Analyzing RNA-seq Data and Synthesizing cdna From Total RNA Dr. Ray Enke Bio 480 Advanced Molecular Bio Lab James Madison University

Transcription

1 Analyzing RNA-seq Data and Synthesizing cdna From Total RNA Dr. Ray Enke Bio 480 Advanced Molecular Bio Lab James Madison University *Gloves required; be mindful of RNases; use pre-pcr pipettes Over the next few weeks we will computationally analyze a transcriptome-wide gene expression experiment and then design follow up gene-specific experiments to gain additional information about gene expression in the developing chicken retina. Today we will analyze an RNA-seq data set from an experiment that my lab conducted this past summer identifying all of the differentially expressed mrnas isolated from embryonic day 8 (E8) chicken retina and E18 chicken retina. The chicken retina looks dramatically different at these two embryonic stages: The mrna-seq experiment identified 1,077 genes up-regulated and 1,416 genes down-regulated in E18 retina compared to E8 retina (see data spreadsheet). During this lab activity you will sort through these genes and pick out a collection of selected candidate genes for in class validation using quantitative reverse transcriptase PCR (qrt-pcr). I. 1 st strand cdna synthesis from chicken total RNA We will use the Bio-Rad iscript 1 st strand synthesis kit to make cdnas from total RNA extracted from embryonic chick retina. *Please use carful pipetting, these reagents are very expensive! Reverse transcriptase (RT) is an enzyme encoded by retroviruses (such as HIV and Cauliflower Mosaic Virus). It has the unique activity of synthesizing DNA from an RNA template. This enzyme activity has been co-opted by researchers as a way to convert unstable RNAs to a more stable DNA copy for subsequent study. Today you will convert chicken mrnas to cdna copies using RT. We will use these cdnas in subsequent labs to assay the abundance of specific mrnas during retinal development. Use the following embryonic chicken RNAs to set up cdna reactions in a labeled PCR strip tube. All RNAs are set to 6.7 ng/ul in strip tubes labeled chick RNA. Add 100 ng of each total RNA (15 ul) to a new strip tube labeled cdna, group# on the side and #1-8 on the top. Here s the RNA you re pipetting into each cdna tube:

2 Sample # embryo age tissue ng/ul for 100 ng 1 E8 retina E10 retina E12 retina E14 retina E16 retina E18 retina E18 brain E18 retina (no RT control) Samples #1-7 will contain RT enzyme and a 5X enzyme buffer containing dntps and a mix of 2 different primers used to start the RT reaction: 1. Poly T primer: anneals to all mrnas specifically (via poly A tails) 2. Random hexamer (NNNNNN; any combo of 6 nucleotides); anneals randomly to all transcripts Here s the RT reaction master mix: per reaction ingredient X8 4 ul 5X buffer 32 ul 1 ul RT 8 ul Add 5 ul of RT mix to 15 ul RNA in tubes #1-7 and keep on ice. Sample #8 will be a no RT control. This reaction will have all of the RNA template, primers, buffer, dntps without the RT enzyme. This will serve as an important control for subsequent cdna quantitative PCR to ensure that trace amounts of contaminating DNA are not being amplified by your cdna-specific primers. Here s the no RT mix: per reaction ingredient 4 ul 5X buffer 1 ul H2O Add 5 ul of no RT mix to 15 ul E18 retina RNA in tube #8 and keep on ice. Using the PCR thermocycler, run the reaction through the following temperatures ( iscript cdna program): 1. 5 min at 25C (primer annealing) min at 42C (RT synthesis) 3. 5 min at 85C (heat denaturation of RT enzyme) 4. Hold at 4C (cdna storage) cdnas can be stored long term at -20C. The synthesized cdnas are a collection of sequences complimentary to all of the mrnas present in the total RNA extracted from each tissue. In subsequent labs we will use 2 ul of each cdna reaction for quantitative gene-specific PCR (qpcr) of interesting candidate genes.

