RNA Antisense Purification (RAP): Experimental Protocols
|
|
|
- Alyson Parks
- 10 years ago
- Views:
Transcription
1 RNA Antisense Purification (RAP): Experimental Protocols Jesse Engreitz August 23, Last Updated: October 18, 2014 This document describes the experimental procedures for RNA Antisense Purification (RAP), a generally applicable method for biochemical purification of a specific RNA or RNAs. This technique can be used to enrich specific RNAs from clean, isolated RNA, or to purify endogenous RNA complexes from crosslinked cell extracts in order to identify interacting molecules. In RAP, we crosslink cells to fix endogenous RNA complexes and then purify these complexes through hybrid capture with biotinylated antisense oligos. RNA or DNA molecules that interact with the target RNA are identified using high-throughput sequencing. RAP can be performed with various crosslinking conditions to identify RNA or DNA molecules that interact with the target RNA through different mechanisms; for instance, direct RNA-RNA interactions (via hybridization) may be specifically captured by crosslinking with psoralens, while indirect interactions (via protein intermediates) can be found by crosslinking with formaldehyde. Compared to other similar techniques, the most distinctive and important feature of RAP is its use of long (>60-nucleotide) capture probes tiled across the entire target RNA. This probe design strategy robustly captures any RNA and enables the use of stringent hybridization and wash conditions that dramatically reduce nonspecific interactions of off-target nucleic acids or proteins. The following document outlines the experimental protocols used in Engreitz et al. (2014) to purify various RNAs to examine their RNA and DNA interactions. For the latest RAP protocols, visit For additional information about RAP, see: Engreitz JM et al. RNA-RNA Interactions Enable Specific Targeting of Noncoding RNAs to Nascent Pre-mRNAs and Chromatin Sites. Cell. September Engreitz JM et al. The Xist lncrna exploits three-dimensional genome architecture to spread across the X chromosome. Science. August For questions and troubleshooting, Jesse at [email protected]. 1
2 Table of Contents: 1 Materials Equipment Solutions Additional Materials and Reagents 4 2 Assay Design 6 3 Probe Design and Generation Probe Design Probe Set Enrichment PCR In Vitro Transcription of Probe DNA Template Reverse Transcription to Generate ssdna Probes 10 4 Magnetic-bead Purification of Nucleic Acids SILANE SPRI 12 5 Sample Preparation RAP-DNA and RAP-RNA with Formaldehyde-DSG Crosslinking RAP-RNA with Formaldehyde Crosslinking RAP-RNA with Psoralen (AMT) Crosslinking 20 6 RNA Antisense Purification RAP-DNA and RAP-RNA with Formaldehyde or Formaldehyde-DSG Crosslinking RAP-RNA with AMT Crosslinking or RAP-RNA from Purified Total RNA 25 7 RAP-DNA Sequencing Library Preparation 27 8 RAP-RNA Sequencing Library Preparation 29 2
3 1 Materials 1.1 Equipment Sonication instrument (e.g., Branson Sonifier with microtip) and chiller Magnetic rack for 1.5 ml tubes (e.g., Invitrogen DynaMag-2) PCR machine and real-time quantitative PCR machine Microcentrifuge NanoDrop Spectrophotometer Glass dounce Heated mixer with 1.5 ml rack (e.g., Eppendorf Thermomixer) UV Stratalinker 2400 (for AMT crosslinking) Agilent Bioanalyzer 1.2 Solutions Different variants of the protocol require different combinations of the following solutions and buffers: Scraping Buffer 1 PBS ph % BSA Fraction V Store at 4 C Cell Lysis Buffer 10 mm HEPES ph mm KCl 1.5 mm MgCl mm EDTA 1 mm tris(2-carboxyethyl)phosphine (TCEP, add fresh) 0.5 mm PMSF (add fresh) Store at 4 C Nuclear Lysis Buffer 20 mm HEPES ph mm KCl 1.5 mm MnCl 2 1% NP % sodium deoxycholate 0.1% N-lauroylsarcosine 1 mm TCEP (add fresh) 0.5 mm PMSF (add fresh) Store at 4 C 100 DNase Cofactor Solution 250 mm MnCl 2 50 mm CaCl 2 25 DNase Stop Solution 250 mm EDTA 125 mm EGTA GuSCN Hybridization Buffer (1 ) 20 mm Tris-HCl ph mm EDTA 3 mm EGTA 150 mm LiCl 1% NP % N-lauroylsarcosine 0.1% sodium deoxycyolate 3 M guanidine thiocyanate 2.5 mm TCEP Prepare 1 and 1.4x solutions GuSCN Wash Buffer 20 mm Tris-HCl ph mm EDTA 1% NP % N-lauroylsarcosine 0.1% sodium deoxycyolate 3 M guanidine thiocyanate 2.5 mm TCEP 3
4 RNase H Elution Buffer 50 mm Tris-HCl ph mm NaCl 3 mm MgCl % N-lauroylsarcosine (add fresh) 0.025% sodium deoxycholate (add fresh) 2.5 mm TCEP (add fresh) NLS Digestion Buffer 20 mm Tris-HCl ph mm EDTA 2% N-lauroylsarcosine 2.5 mm TCEP LiCl Hybridization Buffer (1 ) 10 mm Tris-HCl ph mm EDTA 500 mm LiCl 1% Triton X % SDS 0.1 sodium deoxycholate 4 M urea Low Stringency Wash Buffer 1 SSPE 0.1% SDS 1% NP-40 4 M urea High Stringency Wash Buffer 0.1 SSPE 0.1% SDS 1% NP-40 4 M urea FNK Buffer (5 ) 50 mm Tris-HCl ph mm MgCl mm CaCl 2 50 mm KCl 10 mm DTT 0.01% Triton X Additional Materials and Reagents Different variants of the protocol use different combinations of the following reagents: Oligonucleotide library or biotinylated probes (see section on Probe Generation) NEBNext High-Fidelity PCR Master Mix (NEB) T7 RNA Polymerase and 10 Buffer (NEB) Murine RNase Inhibitor (NEB) 100 mm ATP, CTP, GTP, UTP (NEB) DNA purification kit: DNA Clean and Concentrator-5 (Zymo) RNA purification kits: RNA Clean and Concentrator-5 (Zymo), RNeasy Mini (Qiagen) Bioanalyzer: RNA 6000 Pico Kit, Small RNA Kit, High-Sensitivity DNA Kit (Agilent) TURBO DNase (Invitrogen) Multiple-temperature reverse-transcription reagents (e.g., AffinityScript Reverse Transcriptase and Buffer from Agilent) Cell scraper Disuccinimidyl glutarate (Pierce) 16% Formaldehyde solution in 10-mL ampules (Pierce) 2.5 M Glycine solution BSA Fraction V 4
5 Ambion RNase Cocktail (Life Technologies) 4 -Aminomethyltrioxalen hydrochloride (AMT, Sigma-Aldrich) Ambion 10 RNA Fragmentation Reagent (Life Technologies) MyONE Streptavidin C1 magnetic beads (Invitrogen) MyONE SILANE magnetic beads (Invitrogen) Buffer RLT (Qiagen) TRIzol (Life Technologies) 100 mm dithiothreitol (DTT) 10 RT Random Primers (Applied Biosystems) RT-qPCR reagents and PCR primers NEBNext Ultra DNA Library Prep Kit and Multiplex Primers (NEB) FastAP Thermosensitive Alkaline Phosphtase (Thermo Scientific) T4 Polynucleotide Kinase (NEB) T4 RNA Ligase 1 (30 U / µl, NEB) ExoSAP-IT (Affymetrix) Agencourt AMPure XP magnetic beads (Beckman Coulter) Low-retention pipette tips 5
6 2 Assay Design 1. Choose a target RNA of interest. 2. Choose appropriate negative control target sequences. Suggested controls include: (i) a scrambled version of the target RNA that represents a GC-content-matched control that does not exist in the cell; (ii) other similar-sized and similar-abundance RNAs that should have different interaction partners than the target RNA. 3. Choose appropriate positive control targets to aid in optimizing lysis and purification conditions. As a positive control, we suggest purifying the highly abundant U1 snrna and comparing the resulting data to that published in Engreitz et al. Cell In mouse cells (Mus musculus), use the following three 5 -biotinylated probes: 1. CAGGGGAGAGCGCGAACGCAGTCCCCCACTACCACAAATTATGCAGTCGA 2. GTTTCCCGCATTTGGGGAAATCGCAGGGGTCAGCACACCCCAAAGTGCAA 3. TGGGTGAGCCTCGCCCTGGGAAAACCACCTTCATGATCATGGTATCTCCC 6
7 3 Probe Design and Generation Goal: Design and generate long antisense biotinylated ssdna probes that tile across the length of the target RNA. The goal is to robustly capture the target RNA, regardless of secondary structure or RNA-protein interactions, while avoiding off-target hybridization and capture of other sequences. The method described below uses oligonucleotide library synthesis strategies to simultaneously generate pools of oligos targeting many genes of interest. Each probe set is tagged with unique PCR primers that allow for enrichment of specific probe sets from the total pool. Probe sets are in vitro transcribed and then reverse transcribed with biotinylated primers to generate single-biotin ssdna probes. An alternative strategy for obtaining RAP probes is to order 5 biotinylated oligos from a commercial supplier. Compared to the protocol presented below, ordering ready-touse biotinylated probes from a commercial supplier potentially provides a faster and cheaper alternative for obtaining large amounts of a smaller number of probes. RAP uses highly denaturing and stringent hybridization conditions to ensure capture specificity. However, nonspecific interactions are currently difficult to predict and will be different for each new target RNA, and so we recommend using two independent probe sets in an even/odd design to provide additional confidence in RNA-chromatin interactions identified with RAP. We note that single-stranded DNA probes provide better capture specificity than the RNA probes used in previous iterations of this protocol. 3.1 Probe Design 1. Design 90- to 120-nucleotide capture probes antisense to the target RNA sequences. Shorter probes (50-90 nucleotides) can also be used, provided GC content is >50%. Probes can be tiled across the entire transcript (e.g., each 120-nucleotide probe overlaps the next probe by 105 nucleotides), or they can be divided into two nonoverlapping probe pools (even and odd) for additional specificity. 2. Omit probes that may hybridize to off-target sequences. Remove probes that contain more than 8 bases of any repetitive or low-complexity sequences as defined by RepeatMasker and Tandem Repeat Finder (these annotations can be viewed on the UCSC Genome Browser at Remove probes that contain homo-polymers of more than 8 bases. Remove probes that align to other regions in the genome with 25 or more matching bases (e.g., with BLAT). 3. Choose and validate RT-qPCR primers spanning a short amplicon (<90 bases) on the target RNA, and omit probes that overlap this region. This will enable qpcr measurement of purification yields and enrichments without confounding signal from residual amounts of the probes themselves. 7
