Joe Wood Environmental Genomics Thematic Programme Data Centre

Size: px
Start display at page:

Download "Joe Wood anjw@ceh.ac.uk Environmental Genomics Thematic Programme Data Centre http://envgen.nox.ac.uk"

Transcription

1 Getting started with Perl Joe Wood

2 Session content Writing a perl script Running a perl script Variables Scalars Arrays Hashes Using strict

3 Writing a perl script #!/usr/bin/perl -w Statements(;) Comments(#)

4 Writing a perl script gedit script1.pl #!/usr/bin/perl -w #print some text print Hello World\n ; Save

5 Running a perl script./script1.pl

6 Running a perl script./script1.pl Make your file executable (chmod u+x)!! chmod u+x script1.pl

7 Variables Variables are containers to hold values Values can change within a script Types Scalars single pieces of information Arrays lists of information Hashes 'look-up' table of information

8 Scalars Contain single pieces of info Naming conventions- Preceded by '$' No spaces (use '_') Usually lowercase e.g. $test_scalar Store various types including strings and numbers

9 Scalars Example./script2.pl $bit_of_text assigned value with '=' #!/usr/bin/perl -w #create variable with value of 'Hello World' $bit_of_text = Hello World\n ; print $bit_of text;

10 Scalars Example./script2.pl $bit_of_text assigned value with '=' Permissions! (chmod u+x) #!/usr/bin/perl -w #create variable with value of 'Hello World' $bit_of_text = Hello World\n ; print $bit_of text;

11 Simple arithmetic Script 3 #!usr/bin/perl -w $number1 = 2; $number2 = 3;

12 Simple arithmetic Script 3 #!usr/bin/perl -w $number1 = 2; $number2 = 3; $add = $number1 + $number2; print "Addition answer is $add\n";

13 Simple arithmetic Script 3 $subtract = $number2 - $number1; print "Subtraction answer is $subtract\n";

14 Simple arithmetic Script 3 $subtract = $number2 - $number1; print "Subtraction answer is $subtract\n"; $multiply = $number1 * $number2; print "Multiplication answer is $multiply\n";

15 Incrementing Numbers can be incremented with '++' $number1 = 3; $number1++; print $number1\n ;

16 Incrementing Numbers can be incremented with '++' $number1 = 3; $number1++; print $number1\n ; 4

17 Decrementing Numbers can be decremented with '--' $number1 = 3; $number1--; print $number1\n ;

18 Decrementing Numbers can be decremented with '--' $number1 = 3; $number1--; print $number1\n ; 2

19 Concatenation Strings can be concatenated with '.' $string1 = This ; $string2 = is ; $string3 = easy ; $string4 = so far ; print $string1.$string2.$string3.$string4;

20 Concatenation Strings can be concatenated with '.' $string1 = This ; $string2 = is ; $string3 = easy ; $string4 = so far ; print $string1.$string2.$string3.$string4; This is easy so far

21 Arrays List of information Each member of list is an element 8 hello 5.6 $something Preceded by '@'

22 Arrays Assign values using '=' and list = (8, hello,5.6,$something) 8 hello 5.6 $something

23 Arrays Assign values using '=' and list = (8, hello,5.6,$something) Refer to elements as: $test_array[element number] 8 hello 5.6 $something

24 Array Example 8 hello 5.6 $something $test_array[1] is

25 Array Example 8 hello 5.6 $something $test_array[1] is hello

26 Array Example 8 hello 5.6 $something $test_array[1] is hello arrays start at 0! $test_array[0] is 8

27 Arrays Take care with variable naming! $test_array[0] is unrelated to... $test_array

28 Array Functions pop remove from right hand side push add to right hand side shift remove from left hand side unshift add to left hand side

29 Script4 -pop and push POP into variable (variable=4) PUSH variable back onto array

30 Script4 -pop and push #create an = (8,54,78,2,5,6,4); #pop the last value $pop_test = pop (@an_array); #push $pop_test back on push (@an_array,$pop_test);

31 Script4 -shift and unshift SHIFT into variable (variable=8) UNSHIFT variable back onto array

32 Script4 -shift and unshift #shift the first value $shift_test = shift (@an_array); #unshift $shift_test back on unshift (@an_array,$shift_test);

