Analyzing RNA-seq Data and Synthesizing cdna From Total RNA Dr. Ray Enke Bio 480 Advanced Molecular Bio Lab James Madison University
|
|
- Mabel Weaver
- 7 years ago
- Views:
Transcription
1 Analyzing RNA-seq Data and Synthesizing cdna From Total RNA Dr. Ray Enke Bio 480 Advanced Molecular Bio Lab James Madison University *Gloves required; be mindful of RNases; use pre-pcr pipettes Over the next few weeks we will computationally analyze a transcriptome-wide gene expression experiment and then design follow up gene-specific experiments to gain additional information about gene expression in the developing chicken retina. Today we will analyze an RNA-seq data set from an experiment that my lab conducted this past summer identifying all of the differentially expressed mrnas isolated from embryonic day 8 (E8) chicken retina and E18 chicken retina. The chicken retina looks dramatically different at these two embryonic stages: The mrna-seq experiment identified 1,077 genes up-regulated and 1,416 genes down-regulated in E18 retina compared to E8 retina (see data spreadsheet). During this lab activity you will sort through these genes and pick out a collection of selected candidate genes for in class validation using quantitative reverse transcriptase PCR (qrt-pcr). I. 1 st strand cdna synthesis from chicken total RNA We will use the Bio-Rad iscript 1 st strand synthesis kit to make cdnas from total RNA extracted from embryonic chick retina. *Please use carful pipetting, these reagents are very expensive! Reverse transcriptase (RT) is an enzyme encoded by retroviruses (such as HIV and Cauliflower Mosaic Virus). It has the unique activity of synthesizing DNA from an RNA template. This enzyme activity has been co-opted by researchers as a way to convert unstable RNAs to a more stable DNA copy for subsequent study. Today you will convert chicken mrnas to cdna copies using RT. We will use these cdnas in subsequent labs to assay the abundance of specific mrnas during retinal development. Use the following embryonic chicken RNAs to set up cdna reactions in a labeled PCR strip tube. All RNAs are set to 6.7 ng/ul in strip tubes labeled chick RNA. Add 100 ng of each total RNA (15 ul) to a new strip tube labeled cdna, group# on the side and #1-8 on the top. Here s the RNA you re pipetting into each cdna tube:
2 Sample # embryo age tissue ng/ul for 100 ng 1 E8 retina E10 retina E12 retina E14 retina E16 retina E18 retina E18 brain E18 retina (no RT control) Samples #1-7 will contain RT enzyme and a 5X enzyme buffer containing dntps and a mix of 2 different primers used to start the RT reaction: 1. Poly T primer: anneals to all mrnas specifically (via poly A tails) 2. Random hexamer (NNNNNN; any combo of 6 nucleotides); anneals randomly to all transcripts Here s the RT reaction master mix: per reaction ingredient X8 4 ul 5X buffer 32 ul 1 ul RT 8 ul Add 5 ul of RT mix to 15 ul RNA in tubes #1-7 and keep on ice. Sample #8 will be a no RT control. This reaction will have all of the RNA template, primers, buffer, dntps without the RT enzyme. This will serve as an important control for subsequent cdna quantitative PCR to ensure that trace amounts of contaminating DNA are not being amplified by your cdna-specific primers. Here s the no RT mix: per reaction ingredient 4 ul 5X buffer 1 ul H2O Add 5 ul of no RT mix to 15 ul E18 retina RNA in tube #8 and keep on ice. Using the PCR thermocycler, run the reaction through the following temperatures ( iscript cdna program): 1. 5 min at 25C (primer annealing) min at 42C (RT synthesis) 3. 5 min at 85C (heat denaturation of RT enzyme) 4. Hold at 4C (cdna storage) cdnas can be stored long term at -20C. The synthesized cdnas are a collection of sequences complimentary to all of the mrnas present in the total RNA extracted from each tissue. In subsequent labs we will use 2 ul of each cdna reaction for quantitative gene-specific PCR (qpcr) of interesting candidate genes.