8 4. For each probe set, design unique PCR tags (20 base-pairs) with 65 C annealing temperatures (hereafter, Left Tag Primer and Right Tag Primer). Append the PCR tags to the ends of each probe in a given probe set such that the Left Tag Primer is on the 5 end of the oligo sequence and the Right Tag Primer is on the 3 end of the oligo sequence (which is itself antisense to the target RNA). 5. Order the pool of ssdna oligos from an oligo library synthesis company (such as Agilent Technologies or CustomArray, Inc.). To improve synthesis of difficult sequences (such as probes containing poly-t sequences), synthesize both the desired ssdna oligo as well as its reverse complement in the same pool. 6. Resuspend the lyophilized oligo pool in water to a final concentration of 10 nm. 7. Order enrichment primers: for each probe set, order (i) Left Tag and Right Tag primers; (ii) T7-Left Tag and T7-Right Tag Primers, which are comprised of Left Tag and Right Tag Primers each following a T7 promoter sequence (e.g., GGATTCTAATACGACTCACTATAGGG-Left Tag Primer); and (iii) 5 - biotinylated Left Tag and Right Tag Primers. 3.2 Probe Set Enrichment PCR 8. For each probe set, enrich the component probes from the oligo pool using the unique PCR tags. Set up PCR reaction on ice: Oligo Pool (10 nm) 1 µl Tag Primer Left (25 µm) 1 µl Tag Primer Right (25 µm) 1 µl NEBNext High-Fidelity 2x Master Mix (NEB) 25 µl H 2 O 23 µl Total 50 µl 9. Run PCR program to enrich the desired subset of oligos from the pool: Initiation Denaturation 98 C 30 seconds 1 cycle Denaturation 98 C 10 seconds Annealing 65 C 20 seconds cycles Extension 72 C 20 seconds Final Extension 72 C 60 seconds 1 cycle Hold 4 C hold 10. Clean up the PCR product using the Qiagen PCR Purification Kit according to manufacturer s protocol. Measure DNA yield using a NanoDrop spectrophotometer. Examine the dsdna product on an agarose gel. If necessary, repeat Step 2 varying the annealing temperature or number of cycles until the reaction produces a single clean band of the appropriate size. 11. Create a dilution of the enriched PCR product that is approximately 1 nm. 12. Perform a second round of amplification to add the T7 promoter sequence. If desired, set up two PCR reactions to add the T7 promoter sequence onto one or the other end of the dsdna template, allowing for generation of both antisense and sense probes 8
9 during the in vitro transcription step. To generate antisense ssdna probes that capture the target RNA, for example, use Tag Primer Left with T7-Tag Primer Right. Diluted enriched dsdna (~1 nm) 1 µl Primer mix (25 µm of each primer) 2 µl Phusion High-Fidelity 2 Master Mix (NEB) 25 µl H 2 O 23 µl Total 50 µl Initial Denaturation 98 C 30 seconds 1 cycle Denaturation 98 C 10 seconds Annealing 60 C 20 seconds 3 cycles Extension 72 C 20 seconds Denaturation 98 C 10 seconds Annealing 68 C 20 seconds 9-12 cycles Extension 72 C 20 seconds Final Extension 72 C 60 seconds 1 cycle Hold 4 C hold 13. Clean the PCR product using the Qiagen PCR Purification Kit according to manufacturer s protocol. Examine the dsdna product on an agarose gel. Assess DNA yield using a NanoDrop spectrophotometer. If necessary, repeat PCR varying the annealing temperature or number of cycles until the reaction produces a single clean band of the appropriate size. If necessary, perform multiple PCR reactions to generate >250 ng of dsdna T7 template for in vitro transcription. 3.3 In Vitro Transcription of Probe DNA Template 14. For each probe set, set up one or more 40 µl in vitro transcription reactions: T7 DNA template (~250 ng) 24.2 µl 10 RNA Polymerase Reaction Buffer (NEB) 4 µl 100 mm ATP 2 µl 100 mm CTP 100 mm GTP 100 mm UTP T7 RNA Polymerase (NEB) 100 mm DTT 0.4 µl Murine RNase Inhibitor (NEB) 0.4 µl Total 40 µl 15. Mix well by pipetting and incubate at 37 C overnight. 16. Next day, denature RNA/DNA hybrids by incubating at 85 C for 3 minutes. Afterward, place immediately on ice for 1 minute µl µl µl µl 9
10 17. To digest dsdna templates, add 42 µl H 2 O, 10 µl TURBO DNase Buffer, and 8 µl TURBO DNase (100 µl total volume). Incubate at 37 C for 15 minutes. Note: TURBO DNase outperforms DNase I at high salt concentrations. 18. Incubate at 37 C for 15 minutes to digest T7 DNA template. 19. Purify RNA with the RNeasy Mini kit (Qiagen) using sufficient ethanol to precipitate the ~150-nucleotide RNA fragments: Add 3.5 RLT (350 µl) to sample and mix well. Add % ethanol (775 µl) to sample-rlt mixture and mix well. Transfer 700 µl to the RNeasy Mini column, and spin for 15 seconds at >8,000 g. Discard flow-through and repeat with remaining sample. Add 500 µl Buffer RPE to column and spin for 15 seconds. Discard flow-through. Repeat wash step. Transfer column to fresh collection tube and spin for 2 minutes to remove residual Buffer RPE. Transfer column to 1.5 ml tube; add 30 µl H 2 O and spin for 1 minute to elute. 20. Measure RNA yield with a NanoDrop and dilute to a convenient concentration (e.g., 1 µg/µl). Ideally yield should be >50 µg for a 40 µl reaction. 21. Denature RNA and run on gel to confirm the correct size of the in vitro transcription product. 3.4 Reverse Transcription to Generate ssdna Probes 22. To generate ssdna, set up a 200 µl reverse transcription reaction: RNA template (10 µg) + H 2 O 120 µl 100 μm 5 -biotinylated Left Tag Primer 20 µl 10 AffinityScript Buffer 20 µl 100 mm DTT 20 µl 100 mm dntps (25 mm each) 8 µl AffinityScript Reverse Transcriptase Enzyme 10 µl Total 200 µl 23. Incubate at 55 C for 50 minutes, then 75 C for 5 minutes. 24. To degrade RNA templates, add 0.1 (20 µl) 1 M NaOH. Incubate at 75 C for another 10 minutes. 25. Add 0.1 (20 µl) 1 M acetic acid to neutralize. 26. Clean up the ssdna product and eliminate the unused primer by size selection. For example, use a Zymo RNA Concentrator-5 column: Add 2 volume RNA Binding Buffer (480 µl) and mix well; add 1.9 original volume 100% ethanol (456 µl) and mix well. Transfer 700 µl to column; spin at 12,000 g for 1 minute. Discard flowthrough and repeat with remaining sample. Add 400 µl RNA Prep Buffer; spin for 30 seconds and discard flow-through. Add 700 µl RNA Wash Buffer; spin and discard flow-through. Repeat the wash step with 400 µl RNA Wash Buffer. Transfer column to clean collection tube and spin for 2 minutes. Transfer column to a 1.5 ml tube, add 30 µl of water, and spin at 10,000 g for 1 minute to elute. 10
11 27. Measure the yield with a NanoDrop. Ideal yield should be ~3 µg ssdna for a 200 µl reverse transcription reaction. 28. Freeze biotinylated ssdna probe until use. 11
