassus, X., Meekes, E., Toonen, M., Papayiannis, L., Perez-Egusquiza, Z., Mehle, N., Jansen, C., Nielsen, S.L., (2010) Development and interlaboratory evaluation of real-time PCR assays for the detection of pospiviroids. J. Virol. Methods 169, 207 210. Naktuinbouw 6/9 SPN-V044e v1.1

Mumford, R.A., A.L. Skelton, N. Boonham, K.I. Posthuma, M.J. Kirby, & A.N. Adams (2001) The Improved Detection of Strawberry Crinkle Virus Using Real-Time RT-PCR (TaqMan ). Acta Horticulturae 656: 81-86. Manuals: TaqMan RNA-to-CT 1-Step Kit Protocol RNeasy plant mini kit (Qiagen) 8. History and revisions 20-12-2013 Version 1.0 - Protocol based on ISO17025 accredited PSTVd/ TCDVd seed assay (SPN-V003, version 3.1) for tomato. Overnight soaking of seeds was reduced to 30-60 minutes to limit break down of viroid. Introduction of DLVd spike as an internal amplification control (IAC) in multiplex RT Taqman to replace endogenous Nad5 target since amount of Nad5 RNA is highly variable (14-40) in the seed matrix. Use of GH+ extraction buffer instead of PN1 extraction buffer (LGC) since degradation in GH+ RNA extraction buffer is much less than in PN1 extraction buffer leading to a higher PSTVd sensitivity. Use of several new multiplex RT Taqmans to detect additional Pospiviroidae as CEVd, CLVD, PCFVd, TASVd and TPMVd. 03-02-2014 Version 1.1 - Correction numbering primer sets in appendices. 201d instead 201c, at 349 / mc instead of 249 at / c and 350a, 350b instead 250a, 250b. Naktuinbouw 7/9 SPN-V044e v1.1

9. Appendices GH+ extraction buffer (6M) Adjust to 1 liter with water guanidine-hydrochloride (harmful) 573 g NaAC-buffer (4M) 50 ml EDTA (di-natrium) 9.3 g PVP-10 25 g NaAc buffer (4M) Adjust to 1 liter with water NaAC (CH3COONa) 328 g Check/adjust ph to 5.2 DLVd spike Take a leaf from a DLVd infected Dahlia plant and make an leaf extract. Dilute the extract experimentally to a Ct value of 25. Store aliquots at -80 C. After thawing store aliquot at -20 C for up to one week. Primer No. Naktuinbouw primer collection Sequence PSTV-231F1 201a GCCCCCTTTGCGCTGT 1 PSTV-296R 201b AAGCGGTTCTCGGGAGCTT 1 PSTV-251T-probe 201d 6FAM-CAGTTGTTTCCACCGGGTAGTAGCCGA-BHQ1 1 DaVd1-FT 320a GCTCCGCTCCTTGTAGCTTT 2 DaVd1-RT 320b AGGAGGTGGAGACCTCTTGG 2 DaVd1-P 320c Texas red-ctgactcgaggacgcgaccg-bhq2 2 TPMVd-F1 350a AAAAAAGAATTGCGGCCAAA 3 TPMVd-R 350b GCGACTCCTTCGCCAGTTC 3 puccr2 307i 6FAM-CCGGGGAAACCTGGA-NFQ-MGB 4 CLVd-F 279a GGTTCACACCTGACCCTGCAG 5 CLVd-F2 279b AAACTCGTGGTTCCTGTGGTT 5 CLVd-R 279c CGCTCGGTCTGAGTTGCC 5 CLVd-P 279d 6FAM-AGCGGTCTCAGGAGCCCCGG-BHQ1 5 CEVd-F2-304 280a CTCCACATCCGRTCGTCGCTGA 6 CEVd-R2-399 280b TGGGGTTGAAGCTTCAGTTGT 6 CEVd-P2-337 280c 6FAM-CCCTCGCCCGGAGCTTCTCTCTG-BHQ1 6 TASVd-F2-200 281a CKGGTTTCCWTCCTCTCGC 7 TASVd-R2-269 281b CGGGTAGTCTCCAGAGAGAAG 7 TASVd-P2-228 281c 6FAM-TCTTCGGCCCTCGCCCGR-BHQ 7 PCFVd-F 349a TCTTCTAAGGGTGCCTGTGG 8 PCFVd-R 349b GCTTGCTTCCCCTTTCTTTT 8 PCFVd-Probe 349c VIC-CTCCCCCGAAGCCCGCTTAG-BHQ1 8 nad5 F 151a GATGCTTCTTGGGGCTTCTTGTT 9 nad5 R 151b CTCCAGTCACCAACATTGGCATAA 9 nad5-probe 151d Texas red-aggatccgcatagccctcgatttatgtg-bhq2 9 1: Boonham et al. (2004), 2, 3, 8 and 9: R&D Naktuinbouw, 4: Botermans et al. (2011), 5: Monger et al. (2010), 6 and 7: FERA. Lit. ref. Naktuinbouw 8/9 SPN-V044e v1.1

Composition primer and probe mixes A, B and C (10 µm each) 351a Pospi primermix A 201a, 201b, 349a, 349b, 320a, 320b 351b Pospi primermix A 201d, 349c, 320c 352a Pospi primermix B 280a, 280b, 279a, 279b, 279c, 320a, 320b 352b Pospi primermix B 280c, 279d, 320c 353a Pospi primermix C 350a, 350b, 151a, 151b 353b Pospi primermix C 307i, 151d Naktuinbouw 9/9 SPN-V044e v1.1