3 II. Analyzing Illumina RNA-seq data This training module will use the following web resources: 1. Ensemble BioMart: 2. UCSC genome browser: A very good online tutorial for the browser can be found at The mrna-seq experiment identified 1,077 genes up-regulated and 1,416 genes down-regulated in E18 retina compared to E8 retina. During this lab activity you will computationally sort through these genes and select a collection of candidate genes for in class validation using quantitative reverse transcriptase PCR (qrt-pcr). Open the RNA-Seq Excel spreadsheet to visualize the list of 1,077 genes up-regulated and 1,416 genes down-regulated in E18 retina compared to E8 retina. The 3 rd tab genes to validate should be empty except for the column headings. You will populate this tab with candidate genes that you identify. Spreadsheet columns list the following information: Gene ID: gene identifier # Gene: gene name abbreviation Locus: chromosome and genome coordinates E8 retina FPKM: fragments/kb of exon/million fragments for each gene in E8 E18 retina FPKM: fragments/kb of exon/million fragments for each gene in E18 Log2 fold change E8:E18 fold change of E8/E18 FPKM (2 fold increase=1; 2 fold decrease= - 1; no change = 0) P-value: probability of observed expression change being false positives Significant: Indicates if the p-value <0.05; this means there is a 5% chance or less of false positive Part A: Assigning full gene names and Gene Ontology or GO Terms Genes are listed in descending order from most up-regulated in the E18 upregulated tab and most down-regulated in the E18 downregulated tab (based on log2 fold change). Column B lists the abbreviation of the associated gene name. To pick interesting candidate genes out of the list, we need to get some additional information about each of them. A gene ontology or GO term is a short descriptor of a gene product s function. We will use a database called Ensemble BioMart to assign each gene some GO terms and it s full gene name in order to pick out some interesting ones from the list. Navigate to Ensemble BioMart ( Choose database>>>ensemble genes>>>choose dataset>>>gallus gallus genes (Galgal4) Filters>>>Gene>>>check input external references ID list >>>select Associated gene names from dropdown These commands tell the database that we are going to filter a list of gene name abbreviations through the annotated chicken genome (Gallus gallus). In the RNA-seq spreadsheet, copy the entire column B of the upregulated genes tab paste the gene abbreviations into the BioMart search window.
4 The next set of commands will tell the database what information we want back from our gene abbreviation search: Attributes>>>gene Check only the following boxes under Gene: Description, Associate gene name Check only the following box under External: GO Term name Select Results>>> for Export results to select File>>>XLS>>>check Unique results only>>>go You now have a new spreadsheet with the full gene name and GO terms for each of the up-regulated E18 retina genes (Note: genes with multiple associated GO terms are repeated in multiple rows. Many genes will have multiple rows depending on how many processes they are associated with). Move the GO spreadsheet into the RNA-seq data spreadsheet: Right click the spreadsheet tab in the GO file and select Move or Copy Highlight the tab you want to move and select the RNA-seq Excel file under Move selected sheets to book option Rename this tab upregulated GO Repeat this process for the list of downregulated genes creating a 5 th tab in your spreadsheet downregulated GO Use your modified spreadsheet to search for keywords of interest in the GO tabs (ie full gene names like Rhodopsin or processes such as phototransduction). My lab is interested in 2 aspects of retinal development, 1) the Notch transcription factor signaling pathway and 2) the phototransduction signaling pathway. One of these pathways should be upregulated in E18 retina and one should be downregulated. Do a bit of research and make a hypothesis for genes specific to each pathway in E8 vs E18 retina. Find all up and down regulated genes associated with these 2 pathways by keyword searching the GO tabs of your spreadsheets: Control F in Excel>>>enter search term>>>find next For phototransduction genes search the terms phototransduction, rod, cone, photoreceptor, and visual perception For Notch genes simply search for notch Remember that 1 pathway is upregulated in E18 and the other is downregulated in E18, make sure you are pulling information from the correct list of genes. For each individual gene of interest that you find in the GO tab: search for the same gene in the RNA-seq data by their Gene name abbreviation transfer (copy/paste) the gene expression data for your candidate genes to the genes to validate tab of your spreadsheet include the full gene name and 1-2 relevant GO terms in the indicated columns W will use these candidate genes that you identify in this tab to design qpcr primers to experimentally validate the RNA-seq expression data.