12 4 Magnetic-bead Purification of Nucleic Acids Goal: Clean up RNA or DNA using magnetic beads. 4.1 SILANE 4.2 SPRI At several steps, we use SILANE beads to clean up samples in place of column purifications or chloroform extractions. Size selection can be achieved through adjusting the salt and alcohol concentrations during the initial binding. Use this protocol for a basic SILANE clean-up (captures all nucleic acids >20 nucleotides): 1. Aliquot out an appropriate volume of MyONE SILANE magnetic beads for the cleanup (capacity is at least 100 ng RNA and/or DNA per 5 µl of SILANE beads). 2. Place tube with SILANE beads on a magnetic rack. Wait ~30 seconds for beads to completely separate. 3. Remove supernatant, then remove tube from rack and resuspend beads once in Buffer RLT (Qiagen). 4. Place on magnet, wait for beads to separate, and remove supernatant. 5. Resuspend beads in 3.5 sample volume Buffer RLT (Qiagen) and add to sample (e.g., for cleaning a 20 µl reaction, add beads in 70 µl of RLT). 6. Add 4.5 original sample volume 100% isopropanol (e.g., for cleaning a 20 µl reaction, add 90 µl isopropanol) and mix well by pipet. Note: In some SILANE bead purifications we use ethanol instead of isopropanol. 7. Incubate at room temperature for 2 minutes. 8. Place tube on magnetic rack. Wait 1-2 minutes for beads to separate, then remove and discard supernatant. 9. Wash by removing tube from magnetic rack, resuspending beads in 70% ethanol (e.g., µl), capturing beads, and removing supernatant. Repeat wash step for a total of two washes. 10. Carefully remove all remaining 70% ethanol. Dry beads on the magnetic rack for 4-6 minutes or until dry (exact timing depends on bead volume, humidity, etc.). 11. Elute by resuspending beads in desired volume of H 2 O, then magnetically separating and transferring eluate to a new tube. We use Agencourt AMPure XP (SPRI) beads to clean up and size-select dsdna libraries. Use this protocol: 1. Add indicated volume SPRI beads to the DNA reaction. Take care when pipetting the viscous SPRI bead solution. Mix well by pipetting and wait 5 minutes. 2. Place on magnet and wait 2-5 minutes. 12
13 3. Remove and discard supernatant. 4. Wash beads twice in 100 µl 70% ethanol: add ethanol to beads while tube is on magnet, then move tube around magnet so that beads fly through ethanol from side to side. 5. Dry beads for 5-10 minutes. 6. Add H 2 O to elute. 13
14 5 Sample Preparation Goal: Crosslink cells to fix in vivo RNA complexes. Lyse cells and fragment RNA and/or DNA to appropriate sizes. Multiple protocols below describe sample preparation for different variants of the RAP protocol, including using AMT crosslinking (for identifying direct RNA-RNA interactions), formaldehyde crosslinking (for identifying direct and indirect RNA-RNA), or formaldehyde-dsg crosslinking (for identifying direct and indirect RNA-RNA and RNA-chromatin interactions). Optimization of the lysis conditions (amount of sonication, amount/timing of DNase) is a critical step in establishing the protocol for the first time. The length of sonication might vary from 1-10 minutes and DNase treatment might vary from 10 to 20 minutes, depending on cell number, ploidy, crosslinking strength, and the desired RNA fragment size. To optimize DNase timing and conditions, remove 5 µl lysate aliquots every 2-4 minutes, quench with EDTA and EGTA on ice, and assay RNA and/or DNA sizes for each time point as described in the protocol. We recommend trying several different lysis conditions and comparing the results obtained when performing RAP on a positive control target RNA. If an appropriate combination of solubilization and RNA/DNA fragment sizes cannot be obtained by varying the amount of sonication or DNase, then reducing the strength of the crosslinking may be necessary. These protocols describe the steps for adherent cells, but can be readily adapted for cells grown in suspension. 5.1 RAP-DNA and RAP-RNA with Formaldehyde-DSG Crosslinking Cell Harvesting and Crosslinking 1. Grow adherent cells on 15-cm plates. Before crosslinking, carefully split and count one plate. Note: Accurate cell counts are critical for maintaining consistency between cell and lysate batches because cell numbers affect the efficiency of the sonication and DNase treatment during lysis. We typically harvest and crosslink million cells in parallel and freeze multiple 20-million cell pellets; one of these pellets is spent to optimize lysis conditions, and the rest are used for purification experiments. 2. Heat one aliquot PBS at 37 C and chill one aliquot at 4 C (see below for volumes). 3. Resuspend 50-mg of DSG in 306 µl DMSO to create a 0.5 M stock solution of DSG. 4. Dilute DSG to 2 mm in PBS. Prepare 7 ml of 2 mm DSG for each 15-cm plate. 5. Remove media from cells. Rinse cells in plate with 10 ml room temperature PBS. Discard PBS. 6. Add 7-10 ml of 2 mm DSG solution and rock plates gently at room temperature for 45 minutes to crosslink. 14
15 7. Immediately before using, prepare a 3% formaldehyde solution in PBS preheated to 37 C. Use a fresh ampule of 16% formaldehyde (Pierce). 8. Remove DSG solution from cells and wash once with room temperature PBS. 9. Add 7 ml warmed 3% formaldehyde solution to cells. Incubate at 37 C for 10 minutes, gently rocking by hand every 3 minutes. 10. Quench formaldehyde crosslinking by adding glycine to a final concentration of 500 mm. Incubate at 37 C for 5 minutes. 11. Discard formaldehyde waste in appropriate disposal container. 12. Rinse cells three times with cold PBS. Avoid dislodging cells from plate. 13. After last wash, add 2 ml of ice-cold Scraping Buffer to each 15-cm plate. From this point, keep cells at 4 C. 14. Scrape cells from plate and transfer to a 15-mL Falcon tube. 15. Centrifuge at 1000 g at 4 C for 5 minutes to pellet cells. 16. Discard supernatant and resuspend pellet in 1 ml ice-cold Scraping Buffer to break up the pellet. Add more Scraping Buffer if necessary for convenient aliquoting (e.g., add 1 ml of Scraping Buffer for every 20 million cells). 17. Aliquot cells into microcentrifuge tubes (20 million cells each) and spin at 2,000 g at 4 C for 5 minutes. 18. Remove supernatant and flash freeze pellet in liquid nitrogen. Store until cell lysis at -80 C Cell Lysis Note: All steps and buffers should be cooled to 4 C unless otherwise stated. 19. Thaw cell pellets by completely resuspending 20 million cells in 1 ml Hypotonic Cell Lysis Buffer (add TCEP and PMSF fresh) in a 1.5 ml microcentrifuge tube. 20. Pellet cells by spinning at 3300 g for 7 minutes. Remove supernatant. 21. Gently resuspend swelled cells in 1 ml ice cold Cell Lysis Buffer pre-mixed with 0.1% NP-40. Incubate on ice for 10 minutes. 22. Transfer to an ice-cold glass dounce of appropriate size (e.g., 2 ml). Homogenize cell lysate by douncing Transfer cells back to a microcentrifuge tube and pellet nuclei by spinning at 3300 g for 7 minutes. Remove supernatant. 24. Resuspend nuclei in 1 ml of Nuclear Lysis Buffer (add TCEP and PMSF fresh). Incubate on ice for 10 minutes. 25. Sonicate using a Branson Sonifier fitted with a microtip using 5 Watts of power for 2 minutes in pulses (0.7 seconds on, 3.3 seconds off). Samples should be kept cold during sonication, for example by holding the sample in a 4 C chilling rack or ice bath. Depending on the length of sonication and the efficiency of the cooling strategy, 15
16 longer breaks between sonication pulses may help to keep samples cool. Note again that this step is very sensitive to cell count, type of chilling rack, shape and size of tube, etc., and so plan to optimize by testing multiple conditions. 26. Split sample into two separate microcentrifuge tubes, each with 500 µl lysate. 27. To each, add 6 µl of 100 DNase Cofactor Solution and µl TURBO DNase. Mix by pipet. 28. Transfer to a 37 C heat block and incubate for minutes. 29. Return sample to ice and immediately halt DNase reaction by adding 24 µl of DNase Stop Solution. Mix immediately by pipetting. 30. Remove and save a 5 µl aliquot of lysate (pre-clear). 31. Mix ~600 µl of lysate with 1.5 ml of 1.4 concentrated GuSCN Hybridization Buffer. 32. Clear lysate by spinning at maximum speed (16,000 g) for 10 minutes. 33. Remove and save a 5 µl aliquot of lysate (post-clear). 34. Flash-freeze aliquots of lysate in liquid nitrogen and store at -80 C Check RNA and DNA Sizes 35. To check quantities and sizes of RNA and DNA in saved aliquots of lysate (Steps 12 and 15 above), first add 40 µl of NLS Digestion Buffer, 2.5 µl of 5 M NaCl, and 2.5 µl Proteinase K, and incubate at 65 C for 60 minutes. 36. Clean and purify nucleic acids using 10 µl of SILANE beads. At end, add 20 µl H 2 O but do not remove from beads. 37. Split sample/bead mixture in half: treat half with 1 µl TURBO DNase + 1 µl TURBO DNase Buffer, and the other half with 1 µl of Ambion RNase Cocktail. Incubate each for 37 C for 10 minutes. 38. Clean and purify nucleic acids using the SILANE beads already in the mixture. Elute in 10 µl H 2 O. 39. Quantify RNA and DNA yields with a NanoDrop spectrophotometer. Accounting for the dilution of the lysate between the pre-clear and post-clear aliquots, we typically find that the post-clear aliquots contains >50% of the DNA of the pre-clear aliquot, indicating successful solubilization of chromatin. 40. Assess fragment sizes with the Agilent Bioanalyzer (High-Sensitivity DNA and RNA Pico kits). The figures below show ideal sizes, although some variation is expected and may not significantly change the efficiency of the purification. 16