3 II. Analyzing Illumina RNA-seq data This training module will use the following web resources: 1. Ensemble BioMart: 2. UCSC genome browser: A very good online tutorial for the browser can be found at The mrna-seq experiment identified 1,077 genes up-regulated and 1,416 genes down-regulated in E18 retina compared to E8 retina. During this lab activity you will computationally sort through these genes and select a collection of candidate genes for in class validation using quantitative reverse transcriptase PCR (qrt-pcr). Open the RNA-Seq Excel spreadsheet to visualize the list of 1,077 genes up-regulated and 1,416 genes down-regulated in E18 retina compared to E8 retina. The 3 rd tab genes to validate should be empty except for the column headings. You will populate this tab with candidate genes that you identify. Spreadsheet columns list the following information: Gene ID: gene identifier # Gene: gene name abbreviation Locus: chromosome and genome coordinates E8 retina FPKM: fragments/kb of exon/million fragments for each gene in E8 E18 retina FPKM: fragments/kb of exon/million fragments for each gene in E18 Log2 fold change E8:E18 fold change of E8/E18 FPKM (2 fold increase=1; 2 fold decrease= - 1; no change = 0) P-value: probability of observed expression change being false positives Significant: Indicates if the p-value <0.05; this means there is a 5% chance or less of false positive Part A: Assigning full gene names and Gene Ontology or GO Terms Genes are listed in descending order from most up-regulated in the E18 upregulated tab and most down-regulated in the E18 downregulated tab (based on log2 fold change). Column B lists the abbreviation of the associated gene name. To pick interesting candidate genes out of the list, we need to get some additional information about each of them. A gene ontology or GO term is a short descriptor of a gene product s function. We will use a database called Ensemble BioMart to assign each gene some GO terms and it s full gene name in order to pick out some interesting ones from the list. Navigate to Ensemble BioMart ( Choose database>>>ensemble genes>>>choose dataset>>>gallus gallus genes (Galgal4) Filters>>>Gene>>>check input external references ID list >>>select Associated gene names from dropdown These commands tell the database that we are going to filter a list of gene name abbreviations through the annotated chicken genome (Gallus gallus). In the RNA-seq spreadsheet, copy the entire column B of the upregulated genes tab paste the gene abbreviations into the BioMart search window.

4 The next set of commands will tell the database what information we want back from our gene abbreviation search: Attributes>>>gene Check only the following boxes under Gene: Description, Associate gene name Check only the following box under External: GO Term name Select Results>>> for Export results to select File>>>XLS>>>check Unique results only>>>go You now have a new spreadsheet with the full gene name and GO terms for each of the up-regulated E18 retina genes (Note: genes with multiple associated GO terms are repeated in multiple rows. Many genes will have multiple rows depending on how many processes they are associated with). Move the GO spreadsheet into the RNA-seq data spreadsheet: Right click the spreadsheet tab in the GO file and select Move or Copy Highlight the tab you want to move and select the RNA-seq Excel file under Move selected sheets to book option Rename this tab upregulated GO Repeat this process for the list of downregulated genes creating a 5 th tab in your spreadsheet downregulated GO Use your modified spreadsheet to search for keywords of interest in the GO tabs (ie full gene names like Rhodopsin or processes such as phototransduction). My lab is interested in 2 aspects of retinal development, 1) the Notch transcription factor signaling pathway and 2) the phototransduction signaling pathway. One of these pathways should be upregulated in E18 retina and one should be downregulated. Do a bit of research and make a hypothesis for genes specific to each pathway in E8 vs E18 retina. Find all up and down regulated genes associated with these 2 pathways by keyword searching the GO tabs of your spreadsheets: Control F in Excel>>>enter search term>>>find next For phototransduction genes search the terms phototransduction, rod, cone, photoreceptor, and visual perception For Notch genes simply search for notch Remember that 1 pathway is upregulated in E18 and the other is downregulated in E18, make sure you are pulling information from the correct list of genes. For each individual gene of interest that you find in the GO tab: search for the same gene in the RNA-seq data by their Gene name abbreviation transfer (copy/paste) the gene expression data for your candidate genes to the genes to validate tab of your spreadsheet include the full gene name and 1-2 relevant GO terms in the indicated columns W will use these candidate genes that you identify in this tab to design qpcr primers to experimentally validate the RNA-seq expression data.