5 Part B. Obtaining Sequence information from the UCSC Genome Browser Next you will use the UCSC Genome Browser to obtain genomic DNA and mrna sequences for your genes of interest. I will use the chicken Rhodopsin (Rho) gene as an example for how to obtain sequence info from the browser. Instructor note: View the Open Helix video tutorials to learn the basic features of the USCS Genome Browser Navigate to the UCSC Genome Browser homepage: Select Genomes In the pull down menus select Group>>>vertebrate; genome>>>chicken; assembly>>>2011; enter Rhodopsin as the search term>>>submit Select Rho at chr12 from the result page to access the genome browser view This takes you to a view of the entire Rhodopsin gene on the chicken chromosome 12 with multiple other annotation tracks showing data corresponding to this genetic locus. For simplicity, we will first deselect all tracks to start from scratch and adjust some of the display options. Directly under the viewer select the hide all option to hide all tracks Under genes and gene predictions select the RefSeq Genes option with full display Select Refresh Select the configure button below the genome viewer window to change the following display settings Change the text size to 12 (will make all features larger) Uncheck the Show light blue vertical guidelines box (to remove vertical guidelines) Cold Spring Harbor Laboratory, DNA Learning Center, 1 Bungtown Road, Cold Spring Harbor, NY
6 Hit submit to see your reformatted genome viewer window The Rho gene with annotated exons (blue bars) and introns (arrowed lines) is now displayed in the viewer with corresponding genome coordinates. Note: alternatively, Ensembl or Genescan gene displays can be selected if there is no RefSeq annotation for your gene of interest. The direction of the arrowed line indicates which strand the gene is encoded on. Arrows pointing to the right indicate the gene is coded 5 to 3 on the top strand (left to right in this view), arrows pointing to the left indicate the gene is coded 5 to 3 on the bottom strand (right to left in this view). Rho is coded on the top strand with exon 1 on the far left. Rho has 5 exons and 4 introns. Obtaining DNA and mrna sequence information: To obtain sequence information from a gene or a genetic region, click on the gene name on the left side of the viewer (eg Rho ). This brings you to a page index where you can access more info about your gene. Under the Links to sequence heading you have options to view the genomic DNA, mrna, or protein sequence for this region. We will collect gdna and mrna sequences for Rhodopsin. Select the Genomic sequence link 1 st to go to a sequence formatting page. Get the Rho sequence with the following formatting options and paste it into a Word file: 5 UTRs, CDC exons, 3 UTRs, introns One FASTA record per gene Exons in upper case, everything else in lower case Submit
7 This outputs the Rhodopsin genomic DNA sequence with all exons in upper case and everything else (ie introns) in lower case. Visually, you should be able to pick out the 5 exons by seeing where the upper case letters are separated from lower case. Copy the gene sequence into a new MS Word file titled Gg Rho DNA Go back to the Rho index page and select the mrna sequence link. This outputs the mrna sequence (with Ts instead of Us), that is all of the exonic sequence stitched together with the intronic sequences spliced out. Copy the mrna sequence into a new MS Word file titled Gg Rho mrna Assignments 1. Complete the RNA-Seq spreadsheet from Part A with completed GO upregulated and GO downregulated tabs as well as a fully completed genes to validate tab with information for all genes from in the Notch and phototransduction pathways copy/pasted. Submit 1 spreadsheet/group 2. Create and view new sequence files for your Rho DNA and mrna sequences in the ApE (A Plasmid Editor) sequence editing software (see short ApE tutorial below) Part C: Editing & annotating sequences in the ApE sequence editor (A plasmid Editor) ApE is a free sequence editing software package developed by Wayne Davis at the University of Utah. The programed can be easily downloaded and installed on any Mac or PC computer downloaded at (note: there are slightly different installation instructions for Mac users). You will learn some of the basic features in ApE investigating the mouse CRX gene as an example. After completing the UCSC Genome Browser online tutorial, you now know how to navigate to and obtain information about genes. Using the 2011 assembly of the mouse genome, navigate to the CRX gene. Note: there are 2 isoforms of CRX. This exercise will refer to the longer CRX variant 1 isoform Obtain the genomic DNA sequence CRX in the following format: 5 UTRs, CDC exons, 3 UTRs, introns no extra upstream or downstream sequence One FASTA record per gene Exons in upper case, everything else in lower case Open a new ApE file and copy-and-paste the mouse CRX genomic DNA sequence into the viewer window. Be sure not to paste in the FASTA label tags (the top line >mm10 ). You'll notice the program warns you if you have illegal letters (ie, not ATGC) and will remove them. Save the sequence to your desktop as mouse CRX gene.