17 DNA sizes after lysis (High-Sensitivity DNA Bioanalyzer) RNA sizes after lysis (RNA 6000 Pico Bioanalyzer Assay) 17
18 5.2 RAP-RNA with Formaldehyde Crosslinking We also use this protocol for non-crosslinked controls. Note: Differences from the formaldehyde-dsg protocol above are printed in red text Cell Harvesting and Crosslinking 1. Grow adherent cells on 15-cm plates. Before crosslinking, carefully split and count one plate. Note: Accurate cell counts are critical for maintaining consistency between cell and lysate batches because cell numbers affect the efficiency of the sonication and DNase treatment during lysis. We typically harvest and crosslink million cells in parallel and freeze multiple 20-million cell pellets; one of these pellets is spent to optimize lysis conditions, and the rest are used for purification experiments. 2. Heat one aliquot PBS at 37 C and chill one aliquot at 4 C (see below for volumes). 3. Remove media from cells. Rinse cells in plate with 10 ml room temperature PBS. Discard PBS. 4. Immediately before using, prepare a 2% formaldehyde solution in PBS preheated to 37 C. Use a fresh ampule of 16% formaldehyde (Pierce). 5. Add 7 ml warmed 2% formaldehyde solution to cells. Incubate at 37 C for 10 minutes, gently rocking by hand every 3 minutes. 6. Quench formaldehyde crosslinking by adding glycine to a final concentration of 500 mm. Incubate at 37 C for 5 minutes. 7. Discard formaldehyde waste in appropriate disposal container. 8. Rinse cells three times with cold PBS. Avoid dislodging cells from plate. 9. After last wash, add 2 ml of ice-cold Scraping Buffer to each 15-cm plate. From this point, keep cells at 4 C. 10. Scrape cells from plate and transfer to a 15-mL Falcon tube. 11. Centrifuge at 1000 g at 4 C for 5 minutes to pellet cells. 12. Discard supernatant and resuspend pellet in 1 ml ice-cold Scraping Buffer to break up the pellet. Add more Scraping Buffer if necessary for convenient aliquoting (e.g., add 1 ml of Scraping Buffer for every 20 million cells). 13. Aliquot cells into microcentrifuge tubes (20 million cells each) and spin at 2,000 g at 4 C for 5 minutes. 14. Remove supernatant and flash freeze pellet in liquid nitrogen. Store until cell lysis at -80 C Cell Lysis Note: All steps and buffers should be cooled to 4 C unless otherwise stated. 18
19 15. Thaw cell pellets by completely resuspending 20 million cells in 1 ml Hypotonic Cell Lysis Buffer (add TCEP and PMSF fresh) in a 1.5 ml microcentrifuge tube. 16. Pellet cells by spinning at 3300 g for 7 minutes. Remove supernatant. 17. Gently resuspend swelled cells in 1 ml ice cold Cell Lysis Buffer pre-mixed with 0.1% NP-40. Incubate on ice for 10 minutes. 18. Transfer to an ice-cold glass dounce of appropriate size (e.g., 2 ml). Homogenize cell lysate by douncing Transfer cells back to a microcentrifuge tube and pellet nuclei by spinning at 3300 g for 7 minutes. Remove supernatant. 20. Resuspend nuclei in 1 ml of GuSCN Hybridization Buffer. 21. Sonicate using a Branson Sonifier fitted with a microtip using 10 Watts of power for 7 minutes in pulses (0.7 seconds on, 3.3 seconds off). Samples should be kept cold during sonication, for example by holding the sample in a 4 C chilling rack or ice bath. Depending on the length of sonication and the efficiency of the cooling strategy, longer breaks between sonication pulses may help to keep samples cool. 22. Add GuSCN Hybridization Buffer to bring total volume to 20 million cells in 4 ml. 23. Remove and save a 5 µl aliquot of lysate (pre-clear). 24. Clear lysate by spinning at maximum speed (16,000 g) for 10 minutes. 25. Remove and save a 5 µl aliquot of lysate (post-clear). 26. Flash-freeze aliquots of lysate in liquid nitrogen and store at -80 C. 27. Check RNA and DNA fragment sizes as above. 19
20 5.3 RAP-RNA with Psoralen (AMT) Crosslinking Cell Harvesting and Crosslinking 1. Grow adherent cells on 15-cm plates. Prepare plates for both crosslinked (+AMT) and mock-crosslinked (-AMT control) conditions. 2. Prepare 0.5 mg/ml AMT solution in PBS: Resuspend AMT in H 2 O at 1 mg/ml and then add an equal volume of 2 PBS. Chill solution in the dark on ice. 3. Remove media from cells. Rinse cells in plate with 10 ml room temperature PBS. Discard PBS. 4. Trypsinize and pellet cells, then wash once more with PBS. Spin and discard supernatant. 5. Resuspend cell pellet (~25 million cells) in 4 ml of ice-cold AMT solution (+AMT) or ice-cold PBS alone (-AMT control). Incubate the cells on ice for 15 minutes. 6. Transfer samples to a pre-chilled 10-cm tissue culture dish. 7. Place cells on ice under a long-wave UV bulb (350 nm) in a UV Stratalinker 2400 (Stratagene). Cells should be approximately 3-4 cm away from the light source. 8. Expose cells to UV light at maximum power for 7 minutes. Mix every 2 minutes. 9. Transfer irradiated cells to cold tubes and spin at 330 g for 4 minutes. Discard supernatant. 10. Isolate crosslinked RNA using TRIzol reagent (Life Technologies) according to manufacturer s protocol. Clean RNA with Zymo RNA Concentrator-25 column. 11. Quantify nucleic acid yields with a NanoDrop spectrophotometer. 12. Digest DNA: For each 8 µg of purified nucleic acid, set up a 50 µl reaction (5 µl 10 TURBO DNase Buffer, 2.5 µl TURBO DNase). Incubate at 37 C for 20 minutes. Clean with RNA Concentrator-5 column (Zymo), and elute in 36 µl H 2 O. 13. Measure RNA yield with a NanoDrop spectrophotometer. 14. Store at -80 C or proceed directly to fragmentation RNA Preparation and Fragmentation 15. Prepare 2 µg of input RNA per sample. 16. Fragment RNA to ~100 nucleotides: Start with 4 µg of RNA in 36 µl H 2 O. Add 4 µl 10 RNA Fragmentation Reagent (Ambion). Heat sample for precisely 3 minutes at 70 C and then transfer immediately to ice. 17. Clean the reaction with Zymo RNA Concentrator-5 column and elute in 20 µl H 2 O. 18. Store at -80 C or proceed directly to RAP-RNA [AMT]. 20
21 6 RNA Antisense Purification Goal: Purify target RNA with biotinylated probes. Perform the experiment in parallel for controls (e.g., other RNAs or non-crosslinked lysate). 6.1 RAP-DNA and RAP-RNA with Formaldehyde or Formaldehyde-DSG Crosslinking Lysate Preparation 1. Thaw lysate corresponding to 5 million cells for each sample (~1 ml). 2. Aliquot out 100 µl MyONE Streptavidin C1 magnetic beads (Invitrogen) for each purification from 5 million cells. 3. Wash beads twice in 0.5 original bead volume Hybridization Buffer, using a magnetic rack to capture beads and remove wash buffers each time. When separating magnetic beads from solution, place sample on magnet and wait 1-2 minutes before proceeding to allow beads to completely separate. 4. Resuspend beads in 0.25 bead volume Hybridization Buffer. Add beads to lysate (i.e., 25 µl concentrated beads to 1 ml of lysate containing 5 million cells). 5. Incubate at 37 C for minutes, shaking. 6. Magnetically separate and transfer supernatant (streptavidin-cleared lysate) to a clean tube. Repeat this step to completely remove beads. 7. Save 5 µl of pre-cleared lysate (0.5% total input) on ice as DNA input. 8. Re-warm lysate to 37 C, then proceed immediately to hybridization Hybridization, Capture, Wash 9. Prepare wash and elution buffers beforehand. Equilibrate solutions to the indicated temperatures before adding to samples. 10. Aliquot out 50 pmol of biotinylated ssdna probe for each purification from 5 million cells. 11. Denature probe in H 2 O at 85 C for 3 minutes and then transfer immediately to ice. 12. Add probe to lysate, mix, and immediately transfer to a 37 C Thermomixer. 13. Incubate at 37 C for 2-3 hours, shaking at 1,200 r.p.m. 14. Just before use, aliquot out 500 µl of Streptavidin C1 magnetic beads for each sample. Wash twice in 0.5 bead-volume GuSCN Hybridization Buffer, then resuspend in 0.25 bead-volume GuSCN Hybridization Buffer. Add beads to sample and incubate at 37 C for minutes, shaking. 15. Magnetically separate and then remove supernatant. Optional: When establishing and troubleshooting the assay, it may be useful to save the supernatant, treat with Proteinase K, and isolate RNA and/or DNA to examine (i) the integrity of the RNA at the end of the hybridization, (ii) the amount of target RNA/DNA remaining in the 21