5 Part B. Obtaining Sequence information from the UCSC Genome Browser Next you will use the UCSC Genome Browser to obtain genomic DNA and mrna sequences for your genes of interest. I will use the chicken Rhodopsin (Rho) gene as an example for how to obtain sequence info from the browser. Instructor note: View the Open Helix video tutorials to learn the basic features of the USCS Genome Browser Navigate to the UCSC Genome Browser homepage: Select Genomes In the pull down menus select Group>>>vertebrate; genome>>>chicken; assembly>>>2011; enter Rhodopsin as the search term>>>submit Select Rho at chr12 from the result page to access the genome browser view This takes you to a view of the entire Rhodopsin gene on the chicken chromosome 12 with multiple other annotation tracks showing data corresponding to this genetic locus. For simplicity, we will first deselect all tracks to start from scratch and adjust some of the display options. Directly under the viewer select the hide all option to hide all tracks Under genes and gene predictions select the RefSeq Genes option with full display Select Refresh Select the configure button below the genome viewer window to change the following display settings Change the text size to 12 (will make all features larger) Uncheck the Show light blue vertical guidelines box (to remove vertical guidelines) Cold Spring Harbor Laboratory, DNA Learning Center, 1 Bungtown Road, Cold Spring Harbor, NY

6 Hit submit to see your reformatted genome viewer window The Rho gene with annotated exons (blue bars) and introns (arrowed lines) is now displayed in the viewer with corresponding genome coordinates. Note: alternatively, Ensembl or Genescan gene displays can be selected if there is no RefSeq annotation for your gene of interest. The direction of the arrowed line indicates which strand the gene is encoded on. Arrows pointing to the right indicate the gene is coded 5 to 3 on the top strand (left to right in this view), arrows pointing to the left indicate the gene is coded 5 to 3 on the bottom strand (right to left in this view). Rho is coded on the top strand with exon 1 on the far left. Rho has 5 exons and 4 introns. Obtaining DNA and mrna sequence information: To obtain sequence information from a gene or a genetic region, click on the gene name on the left side of the viewer (eg Rho ). This brings you to a page index where you can access more info about your gene. Under the Links to sequence heading you have options to view the genomic DNA, mrna, or protein sequence for this region. We will collect gdna and mrna sequences for Rhodopsin. Select the Genomic sequence link 1 st to go to a sequence formatting page. Get the Rho sequence with the following formatting options and paste it into a Word file: 5 UTRs, CDC exons, 3 UTRs, introns One FASTA record per gene Exons in upper case, everything else in lower case Submit

7 This outputs the Rhodopsin genomic DNA sequence with all exons in upper case and everything else (ie introns) in lower case. Visually, you should be able to pick out the 5 exons by seeing where the upper case letters are separated from lower case. Copy the gene sequence into a new MS Word file titled Gg Rho DNA Go back to the Rho index page and select the mrna sequence link. This outputs the mrna sequence (with Ts instead of Us), that is all of the exonic sequence stitched together with the intronic sequences spliced out. Copy the mrna sequence into a new MS Word file titled Gg Rho mrna Assignments 1. Complete the RNA-Seq spreadsheet from Part A with completed GO upregulated and GO downregulated tabs as well as a fully completed genes to validate tab with information for all genes from in the Notch and phototransduction pathways copy/pasted. Submit 1 spreadsheet/group 2. Create and view new sequence files for your Rho DNA and mrna sequences in the ApE (A Plasmid Editor) sequence editing software (see short ApE tutorial below) Part C: Editing & annotating sequences in the ApE sequence editor (A plasmid Editor) ApE is a free sequence editing software package developed by Wayne Davis at the University of Utah. The programed can be easily downloaded and installed on any Mac or PC computer downloaded at (note: there are slightly different installation instructions for Mac users). You will learn some of the basic features in ApE investigating the mouse CRX gene as an example. After completing the UCSC Genome Browser online tutorial, you now know how to navigate to and obtain information about genes. Using the 2011 assembly of the mouse genome, navigate to the CRX gene. Note: there are 2 isoforms of CRX. This exercise will refer to the longer CRX variant 1 isoform Obtain the genomic DNA sequence CRX in the following format: 5 UTRs, CDC exons, 3 UTRs, introns no extra upstream or downstream sequence One FASTA record per gene Exons in upper case, everything else in lower case Open a new ApE file and copy-and-paste the mouse CRX genomic DNA sequence into the viewer window. Be sure not to paste in the FASTA label tags (the top line >mm10 ). You'll notice the program warns you if you have illegal letters (ie, not ATGC) and will remove them. Save the sequence to your desktop as mouse CRX gene.