8 Searching for Sequences To find particular sequences, press "Command F" or click on the "binoculars" icon or select "Find" under the "Edit" menu. Any of these commands will open the Find menu. Input the sequence you're looking for (type or copy/paste) into the search field and click "Find next" to find the 1 st occurrence of your search. Alternatively, you can select highlight all to find all occurrences of your query sequence. Use this feature to search for possible ATG start codons in the CRX gene. The 1 st ATG in a gene sometimes but not always codes for the starting Met amino acid codon. type ATG in the search window select wrap to search sequences that wrap across lines of sequence deselect all other options highlight all, select wrap). Place the cursor in front of the 1 st ATG. At the top of the sequence window the Sequence and values indicating the length of the entire sequence and the position of the cursor respectively within your sequence. Note the position of the 1 st ATG is beginning at the 11 th nucleotide of the CRX gene. This is a useful feature for quickly determining the position of certain sequence features. With your cursor, select all of the sequence between the 1 st and 2 nd ATG sequences. The Length value in the sequence window will indicate the nucleotide length of the highlighted regions. This is a useful feature for quickly calculating the size of certain sequence features.
9 These highlights are temporary and will not be saved in your file. Select Edit>>>Clear Find Highlighted to remove the highlights. Annotating Sequences Sequence features can be highlighted and saved (annotated) to your sequence file. We will now use the search feature to find and annotate sequences of a hypothetical PCR primer set. Starting with the top strand F1 forward primer, copy/paste the primer sequence below into the find window: Mouse CRX F1 primer: 5 - GCTGTCTTTCCAGACCCTATAC -3 Mouse CRX R1 primer: 5 - CTGCCTCCACATCCCAAATA -3 To annotate a sequence, make sure the nucleotides of interest are highlighted. Select "New Feature" from the "Features" menu. This will open an edit feature format menu. Give the feature a name (ie CRX F1 primer ) and select a color to highlight your sequencing in (blue in this example). Leave all other defaults and select OK. The forward primer will now be highlighted blue in your sequence. Repeat these steps to annotate the reverse strand R1 primer with a few extra steps. To find sequences on the reverse strand of DNA you must select the also find rev-com of string option on the find menu. This commend tells the software to search for exact text matches as well as reverse complement matches. For example, if you search for AT, the software will report all AT and TA sequences. This search should find your R1 primer sequence. Note that the highlighted sequence is the top strand reverse complement of the sequence you searched for.
10 There are also a couple of extra steps for annotating features on the reverse or complimentary strand. Select "New Feature" from the "Features" menu. In the edit features window select a Reverse color (red in this example), also select the Rev-Com option on the top right of the menu. This command will inform the software that the sequence you are annotating is on the bottom strand instead of the top strand. Leave all other defaults and select OK. Your single stranded sequence should now have both the F1 and R1 primers highlighted in their respective colors in the sequence viewer window: Viewing and Printing Annotated Sequence To view and print strand-specific annotated sequences you will use the Text Map View in ApE. Select Enzymes>>>Text Map or by select the text map icon in the tool bar above the sequence (3 rd icon from the left; see below image). Keep default setting for the configurations menu and hit OK.
11 This command gives you your sequence + annotations in a printable format. Note that the primer annotations are indicated in strand-specific orientation (with arrows). Right click to print in ApE or save your annotated text map sequence to a Word document as a screen clipping and print from MS Word. This is a handy trick if the computer you re printing from does not have ApE installed. Here is an example of Text Map View: There are a number of other features not described by this guide that you can explore on your own if you like. Assignment Turn in a printout a of your annotated mouse CRX gene in Text Map View. The following must be annotated on the correct strand: The second ATG in the CRX gene in green F1 CRX primer in blue R1 CRX primer in red (annotated on the reverse strand) Also indicate the following: The numerical position in the sequence of the 1 st 5 nucleotide of the F1 primer The numerical position in the sequence of the 1 st 5 nucleotide of the R1 primer The size in nucleotides of the putative F1/R1 CRX PCR product Please note that the printout can be directly from ApE or a MS Word screen clipping of your annotated Text Map View. Color printing is not required.
Real-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
More informationFrequently Asked Questions Next Generation Sequencing
Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided
More informationSICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE
AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,
More informationBioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
More informationFirst Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationExercises for the UCSC Genome Browser Introduction
Exercises for the UCSC Genome Browser Introduction 1) Find out if the mouse Brca1 gene has non-synonymous SNPs, color them blue, and get external data about a codon-changing SNP. Skills: basic text search;
More informationCompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
More informationRT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
More informationRETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
More informationThermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationGenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
More informationNew Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.