22 supernatant after capture, and (iii) the amount of probe remaining in the supernatant after capture. 16. Resuspend beads in 1 original bead-volume (500 µl) GuSCN Wash Buffer, then incubate at 45 C for 3-10 minutes while washing other samples. Wash a total of 6 times. When removing final wash: place on magnet, remove liquid, spin down tube briefly, and remove the last drops of wash buffer with a fine tip. 17. Wash with 1 bead-volume RNase H Elution Buffer (add TCEP and detergents fresh). 18. Wash with 100 µl RNase H Elution Buffer (add TCEP and detergents fresh). Transfer samples to new tube before removing the final wash. 19. To elute, add 55 µl RNase Elution Buffer and 7.5 µl RNase H to each sample. 20. Incubate at 37 C for 30 minutes, shaking. 21. Remove and save eluate. 22. Add 62.5 µl GuSCN Hybridization Buffer and incubate at 37 C for 5 minutes, shaking. 23. Remove eluate and combine with previous eluate. 24. Magnetically separate the combined eluates once more and transfer to a new tube to remove any residual beads and attached ssdna probe. 25. Add NLS Digestion Buffer, 50 µl 5 M NaCl, and 12.5 µl Proteinase K to each sample and to the saved input sample. Proceed to DNA or RNA analysis section. Alternatively, divide sample for both RNA and DNA analysis RNA Elution and Analysis 26. Mix well, and incubate tubes for 1 hour at 65 C to digest protein and reverse formaldehyde crosslinks. 27. Clean and purify nucleic acids using SILANE beads: To each sample, add 40 µl SILANE beads rinsed and resuspended in 50 µl 5 M NaCl. Mix well. Add 1 100% isopropanol (550 µl). Mix well and wait 2 minutes. Place on magnet, and wash twice in 600 µl 70% ethanol. Dry for 10 minutes. Add 25 µl of H 2 O and resuspend beads, but do not remove from beads. Transfer to a PCR strip tube, and clean once more by adding 87.5 µl RLT and µl isopropanol. Wash twice in 70% ethanol and elute in 25 µl. 28. Proceed to quantitative real-time PCR (first digest residual genomic DNA and ssdna probes by treating with DNase I and Exonuclease I) or RNA sequencing (see below). When setting up the assay, we recommend measuring the captured RNA using quantitative real-time PCR to determine enrichment and yield of the target RNA. Primers should include one or more primer pairs for the target RNA as well as multiple primer pairs targeting other abundant RNAs (e.g., 18S rrna, U1 snrna). 29. RNA enrichments are typically in the range of 100-1,000-fold versus negative controls. RNA yields are typically in the range of 10-80%, depending on the target RNA. If low RNA (or DNA) enrichments are observed with high yield, one possible 22
23 reason is that crosslinked macromolecular complexes are too large due to overcrosslinking or insufficient sonication; try decreasing crosslinking or increasing sonication. If low RNA (or DNA) enrichments are observed with low yield, then there are multiple possibilities to consider. First, RNA may be degraded throughout the process, leading to poor capture; to address this, examine RNA integrity and yields at each intermediate step by RT-qPCR and/or visualization of RNA sizes with the Bioanalyzer. Second, the probe set may not properly capture the target RNA even with acceptable RNA integrity; to test this, use the same probe set to capture the target RNA in purified total RNA using the same protocol, and/or test the protocol in lysate using an abundant positive control RNA. 30. Calculate enrichment as the ratio of the amount of the target RNA in the target purification versus negative-control purification, normalized to the ratio of the signal of abundant RNAs in the target purification versus negative-control purification. Calculate yield as the ratio of the amount of the target RNA in the target purification versus the input, accounting for the fraction of input saved during the lysate preparation DNA Elution and Analysis 31. Mix well, and incubate tubes overnight at 60 C to digest protein and completely reverse formaldehyde crosslinks. 32. Place samples on ice. 33. Clean and purify nucleic acids using SILANE beads: To each sample, add 40 µl SILANE beads rinsed and resuspended in 50 µl 5 M NaCl. Mix well. Add 1 100% isopropanol (550 µl). Mix well and wait 2 minutes. Place on magnet, and wash twice in 600 µl 70% ethanol. Dry for 10 minutes. Add 25 µl of H 2 O and resuspend beads, but do not remove from beads. Transfer to a PCR strip tube, and clean once more by adding 87.5 µl RLT and µl isopropanol. Wash twice in 70% ethanol and elute in 25 µl. 34. In initial experiments, measure DNA yields and enrichments using quantitative PCR to validate that the experiment worked before moving immediately to DNA sequencing. Primers should include one or more primer pairs that measure genomic DNA close to but not overlapping the target gene locus; these regions should be strongly enriched (>100-fold) compared to input after normalizing to other locations in the genome. An appropriate negative control for this assay is comparing RAP with antisense probes to RAP with sense probes, which will capture DNA at the target locus but not RNA; the antisense probes should enrich more strongly for genomic DNA close to the target gene locus. Depending on the abundance of the target RNA, it may be necessary to use the entire DNA sample for qpcr, rather than saving some for DNA sequencing, to ensure that the DNA levels are high enough to meet the threshold for qpcr quantification. 35. Generate DNA sequencing libraries for high-throughput DNA sequencing (see below). For input sample(s), use 1/10 of the sample to avoid overloading the lowquantity DNA library preparation reaction. 23
24 36. Sequence the DNA libraries to generate ~20 million reads for the RAP samples and million reads for the input samples. Proper analysis of the data, including identification of RNA-chromatin interaction sites and calculation of enrichments across different regions of the genome, requires deep sequencing of the input library because DNA fragment density can vary substantially across the genome. 37. For suggestions regarding RAP-DNA interpretation and analysis, please refer to Engreitz et al. Science 2013 and Engreitz et al. Cell 2014, particularly regarding the appropriate controls to ensure that observed peaks are not due to off-target hybridization. 24
25 6.2 RAP-RNA with AMT Crosslinking or RAP-RNA from Purified Total RNA Hybridization, Capture, Wash, Elution 1. Prepare wash and elution buffers beforehand. Equilibrate solutions to the indicated temperatures before adding to samples. 2. Aliquot out 15 pmol of biotinylated ssdna probe for each purification from 2 µg of input RNA. 3. Denature probe in H 2 O at 85 C for 3 minutes and then transfer immediately to ice. 4. Mix probe and input RNA in 300 µl of preheated LiCl Hybridization Buffer and immediately transfer to a 55 C Thermomixer. 5. Incubate at 55 C for 2 hours, shaking at 1,200 r.p.m. 6. Just before use, aliquot out 200 µl of Streptavidin C1 magnetic beads for each sample. Wash twice in 0.5 bead-volume LiCl Hybridization Buffer, then resuspend in 0.25 bead-volume LiCl Hybridization Buffer. Add beads to sample and incubate at 37 C for minutes, shaking. 7. Magnetically separate and then remove supernatant. Optional: When establishing and troubleshooting the assay, it may be useful to save the supernatant and isolate RNA to examine (i) the integrity of the RNA at the end of the hybridization, (ii) the amount of target RNA remaining in the supernatant after capture, and (iii) the amount of probe remaining in the supernatant after capture. 8. Wash three times in Low Stringency Wash Buffer: Resuspend beads in 1.25 original bead-volume (250 µl) wash buffer, then incubate at 58 C for 3-10 minutes while washing other samples. 9. Wash three times in 1.25 original bead-volume (250 µl) High Stringency Wash Buffer at 58 C. When removing final wash: place on magnet, remove liquid, spin down tube briefly, and remove the last drops of wash buffer with a fine tip. 10. Wash with 1 bead-volume RNase H Elution Buffer (add TCEP and detergents fresh). 11. Wash with 100 µl RNase H Elution Buffer (add TCEP and detergents fresh). Transfer samples to new tube before removing the final wash. 12. To elute, add 21 µl RNase Elution Buffer and 4 µl RNase H to each sample. 13. Incubate at 37 C for 30 minutes, shaking. 14. Remove and save eluate. 15. Add 25 µl LiCl Hybridization Buffer and incubate at 37 C for 5 minutes, shaking. 16. Remove eluate and combine with previous eluate. 17. Magnetically separate the combined eluates once more and transfer to a new tube to remove any residual beads and attached ssdna probe. Place on ice. 18. Clean RNA with SILANE beads: Add 15 µl of beads resuspended in 150 µl RLT. Add 200 µl 100% ethanol. Bind for 2 minutes and remove supernatant. Wash twice 25
26 in 200 µl 70% ethanol. Dry beads for 6-10 minutes. Elute in 15 µl H 2 O and remove eluate from beads. 19. Proceed to RNA sequencing. 26