8 Searching for Sequences To find particular sequences, press "Command F" or click on the "binoculars" icon or select "Find" under the "Edit" menu. Any of these commands will open the Find menu. Input the sequence you're looking for (type or copy/paste) into the search field and click "Find next" to find the 1 st occurrence of your search. Alternatively, you can select highlight all to find all occurrences of your query sequence. Use this feature to search for possible ATG start codons in the CRX gene. The 1 st ATG in a gene sometimes but not always codes for the starting Met amino acid codon. type ATG in the search window select wrap to search sequences that wrap across lines of sequence deselect all other options highlight all, select wrap). Place the cursor in front of the 1 st ATG. At the top of the sequence window the Sequence and values indicating the length of the entire sequence and the position of the cursor respectively within your sequence. Note the position of the 1 st ATG is beginning at the 11 th nucleotide of the CRX gene. This is a useful feature for quickly determining the position of certain sequence features. With your cursor, select all of the sequence between the 1 st and 2 nd ATG sequences. The Length value in the sequence window will indicate the nucleotide length of the highlighted regions. This is a useful feature for quickly calculating the size of certain sequence features.

9 These highlights are temporary and will not be saved in your file. Select Edit>>>Clear Find Highlighted to remove the highlights. Annotating Sequences Sequence features can be highlighted and saved (annotated) to your sequence file. We will now use the search feature to find and annotate sequences of a hypothetical PCR primer set. Starting with the top strand F1 forward primer, copy/paste the primer sequence below into the find window: Mouse CRX F1 primer: 5 - GCTGTCTTTCCAGACCCTATAC -3 Mouse CRX R1 primer: 5 - CTGCCTCCACATCCCAAATA -3 To annotate a sequence, make sure the nucleotides of interest are highlighted. Select "New Feature" from the "Features" menu. This will open an edit feature format menu. Give the feature a name (ie CRX F1 primer ) and select a color to highlight your sequencing in (blue in this example). Leave all other defaults and select OK. The forward primer will now be highlighted blue in your sequence. Repeat these steps to annotate the reverse strand R1 primer with a few extra steps. To find sequences on the reverse strand of DNA you must select the also find rev-com of string option on the find menu. This commend tells the software to search for exact text matches as well as reverse complement matches. For example, if you search for AT, the software will report all AT and TA sequences. This search should find your R1 primer sequence. Note that the highlighted sequence is the top strand reverse complement of the sequence you searched for.

10 There are also a couple of extra steps for annotating features on the reverse or complimentary strand. Select "New Feature" from the "Features" menu. In the edit features window select a Reverse color (red in this example), also select the Rev-Com option on the top right of the menu. This command will inform the software that the sequence you are annotating is on the bottom strand instead of the top strand. Leave all other defaults and select OK. Your single stranded sequence should now have both the F1 and R1 primers highlighted in their respective colors in the sequence viewer window: Viewing and Printing Annotated Sequence To view and print strand-specific annotated sequences you will use the Text Map View in ApE. Select Enzymes>>>Text Map or by select the text map icon in the tool bar above the sequence (3 rd icon from the left; see below image). Keep default setting for the configurations menu and hit OK.

11 This command gives you your sequence + annotations in a printable format. Note that the primer annotations are indicated in strand-specific orientation (with arrows). Right click to print in ApE or save your annotated text map sequence to a Word document as a screen clipping and print from MS Word. This is a handy trick if the computer you re printing from does not have ApE installed. Here is an example of Text Map View: There are a number of other features not described by this guide that you can explore on your own if you like. Assignment Turn in a printout a of your annotated mouse CRX gene in Text Map View. The following must be annotated on the correct strand: The second ATG in the CRX gene in green F1 CRX primer in blue R1 CRX primer in red (annotated on the reverse strand) Also indicate the following: The numerical position in the sequence of the 1 st 5 nucleotide of the F1 primer The numerical position in the sequence of the 1 st 5 nucleotide of the R1 primer The size in nucleotides of the putative F1/R1 CRX PCR product Please note that the printout can be directly from ApE or a MS Word screen clipping of your annotated Text Map View. Color printing is not required.