New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System
More informationMMLV High Performance Reverse Transcriptase
MMLV High Performance Reverse Transcriptase Cat. Nos. RT80110K and RT80125K Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio).
More informationab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
More informationMir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
More informationGene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene
More informationHierarchical Clustering Analysis
Hierarchical Clustering Analysis What is Hierarchical Clustering? Hierarchical clustering is used to group similar objects into clusters. In the beginning, each row and/or column is considered a cluster.
More informationUsing Illumina BaseSpace Apps to Analyze RNA Sequencing Data
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless
More informationMicrosoft Access 2010 handout
Microsoft Access 2010 handout Access 2010 is a relational database program you can use to create and manage large quantities of data. You can use Access to manage anything from a home inventory to a giant
More informationPrimePCR Assay Validation Report
Gene Information Gene Name sorbin and SH3 domain containing 2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORBS2 Human Arg and c-abl represent the mammalian
More informationAll-in-One First-Strand cdna Synthesis Kit
All-in-One First-Strand cdna Synthesis Kit For reliable first-strand cdna synthesis from all RNA sources Cat. No. AORT-0020 (20 synthesis reactions) Cat. No. AORT-0050 (50 synthesis reactions) User Manual
More informationAnalyzing A DNA Sequence Chromatogram
LESSON 9 HANDOUT Analyzing A DNA Sequence Chromatogram Student Researcher Background: DNA Analysis and FinchTV DNA sequence data can be used to answer many types of questions. Because DNA sequences differ
More informationVector NTI Advance 11 Quick Start Guide
Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.
More informationREAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
More informationUser Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
More informationIntellect Platform - Tables and Templates Basic Document Management System - A101
Intellect Platform - Tables and Templates Basic Document Management System - A101 Interneer, Inc. 4/12/2010 Created by Erika Keresztyen 2 Tables and Templates - A101 - Basic Document Management System
More informationRNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr)
RNA Extraction and Quantification, Reverse Transcription, and Real-time Preparation of Samples Cells: o Remove media and wash cells 2X with cold PBS. (2 ml for 6 well plate or 3 ml for 6cm plate) Keep
More informationRT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl
Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl
More informationDyNAmo cdna Synthesis Kit for qrt-pcr
DyNAmo cdna Synthesis Kit for qrt-pcr Instruction manual F- 470S Sufficient for 20 cdna synthesis reactions (20 µl each) F- 470L Sufficient for 100 cdna synthesis reactions (20 µl each) Description...
More informationGoogle Drive Create, Share and Edit Documents Online
Revision 3 (1-31-2014) Google Drive Create, Share and Edit Documents Online With Google Drive, you can easily create, share, and edit documents online. Here are a few specific things you can do: Convert
More informationAnalyzing microrna Data and Integrating mirna with Gene Expression Data in Partek Genomics Suite 6.6
Analyzing microrna Data and Integrating mirna with Gene Expression Data in Partek Genomics Suite 6.6 Overview This tutorial outlines how microrna data can be analyzed within Partek Genomics Suite. Additionally,
More informationCluster software and Java TreeView
Cluster software and Java TreeView To download the software: http://bonsai.hgc.jp/~mdehoon/software/cluster/software.htm http://bonsai.hgc.jp/~mdehoon/software/cluster/manual/treeview.html Cluster 3.0
More informationBiotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
More informationqstar mirna qpcr Detection System
qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr
More informationRevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
More informationVersion 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
More informationIntroduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
More informationAppendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
More informationUser Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse)
User Manual/Hand book qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse) Kit Components Cat. No. MA003...Human Whole Genome mirna qpcr Profiling Kit (-20 C) The following components are sufficient
More informationIntroduction to Microsoft Access 2003
Introduction to Microsoft Access 2003 Zhi Liu School of Information Fall/2006 Introduction and Objectives Microsoft Access 2003 is a powerful, yet easy to learn, relational database application for Microsoft
More informationMystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C
microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr
More informationHow to Login Username Password:
How to Login After navigating to the SelecTrucks ATTS Call Tracking & Support Site: www.selectrucksatts.com Select Corporate Link to login for Corporate owned Centers/Locations. Username: Your Email Address