27 7 RAP-DNA Sequencing Library Preparation Goal: Prepare Illumina sequencing libraries from co-purified DNA. This protocol uses the NEBNext Ultra Library Prep Kit for Illumina and the NEBNext Multiplex Oligos for Illumina, with modifications we designed for making libraries from small amounts of short-fragment DNA. 1. Start with 12.5 µl of purified DNA in H 2 O in low-retention PCR strip tubes. 2. Add 2.5 µl of master mix containing 1.5 µl 10 NEBNext End Repair Reaction Buffer and 1 µl NEBNext End Prep Enzyme Mix. 3. Mix by pipet and incubate at 20 C for 30 minutes. 4. Add 1 µl of 160 mm NaCl (15 mm final concentration) and mix. 5. Incubate at 55 C for 30 minutes, then hold at 4 C. 6. To the end repair reaction, add 1 µl of a 1:10 dilution of NEBNext Adaptor for Illumina. Then add 4 µl of master mix containing 3.75 µl of Blunt/TA Ligase Master Mix and 0.25 µl NEBNext Ligation Enhancer. 7. Mix and incubate at 20 C for 45 minutes. 8. Add 1 µl of USER enzyme. Mix and incubate at 37 C for 15 minutes. 9. Add 19 µl H 2 O to 40 µl total volume. 10. Clean once using 0.7 volume (28 µl) SPRI beads. At end, add 40 µl H 2 O but do not remove from beads. 11. Clean again use 1 volume (40 µl) SPRI beads. At end, elute in 24 µl and remove 23 µl from the beads. 12. Set up PCR reaction: DNA 23 µl NEBNext Indexed PCR Primer (25 µm) 1 µl NEBNext Unversal PCR Primer (25 µm) 1 µl NEBNext High-Fidelity 2 Master Mix (NEB) 25 µl Total 50 µl 13. Run the following PCR program: Initial Denaturation 98 C 30 seconds 1 cycle Denaturation 98 C 10 seconds Annealing 67 C 30 seconds 4 cycles Extension 72 C 30 seconds Denaturation 98 C 10 seconds 4-10* cycles Annealing and Extension 72 C 30 seconds Final Extension 72 C 60 seconds 1 cycle Hold 4 C hold 27
28 *RAP samples usually require 10 cycles during this step, while inputs require between 4 and Clean once using 1 volume (50 µl) SPRI beads. At end, add 50 µl H 2 O but do not remove from beads. 15. Clean again use 1 volume (50 µl) SPRI beads. At end, elute in 13 µl H 2 O. 16. Measure library concentration with Qubit fluorometric quantitation. 17. Examine DNA fragment sizes using the High-Sensitivity DNA Bioanalyzer kit. 18. Pool multiple barcoded libraries and sequence with Illumina. 28
29 8 RAP-RNA Sequencing Library Preparation Goal: Prepare Illumina sequencing libraries from purified RNAs. This protocol is optimized for very low amounts of input RNA, and uses an adapter-ligation strategy in order to map locations of crosslinks (e.g., for the AMT protocol). This RNA-sequencing protocol also includes several steps that remove contaminating ssdna probes Primer and Adapter Sequences RiL-19 RNA adapter: /5Phos/rArGrArUrCrGrGrArArGrArGrCrGrUrCrGrUrG/3ddC/ 3Tr3 DNA adapter: /5Phos/AGATCGGAAGAGCACACGTCTG/3ddC/ 5Phos = 5 phosphate, 3ddC = 3 dideoxycytosine to block self-ligation AR17 primer for reverse transcription: ACACGACGCTCTTCCGA Universal PCR primer: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT Barcoded PCR primer (example 8-mer barcode in red Illumina indexing read will contain the reverse complement of this sequence): CAAGCAGAAGACGGCATACGAGATCCTGGTAGGTGACTGGAGTTCAGACGTGTGCT CTTCCGATCT DNase Digestion and RNA Preparation 19. Start with 31 µl of purified RNA in H 2 O in low-retention PCR strip tubes. 20. Add 19 µl of a master mix containing: 5 FNK Buffer 10 µl Murine RNase Inhibitor 1 µl FastAP Thermosensitive Alkaline Phosphatase 3 µl T4 Polynucleotide Kinase 3 µl TURBO DNase 1 µl Exonuclease I 1 µl Total 19 µl 21. Mix well and incubate at 37 C for 30 minutes. 22. Clean up with 15 µl SILANE beads, 3 volume RLT, and 1 volume ethanol. Elute in 6 µl H 2 O First Ligation 23. Add 20 pmol (0.5 µl of 40 µm) RNA adapter RiL-19 to each sample. 24. Denature at 70 C for 2 minutes and then transfer immediately to ice. 25. Add 13.6 µl of ligation master mix: 10 NEB Ligase 1 Buffer 2 µl 29
30 DMSO (100%) 1.8 µl ATP (100 mm) 0.2 µl PEG 8000 (50%) 8 µl Murine RNase Inhibitor 0.3 µl T4 RNA Ligase 1 (30 U / µl) 1.3 µl Total 13.6 µl 26. Close cap and mix by shaking vigorously and spinning down tubes many times. 27. Incubate at room temperature for 1.5 hours. 28. Clean RNA: Add 15 µl SILANE beads in 61 µl RLT. Mix well. Add 65 µl 100% ethanol. Mix well and wait 2 minutes. Wash twice by resuspending beads in 70% ethanol. Dry for 5-10 minutes. Elute in 14.3 µl H 2 O Reverse Transcription First Strand cdna 1. To each sample, add 10 pmol (0.5 µl of 20 µm stock) AR17 primer. 2. Denature at 70 C for 2 minutes and then immediately transfer to ice. 3. Add 6 µl of reverse transcription master mix: 10 AffinityScript RT Buffer 2 µl 100 mm DTT 2 µl 100 mm dntps (25 mm each) 0.8 µl Murine RNase Inhibitor 0.4 µl AffinityScript Reverse Transcriptase Enzyme 0.8 µl Total 6 µl 4. Quickly mix by pipet and transfer to a preheated 55 C incubator. 5. Incubate at 55 C for 5 minutes, 54 C for 50 minutes, then 4 C for 1 minute. 6. Immediately remove samples from thermal cycler. 7. Digest excess RT primers by adding 3 µl of ExoSAP-IT. Mix and incubate at 37 C for 12 minutes Probe Removal 8. Take 20 µl of Streptavidin C1 magnetic beads per sample. Wash in 1 C1 Binding Buffer (10 mm Tris ph 7.5, 250 mm LiCl, 20 mm EDTA, 0.1% Triton X-100). Aliquot out beads into an empty strip tube, place on magnet, then remove supernatant. 9. Add 2.5 µl of 10 C1 Binding Buffer to each sample, then transfer the samples to the washed beads and mix. 10. Incubate at 60 C for 15 minutes in a thermal mixer, shaking at 1,200 r.p.m. 11. Place samples on magnet; remove and keep supernatant. Discard beads with captured probes Second Ligation 30
31 12. Degrade RNA by adding 2.55 µl 1 M NaOH to each sample (100 mm final concentration). 13. Incubate at 70 C for 10 minutes. 14. Place samples on ice and neutralize solution by adding 2.55 µl 1 M acetic acid. 15. Clean up RNA using 12 µl of SILANE beads with 75 µl RLT and 65 µl 100% ethanol. At end, resuspend beads in 5.5 µl H 2 O but do not remove sample from beads. 16. Add 40 pmol (0.5 µl of 80 µm stock) 3Tr3 DNA adapter to each sample containing cdna and SILANE beads. 17. Denature at 75 C for 2 minutes and then transfer immediately to ice. 18. Add 14.1 µl of ligation master mix: 10 NEB Ligase 1 Buffer 2 µl DMSO (100%) 0.8 µl ATP (100 mm) 0.2 µl PEG 8000 (50%) 9.5 µl T4 RNA Ligase 1 (30 U / µl) 1.6 µl Total 14.1 µl 19. Close cap and mix by shaking vigorously and spinning down tubes many times. 20. Incubate at room temperature overnight. Mix by shaking several times during this period. 21. Clean up sample by adding 5 µl more of SILANE beads in 61 µl RLT, then adding 55 µl 100% ethanol. Wash twice and elute in 25 µl H 2 O PCR Enrichment 22. Set up PCR reaction: cdna 21 µl Barcoded PCR primer (25 µm) 2 µl Universal PCR primer (25 µm) 2 µl NEBNext High-Fidelity 2 Master Mix (NEB) 25 µl Total 50 µl 23. Run the following PCR program: Initial Denaturation 98 C 30 seconds 1 cycle Denaturation 98 C 10 seconds Annealing 67 C 30 seconds 4 cycles Extension 72 C 30 seconds Denaturation 98 C 10 seconds 4-10* cycles Annealing and Extension 72 C 30 seconds Final Extension 72 C 60 seconds 1 cycle 31
32 Hold 4 C hold *RAP samples usually require 10 cycles during this step, while inputs require between 4 and Clean once using 1.2 volume (60 µl) SPRI beads. At end, add 40 µl H 2 O but do not remove from beads. 25. Clean again use 1.1 volume (50 µl) SPRI beads. At end, elute in 24 µl and remove 23 µl from the beads. 26. Measure library concentration with Qubit fluorometric quantitation. 27. Examine DNA fragment sizes using the High-Sensitivity DNA Bioanalyzer kit. 28. Pool multiple barcoded libraries and sequence with Illumina. 32
Chromatin Immunoprecipitation (ChIP)
Chromatin Immunoprecipitation (ChIP) Day 1 A) DNA shearing 1. Samples Dissect tissue (One Mouse OBs) of interest and transfer to an eppendorf containing 0.5 ml of dissecting media (on ice) or PBS but without
Application Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
Chromatin Immunoprecipitation
Chromatin Immunoprecipitation A) Prepare a yeast culture (see the Galactose Induction Protocol for details). 1) Start a small culture (e.g. 2 ml) in YEPD or selective media from a single colony. 2) Spin
How To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent
SPARK DNA Sample Prep Kit Ion Torrent (SPK0002-V08) Frequently Asked Questions Under what circumstances would I use SPARK DNA Sample Prep Kit for Ion Torrent? Enzymatics SPARK DNA Sample Prep Kit for Ion
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
FOR REFERENCE PURPOSES
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual
Toll Free: 866-252-7771 752A Lincoln Blvd. Phone: 732-469-7771 Fax: 732-469-7782 Middlesex, NJ 08846 Web: www.purebiotechllc.com SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual Product: SOLIDscript
Classic Immunoprecipitation
292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.