More informationMicrosoft Access Basics
Microsoft Access Basics 2006 ipic Development Group, LLC Authored by James D Ballotti Microsoft, Access, Excel, Word, and Office are registered trademarks of the Microsoft Corporation Version 1 - Revision
More informationMICROSOFT ACCESS 2003 TUTORIAL
MICROSOFT ACCESS 2003 TUTORIAL M I C R O S O F T A C C E S S 2 0 0 3 Microsoft Access is powerful software designed for PC. It allows you to create and manage databases. A database is an organized body
More informationIntroduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
More informationLab 2: MS ACCESS Tables
Lab 2: MS ACCESS Tables Summary Introduction to Tables and How to Build a New Database Creating Tables in Datasheet View and Design View Working with Data on Sorting and Filtering 1. Introduction Creating
More informationEducation Solutions Development, Inc. APECS Navigation: Business Systems Getting Started Reference Guide
Education Solutions Development, Inc. APECS Navigation: Business Systems Getting Started Reference Guide March 2013 Education Solutions Development, Inc. What s Inside The information in this reference
More informationUW- Green Bay QuickBooks Accounts Receivable User Manual
UW- Green Bay QuickBooks Accounts Receivable User Manual Table of Contents Topic Page Number Logging into QuickBooks 2 Changing your password. 3 Creating Invoices. 4 Customer Entry/Search. 5-7 Entering
More informationUser Manual. Transcriptome Analysis Console (TAC) Software. For Research Use Only. Not for use in diagnostic procedures. P/N 703150 Rev.
User Manual Transcriptome Analysis Console (TAC) Software For Research Use Only. Not for use in diagnostic procedures. P/N 703150 Rev. 1 Trademarks Affymetrix, Axiom, Command Console, DMET, GeneAtlas,
More informationEXCEL PIVOT TABLE David Geffen School of Medicine, UCLA Dean s Office Oct 2002
EXCEL PIVOT TABLE David Geffen School of Medicine, UCLA Dean s Office Oct 2002 Table of Contents Part I Creating a Pivot Table Excel Database......3 What is a Pivot Table...... 3 Creating Pivot Tables
More informationEXCEL 2007. Using Excel for Data Query & Management. Information Technology. MS Office Excel 2007 Users Guide. IT Training & Development
Information Technology MS Office Excel 2007 Users Guide EXCEL 2007 Using Excel for Data Query & Management IT Training & Development (818) 677-1700 Training@csun.edu http://www.csun.edu/training TABLE
More informationExcel Reports and Macros
Excel Reports and Macros Within Microsoft Excel it is possible to create a macro. This is a set of commands that Excel follows to automatically make certain changes to data in a spreadsheet. By adding
More informationTable of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3
Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA
More informationValidating Microarray Data Using RT 2 Real-Time PCR Products
Validating Microarray Data Using RT 2 Real-Time PCR Products Introduction: Real-time PCR monitors the amount of amplicon as the reaction occurs. Usually, the amount of product is directly related to the
More informationRochester Institute of Technology. Oracle Training: Advanced Financial Application Training
Rochester Institute of Technology Oracle Training: Advanced Financial Application Training Table of Contents Introduction Lesson 1: Lesson 2: Lesson 3: Lesson 4: Creating Journal Entries using Excel Account
More informationMicrosoft Excel v5.0 Database Functions
Microsoft Excel v5.0 Database Functions Student Guide Simon Dupernex Aston Business School Version 1.0 1 Preface This document is an introduction to the database functions contained within the spreadsheet
More informationAppointment Scheduler
EZClaim Appointment Scheduler User Guide Last Update: 11/19/2008 Copyright 2008 EZClaim This page intentionally left blank Contents Contents... iii Getting Started... 5 System Requirements... 5 Installing
More informationGlobal MicroRNA Amplification Kit
Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in
More informationGenomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
More informationExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas
ExpressArt Bacterial H-TR cdna synthesis kit With extreme selectivity against rrnas suitable for 2 to 4 µg total RNA Catalogue No. 8004-A30 (30 rxns) Reagents Materials are provided for 30 cdna synthesis
More informationTask Force on Technology / EXCEL
Task Force on Technology EXCEL Basic terminology Spreadsheet A spreadsheet is an electronic document that stores various types of data. There are vertical columns and horizontal rows. A cell is where the
More informationTutorial. Reference Genome Tracks. Sample to Insight. November 27, 2015
Reference Genome Tracks November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com Reference
More informationedgebooks Quick Start Guide 4
edgebooks Quick Start Guide 4 memories made easy SECTION 1: Installing FotoFusion Please follow the steps in this section to install FotoFusion to your computer. 1. Please close all open applications prior
More informationGene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
More informationNote: With v3.2, the DocuSign Fetch application was renamed DocuSign Retrieve.
Quick Start Guide DocuSign Retrieve 3.2.2 Published April 2015 Overview DocuSign Retrieve is a windows-based tool that "retrieves" envelopes, documents, and data from DocuSign for use in external systems.
More informationMir-X mirna First-Strand Synthesis and SYBR qrt-pcr
User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
More informationTranslation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
More informationPlexor Systems Instrument Setup and Data Analysis for the Roche LightCycler 2.0 and LightCycler 1.5 Systems using LightCycler Software Version 4.
TECHNICAL MANUAL Plexor Systems Instrument Setup and Data Analysis for the Roche LightCycler 2.0 and LightCycler 1.5 Systems using LightCycler Software Version 4.0 Instruc ons for use of Products A4011,
More informationMicrosoft Office Access 2007 Basics
Access(ing) A Database Project PRESENTED BY THE TECHNOLOGY TRAINERS OF THE MONROE COUNTY LIBRARY SYSTEM EMAIL: TRAININGLAB@MONROE.LIB.MI.US MONROE COUNTY LIBRARY SYSTEM 734-241-5770 1 840 SOUTH ROESSLER
More informationWhat Do You Think? for Instructors
Accessing course reports and analysis views What Do You Think? for Instructors Introduction As an instructor, you can use the What Do You Think? Course Evaluation System to see student course evaluation
More informationConverting an Excel Spreadsheet Into an Access Database
Converting an Excel Spreadsheet Into an Access Database Tracey L. Fisher Personal Computer and Software Instructor Butler County Community College - Adult and Community Education Exceeding Your Expectations..
More informationkalmstrom.com Business Solutions
Kanban Task Manager for Outlook Manual Table of contents 1 INTRODUCTION... 3 1.1 LANGUAGES... 4 1.2 REQUIREMENTS... 4 1.3 SYSTEMS... 4 2 INSTALLATION OF KANBAN TASK MANAGER... 5 2.1 INTRODUCTION... 5 2.2
More informationExcel 2007 - Using Pivot Tables
Overview A PivotTable report is an interactive table that allows you to quickly group and summarise information from a data source. You can rearrange (or pivot) the table to display different perspectives
More informationPlexor Systems Instrument Setup and Data Analysis for the Applied Biosystems 7300 and 7500 Real-Time PCR Systems
Technical Manual Plexor Systems Instrument Setup and Data Analysis for the Applied Biosystems 7300 and 7500 Real-Time PCR Systems INSTRUCTIONS FOR USE OF PRODUCTS A4011, A4021, A4031, A4041, A4051 AND
More informationPreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
More informationBusiness Objects InfoView Quick-start Guide
Business Objects InfoView Quick-start Guide Last Modified: 10/28/2015 The latest PDF version of this document can be found at: http://www.calpolycorporation.com/docs/finance/boeinfoviewquickstart.pdf What
More informationMicrosoft Word 2010. Quick Reference Guide. Union Institute & University
Microsoft Word 2010 Quick Reference Guide Union Institute & University Contents Using Word Help (F1)... 4 Window Contents:... 4 File tab... 4 Quick Access Toolbar... 5 Backstage View... 5 The Ribbon...