TECHNICAL BULLETIN. HIS-Select Nickel Affinity Gel. Catalog Number P6611 Storage Temperature 2 8 C
HIS-Select Nickel Affinity Gel Catalog Number P6611 Storage Temperature 2 8 C TECHNICAL BULLETIN Product Description HIS-Select Nickel Affinity Gel is an immobilized metalion affinity chromatography (IMAC)
ab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.
QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and
RNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr)
RNA Extraction and Quantification, Reverse Transcription, and Real-time Preparation of Samples Cells: o Remove media and wash cells 2X with cold PBS. (2 ml for 6 well plate or 3 ml for 6cm plate) Keep
RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl
Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl
User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas
ExpressArt Bacterial H-TR cdna synthesis kit With extreme selectivity against rrnas suitable for 2 to 4 µg total RNA Catalogue No. 8004-A30 (30 rxns) Reagents Materials are provided for 30 cdna synthesis
Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280.
Technical Bulletin Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280. PRINTED IN USA. Revised 4/06 AF9TB141 0406TB141 Wizard DNA Clean-Up System All technical literature is available on
Genomic DNA Extraction Kit INSTRUCTION MANUAL
Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
Procedure for RNA isolation from human muscle or fat
Procedure for RNA isolation from human muscle or fat Reagents, all Rnase free: 20% SDS DEPC-H2O Rnase ZAP 75% EtOH Trizol Chloroform Isopropanol 0.8M NaCitrate/1.2M NaCl TE buffer, ph 7.0 1. Homogenizer-probe
Dynabeads mrna DIRECT Micro Kit
USER GUIDE Dynabeads mrna DIRECT Micro Kit Catalog Number 61021 Revision 004 Revision Date 14 May 2012 For Research Use Only. Not for human or animal therapeutic or diagnostic use. For Research Use Only.
Plant Genomic DNA Extraction using CTAB
Plant Genomic DNA Extraction using CTAB Introduction The search for a more efficient means of extracting DNA of both higher quality and yield has lead to the development of a variety of protocols, however
How To Make A Tri Reagent
TRI Reagent For processing tissues, cells cultured in monolayer or cell pellets Catalog Number T9424 Store at room temperature. TECHNICAL BULLETIN Product Description TRI Reagent is a quick and convenient
AffinityScript QPCR cdna Synthesis Kit
AffinityScript QPCR cdna Synthesis Kit INSTRUCTION MANUAL Catalog #600559 Revision C.01 For In Vitro Use Only 600559-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this
NimbleGen DNA Methylation Microarrays and Services
NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the
ChIP-IT High Sensitivity
ChIP-IT High Sensitivity (version A4) Catalog No. 53040 Active Motif North America 1914 Palomar Oaks Way, Suite 150 Carlsbad, California 92008, USA Toll free: 877 222 9543 Telephone: 760 431 1263 Fax:
AxyPrep TM Mag PCR Clean-up Protocol
AxyPrep TM Mag PCR Clean-up Protocol Intro The AxyPrep Mag PCR Clean-up kit utilizes a unique paramagnetic bead technology for rapid, high-throughput purification of PCR amplicons. Using this kit, PCR
How To Write An Ipa
LIBRARY PREPARATION NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) Instruction Manual NEB #E7300S/L 24/96 reactions Sign up for the NEBNext e-newsletter Scan this code or visit www.neb.com/
TruSeq DNA Methylation Library Preparation Guide
TruSeq DNA Methylation Library Preparation Guide Kit Contents 3 Consumables and Equipment 4 Preparation 5 Quality Control of Bisulfite-Converted DNA 6 TruSeq DNA Methylation Kit Protocol 7 Sequencing the
Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
Kevin Bogart and Justen Andrews. Extraction of Total RNA from Drosophila. CGB Technical Report 2006-10 doi:10.2506/cgbtr-200610
Kevin Bogart and Justen Andrews Extraction of Total RNA from Drosophila CGB Technical Report 2006-10 doi:10.2506/cgbtr-200610 Bogart K and Andrews J. 2006. Extraction of Total RNA from Drosophila. CGB
How To Shear Chromatin
truchip Low Cell Chromatin Shearing Kit with Non-ionic Shearing Buffer Part Number: 010144 Rev C 1 Page INTRODUCTION The truchip Low Cell Chromatin Shearing Kit with Non-ionic Shearing Buffer (PN 520084)
HighPure Maxi Plasmid Kit
HighPure Maxi Plasmid Kit For purification of high pure plasmid DNA with high yields www.tiangen.com PP120109 HighPure Maxi Plasmid Kit Kit Contents Storage Cat.no. DP116 Contents RNaseA (100 mg/ml) Buffer
In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab)
In vitro analysis of pri-mirna processing by Drosha-DGCR8 complex (Narry Kim s lab) 1-1. Preparation of radiolabeled pri-mirna transcript The RNA substrate for a cropping reaction can be prepared by in
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
1) Vector Preparation sg 1371 w/blp1 Ef1α puro t29 BFP (602 ng/ul)
1) Vector Preparation sg 1371 w/blp1 Ef1α puro t29 BFP (602 ng/ul) a) Digest 5 ug of vector with Thermo Scientific FastDigest BstX1 and Blp1 for 1h at 37ºC. Set up reaction as follows: 100 ul Reaction
Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform
Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 2 Sample Prep Workflow, 3 Best Practices, 4 DNA Input Recommendations, 6
Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus
Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus Introduction Protein extraction from tissues and cultured cells is the first step for many biochemical and analytical
Amplicon Template Preparation and Sequencing
Please note: the shared protocols described herein may not have been validated by Pacific Biosciences and are provided as-is and without any warranty. Use of these protocols is offered to those customers
GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps)
1 GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps) (FOR RESEARCH ONLY) Sample : Expected Yield : Endotoxin: Format : Operation Time : Elution Volume : 50-400 ml of cultured bacterial
PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System)
UltraClean PCR Clean-Up Kit
UltraClean PCR Clean-Up Kit Catalog No. Quantity 12500-50 50 Preps 12500-100 100 Preps 12500-250 250 Preps Instruction Manual Please recycle Version: 02212013 1 Table of Contents Introduction... 3 Protocol
ncounter Gene Expression Assay Manual Total RNA and Cell Lysate Protocols
ncounter Gene Expression Assay Manual Total RNA and Cell Lysate Protocols v.20090807 For research use only. Not for use in diagnostic procedures. Limited License Subject to the terms and conditions of
TIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
CompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
RT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
Contents. XI. Materials and Equipment Needed But Not Provided 5. DNA Extraction from Small Amount of Tissue 10
Contents I. Overview 1 II. Kit Components 1 III. Storage 2 IV. Intended Use 2 V. Safety Warnings and Precautions 2 VI. Warranty and Liability 2 VII. Technical Assistance 3 VIII. Quality Management 3 IX.
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
Agencourt RNAdvance Blood Kit for Free Circulating DNA and mirna/rna Isolation from 200-300μL of Plasma and Serum
SUPPLEMENTAL PROTOCOL WHITE PAPER Agencourt RNAdvance Blood Kit for Free Circulating DNA and mirna/rna Isolation from 200-300μL of Plasma and Serum Bee Na Lee, Ph.D., Beckman Coulter Life Sciences Process
ChIP TROUBLESHOOTING TIPS
ChIP TROUBLESHOOTING TIPS Creative Diagnostics Abstract ChIP dissects the spatial and temporal dynamics of the interactions between chromatin and its associated factors CD Creative Diagnostics info@creative-
PowerFecal DNA Isolation Kit
PowerFecal DNA Isolation Kit Catalog No. Quantity 12830-50 50 Preps Instruction Manual Inhibitor Removal Technology (IRT) is a registered trademark of MO BIO Laboratories, Inc. and is covered by the following
Aurora Forensic Sample Clean-up Protocol
Aurora Forensic Sample Clean-up Protocol 106-0008-BA-D 2015 Boreal Genomics, Inc. All rights reserved. All trademarks are property of their owners. http://www.borealgenomics.com [email protected]
RNeasy MinElute Cleanup Handbook
Second Edition December October 2010 2005 RNeasy MinElute Cleanup Handbook For RNA cleanup and concentration with small elution volumes Sample & Assay Technologies QIAGEN Sample and Assay Technologies
50 g 650 L. *Average yields will vary depending upon a number of factors including type of phage, growth conditions used and developmental stage.
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] Phage DNA Isolation Kit Product # 46800, 46850 Product Insert
Updated: July 2005. 5' End label RNA markers 18.113 (18mer) and 44.12 (24mer) with Kinase and 32P-gamma-ATP. Gel purify labeled markers.
RNA Cloning Method Flowchart Extract total RNA containing small RNAs. Check quality on denaturing gel with EtBr staining 5' End label RNA markers 18.113 (18mer) and 44.12 (24mer) with Kinase and 32P-gamma-ATP.
The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade plasmid DNA.
INSTRUCTION MANUAL ZymoPURE Plasmid Gigaprep Kit Catalog Nos. D4204 (Patent Pending) Highlights The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade
RNA Fragment DeepSeq Library Preparation Protocol
RNA Fragment DeepSeq Library Preparation Protocol I) LIGATION Recommended input: RNA between 0.05-2 pmol; must have 3' OH 1. Thaw 10X T4 RNA Ligase Reaction Buffer, 50% PEG8000, 20 mm DTT, 7 um App Adaptor
Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity
Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity Today you analyze the results of your bacterial transformation from last week and determine the efficiency
TRI Reagent Solution. A. Product Description. RNA / DNA / Protein Isolation Reagent Part Number AM9738 100 ml
TRI Reagent Solution RNA / DNA / Protein Isolation Reagent Part Number AM9738 100 ml A. Product Description TRI Reagent * solution is a complete and ready-to-use reagent for the isolation of total RNA
Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products
Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B
HiPer Total RNA Extraction Teaching Kit
HiPer Total RNA Extraction Teaching Kit Product Code: HTBM012 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1 hour Agarose Gel Electrophoresis: 1 hour Storage Instructions:
DNA Isolation Kit for Cells and Tissues
DNA Isolation Kit for Cells and Tissues for 10 isolations of 00 mg each for tissue or 5 x 10 7 cultured cells Cat. No. 11 81 770 001 Principle Starting material Application Time required Results Benefits
Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation
BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.
Protein Precipitation Protocols
Protein Precipitation Protocols Notes: All reagents need to high purity/hplc quality. All tubes used should be new or hand cleaned thoroughly with Micro90 detergent. High quality water needs to be used
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination
Important Note. September 2011
September 2011 Important Note Dear PAXgene Tissue mirna Kit user, When working with PAXgene Tissue treated samples of fibrous tissue (e.g., skin, heart or skeletal muscle, aorta), we recommend to extend
UltraClean Soil DNA Isolation Kit
PAGE 1 UltraClean Soil DNA Isolation Kit Catalog # 12800-50 50 preps New improved PCR inhibitor removal solution (IRS) included Instruction Manual (New Alternative Protocol maximizes yields) Introduction
QIAGEN Supplementary Protocol
QIAGEN Supplementary Protocol Isolation of Peripheral Blood Mononuclear Cells (PBMC) and Purification of Total RNA from PBMC Using the RNeasy Micro or Mini Kit This protocol describes how to isolate PBMC
RealLine HCV PCR Qualitative - Uni-Format
Instructions for use PCR KIT FOR EXTRACTION OF RNA AND REAL TIME PCR DETECTION KIT FOR HEPATITIS C VIRUS RNA Research Use Only Qualitative Uni Format VBD0798 48 tests valid from: December 2013 Rev11122013
TransformAid Bacterial Transformation Kit
Home Contacts Order Catalog Support Search Alphabetical Index Numerical Index Restriction Endonucleases Modifying Enzymes PCR Kits Markers Nucleic Acids Nucleotides & Oligonucleotides Media Transfection
MagExtractor -Genome-
Instruction manual MagExtractor-Genome-0810 F0981K MagExtractor -Genome- NPK-101 100 preparations Store at 4 C Contents [1] Introduction [2] Components [3] Materials required [4] Protocol 1. Purification
Quantitative Real Time PCR Protocol. Stack Lab
Quantitative Real Time PCR Protocol Stack Lab Overview Real-time quantitative polymerase chain reaction (qpcr) differs from regular PCR by including in the reaction fluorescent reporter molecules that
How To Get Rid Of Small Dna Fragments
AxyPrep TM Mag FragmentSelect-I Protocol (Fragment Size Selection for Illumina Genome Analyzer and Life Technologies SoLiD) Introduction The AxyPrep Mag FragmentSelect-I purification kit utilizes a unique
Hepatitis B Virus Genemer Mix
Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For
Troubleshooting Sequencing Data
Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page
Automation in Genomics High-throughput purification of nucleic acids from biological samples. Valentina Gualdi Operational Scientist PGP
Automation in Genomics High-throughput purification of nucleic acids from biological samples Valentina Gualdi Operational Scientist PGP OVERVIEW Nucleic acid purification technologies general aspects Genomic
Protocol 001298v001 Page 1 of 1 AGENCOURT RNACLEAN XP IN VITRO PRODUCED RNA AND CDNA PURIFICATION
Page 1 of 1 AGENCOURT RNACLEAN XP IN VITRO PRODUCED RNA AND CDNA PURIFICATION Please refer to http://www.agencourt.com/technical for updated protocols and refer to MSDS instructions when handling or shipping
NimbleGen SeqCap EZ Library SR User s Guide Version 3.0
NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 For life science research only. Not for use in diagnostic procedures. Copyright 2011 Roche NimbleGen, Inc. All Rights Reserved. Editions Version
Real-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
BUFFERS and MEDIAS Coomassie Blue Staining Solution Coomassie blue Destaining Solution DMEM Normal Cell Culture Media
BUFFERS and MEDIAS Coomassie Blue Staining Solution 2 g Coomassie Blue 2 L Methanol or Ethanol * 1.6 L 400 ml Glacial acetic acid *If you will be microwaving the gel in staining solution for rapid staining
Register your instrument! www.eppendorf.com/myeppendorf. MagSep Viral DNA/RNA Kit. Instructions for use
DNA/RNA r use Kit ns N) for use Register your instrument! www.eppendorf.com/myeppendorf Instructions for use Copyright 2014 Eppendorf AG, Hamburg. All rights reserved, including graphics and images. No
ISOLATE II PCR and Gel Kit. Product Manual
ISOLATE II PCR and Gel Kit Product Manual 2 Product Manual www.bioline.com/isolate PCR and Gel Kit ISOLATE II PCR and Gel Kit ISOLATE II PCR and Gel Kit 1 Kit contents 04 2 Description 04 3 Storage 04
Recommended Procedures for the Extraction of RNA. Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010
Recommended Procedures for the Extraction of RNA Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010 RNA Extraction Isolates RNA from other cellular components in the
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
U.S. Patent No. 9,051,563 and other pending patents. Ver. 1.1.3
INSTRUCTION MANUAL Direct-zol RNA MiniPrep Catalog Nos. R050, R05, R05, & R053 Highlights Quick, spin column purification of high-quality (DNA-free) total RNA directly from TRIzol, TRI Reagent and other
Arcturus PicoPure RNA Isolation Kit. User Guide
Arcturus PicoPure RNA Isolation Kit User Guide For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.
Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform
Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 3 Sample Prep Workflow, 4 Best Practices, 5 DNA Input Recommendations,
PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,
Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic
All-in-One First-Strand cdna Synthesis Kit
All-in-One First-Strand cdna Synthesis Kit For reliable first-strand cdna synthesis from all RNA sources Cat. No. AORT-0020 (20 synthesis reactions) Cat. No. AORT-0050 (50 synthesis reactions) User Manual
RealStar HBV PCR Kit 1.0 11/2012
RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 For research use only! (RUO) Product No.: 201003 96 rxns INS-201000-GB-02 Store at -25 C... -15 C November 2012 altona Diagnostics GmbH Mörkenstraße
Global MicroRNA Amplification Kit
Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in
RIBOPROTECT. RNase Inhibitor RT33-020, RT33-100
RIBOPROTECT RT33-020, RT33-100 RT33-020, RT33-100 RIBOPROTECT The RIBOPROTECT is a recombinant protein isolated and purified from Escherichia coli. It inhibits ribonuclease (RNase) activity of enzymes
PreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
DP419 RNAsimple Total RNA Kit. RNAprep pure Series. DP501 mircute mirna Isolation Kit. DP438 MagGene Viral DNA / RNA Kit. DP405 TRNzol Reagent
Overview of TIANGEN Products DP419 RNAsimple Total RNA Kit DP430 RNAprep pure Kit(For Cell/Bacteria) DP315/DP315-R TIANamp Virus DNA/RNA Kit DP431 RNAprep pure Kit (For Tissue) Silica-membrane Technology
Stratagene QPCR Mouse Reference Total RNA
Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits
Protocol for Western Blotting
Protocol for Western Blotting Materials Materials used on Day 3 Protease inhibitor stock: 1 μg/μl pepstatin A in DMSO 200 μm leupeptin in OG Buffer 200 mm PMSF: Freshly made. Ex) 34.8 mg PMSF in 1 ml isopropanol
INSTRUCTION Probemaker
INSTRUCTION Probemaker Instructions for Duolink In Situ Probemaker PLUS (Art. no. 92009-0020) and Duolink In Situ Probemaker MINUS (Art. no. 92010-0020) Table of content 1. Introduction 4 2. Applications
MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA
Plasmid DNA Preparation MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA Introduction: I have always used the classic Alkaline Lysis miniprep method to isolate plasmid DNA. (See below) If
MinElute Handbook. Sample & Assay Technologies. March 2008
March 2008 MinElute Handbook MinElute PCR Purification Kit For purification of PCR products (70 bp to 4 kb) in low elution volumes MinElute Gel Extraction Kit For gel extraction of DNA fragments (70 bp