More informationWHAT S NEW IN MS EXCEL 2013
Contents Excel... 1 Filling empty cells using Flash Fill... 1 Filtering records using a Timeline... 2 Previewing with Quick Analysis... 4 Using Chart Advisor recommendations... 5 Finding errors and issues
More informationBeckman Coulter DTX 880 Multimode Detector Bergen County Technical Schools Stem Cell Lab
Beckman Coulter DTX 880 Multimode Detector Bergen County Technical Schools Stem Cell Lab Room 213 Beckman Coulter DTX 880 Multimode Detector Information The Beckman Coulter DTX 880 Multimode Detector is
More informationDeCyder Extended Data Analysis module Version 1.0
GE Healthcare DeCyder Extended Data Analysis module Version 1.0 Module for DeCyder 2D version 6.5 User Manual Contents 1 Introduction 1.1 Introduction... 7 1.2 The DeCyder EDA User Manual... 9 1.3 Getting
More informationSAP BusinessObjects Financial Consolidation Web User Guide
SAP BusinessObjects Financial Consolidation Document Version: 10.0 Support Package 18 2016-02-19 SAP BusinessObjects Financial Consolidation Web User Guide Content 1 General user functions....12 1.1 To
More informationStructure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
More informationAIM Dashboard-User Documentation
AIM Dashboard-User Documentation Accessing the Academic Insights Management (AIM) Dashboard Getting Started Navigating the AIM Dashboard Advanced Data Analysis Features Exporting Data Tables into Excel
More informationFinance Reporting. Millennium FAST. User Guide Version 4.0. Memorial University of Newfoundland. September 2013
Millennium FAST Finance Reporting Memorial University of Newfoundland September 2013 User Guide Version 4.0 FAST Finance User Guide Page i Contents Introducing FAST Finance Reporting 4.0... 2 What is FAST
More informationOnline Web Learning University of Massachusetts at Amherst
GETTING STARTED WITH OWL COURSE MANAGEMENT Online Web Learning University of Massachusetts at Amherst A Series of Hands-on Activities to Teach You How to Manage Your Course Using the OWL Instructor Tools
More informationMicrosoft Office. Mail Merge in Microsoft Word
Microsoft Office Mail Merge in Microsoft Word TABLE OF CONTENTS Microsoft Office... 1 Mail Merge in Microsoft Word... 1 CREATE THE SMS DATAFILE FOR EXPORT... 3 Add A Label Row To The Excel File... 3 Backup
More informationTutorial for proteome data analysis using the Perseus software platform
Tutorial for proteome data analysis using the Perseus software platform Laboratory of Mass Spectrometry, LNBio, CNPEM Tutorial version 1.0, January 2014. Note: This tutorial was written based on the information
More informationBasics FLEETMATE. Getting Started The Main Window Filtering Data Using Your Mouse Windows and Buttons
Basics Getting Started The Main Window Filtering Data Using Your Mouse Windows and Buttons Copyright SCB Consulting, LLC. All rights reserved. www.fleetmate.com Getting Started Welcome to FLEETMATE, Windows
More informationProtocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR
Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.
More informationTable of Contents. Manual for Core Staff - Equipment/Scheduling Core Facilities
Table of Contents 1. Overview 2. How do I manage my account? 3. Equipment Scheduling Workflow Overview 4. Equipment Scheduling Walk Through a. How do I access the list of calendars available for scheduling?
More informationRA MODEL VISUALIZATION WITH MICROSOFT EXCEL 2013 AND GEPHI
RA MODEL VISUALIZATION WITH MICROSOFT EXCEL 2013 AND GEPHI Prepared for Prof. Martin Zwick December 9, 2014 by Teresa D. Schmidt (tds@pdx.edu) 1. DOWNLOADING AND INSTALLING USER DEFINED SPLIT FUNCTION
More informationUsing Word 2007 For Mail Merge
Using Word 2007 For Mail Merge Introduction This document assumes that you are familiar with using Word for word processing, with the use of a computer keyboard and mouse and you have a working knowledge
More informationUser Guide to the Content Analysis Tool
User Guide to the Content Analysis Tool User Guide To The Content Analysis Tool 1 Contents Introduction... 3 Setting Up a New Job... 3 The Dashboard... 7 Job Queue... 8 Completed Jobs List... 8 Job Details
More information7.0 BW Budget Formulation Report Tips and Tricks
7.0 BW Budget Formulation Report Tips and Tricks Sections: A. Variables Entry Options for Entering Selections B. Variables Entry Screen Personalization and Screen Variants C. Bookmarks D. Print in PDF
More informationWeb Ambassador Training on the CMS
Web Ambassador Training on the CMS Learning Objectives Upon completion of this training, participants will be able to: Describe what is a CMS and how to login Upload files and images Organize content Create
More informationFormatting Formatting Tables
Intermediate Excel 2013 One major organizational change introduced in Excel 2007, was the ribbon. Each ribbon revealed many more options depending on the tab selected. The Help button is the question mark
More informationExcel 2013 - Using Pivot Tables
Overview A PivotTable report is an interactive table that allows you to quickly group and summarise information from a data source. You can rearrange (or pivot) the table to display different perspectives
More information