33 Hashes Look-up table of 'Keys' with associated 'Values' e.g. Hash called 'car' KEY COLOUR SIZE SPEED VALUE BLUE BIG REALLY FAST

34 Hashes Keys are arbitrary scalars Preceded by %, e.g. %car Use keys to retrieve values: $test_hash{key}=value $car{colour}= blue

35 Script5 Hashes Example #Hash example - codon translation use strict; my %translate; $translate{'atg'} = 'M'; $translate{'taa'} = '*'; $translate{'ctt'} = 'L'; print "$translate{'atg'}\n";

36 Hash functions keys = keys(%translate) values = values(%translate)

37 Use strict 'use strict;' Forces you to declare variables before using them Good for when scripts get bigger Declarations start with 'my' e.g. my %translate;

?<BACBC;@@A=2(?@?;@=2:;:%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%

?<BACBC;@@A=2(?@?;@=2:;:%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% NGS data format NGS data format @SRR031028.1708655 GGATGATGGATGGATAGATAGATGAAGAGATGGATGGATGGGTGGGTGGTATGCAGCATACCTGAAGTGC BBBCB=ABBB@BA=?BABBBBA??B@BAAA>ABB;@5=@@@?8@:==99:465727:;41'.9>;933!4 @SRR031028.843803

More information

Introduction to Perl

Introduction to Perl Introduction to Perl March 8, 2011 by Benjamin J. Lynch http://msi.umn.edu/~blynch/tutorial/perl.pdf Outline What Perl Is When Perl Should Be used Basic Syntax Examples and Hands-on Practice More built-in

More information

Learn Perl by Example - Perl Handbook for Beginners - Basics of Perl Scripting Language

Learn Perl by Example - Perl Handbook for Beginners - Basics of Perl Scripting Language Learn Perl by Example - Perl Handbook for Beginners - Basics of Perl Scripting Language www.freebsdonline.com Copyright 2006-2008 www.freebsdonline.com 2008/01/29 This course is about Perl Programming

More information

7 Why Use Perl for CGI?

7 Why Use Perl for CGI? 7 Why Use Perl for CGI? Perl is the de facto standard for CGI programming for a number of reasons, but perhaps the most important are: Socket Support: Perl makes it easy to create programs that interface

More information

Python Loops and String Manipulation

Python Loops and String Manipulation WEEK TWO Python Loops and String Manipulation Last week, we showed you some basic Python programming and gave you some intriguing problems to solve. But it is hard to do anything really exciting until

More information

#!/usr/bin/perl use strict; use warnings; use Carp; use Data::Dumper; use Tie::IxHash; use Gschem 3; 3. Setup and initialize the global variables.

#!/usr/bin/perl use strict; use warnings; use Carp; use Data::Dumper; use Tie::IxHash; use Gschem 3; 3. Setup and initialize the global variables. 1. Introduction. This program creates a Bill of Materials (BOM) by parsing a gschem schematic file and grouping components that have identical attributes (except for reference designator). Only components

More information

Top 72 Perl Interview Questions and Answers

Top 72 Perl Interview Questions and Answers Top 72 Perl Interview Questions and Answers 1. Difference between the variables in which chomp function work? Scalar: It is denoted by $ symbol. Variable can be a number or a string. Array: Denoted by

More information

We will learn the Python programming language. Why? Because it is easy to learn and many people write programs in Python so we can share.

We will learn the Python programming language. Why? Because it is easy to learn and many people write programs in Python so we can share. LING115 Lecture Note Session #4 Python (1) 1. Introduction As we have seen in previous sessions, we can use Linux shell commands to do simple text processing. We now know, for example, how to count words.

More information

Jonathan Worthington Scarborough Linux User Group

Jonathan Worthington Scarborough Linux User Group Jonathan Worthington Scarborough Linux User Group Introduction What does a Virtual Machine do? Hides away the details of the hardware platform and operating system. Defines a common set of instructions.

More information

ven though you might enjoy writing greeting cards by hand and

ven though you might enjoy writing greeting cards by hand and Features Don t write it, stick it! Independent Label OpenOffice offers a selection of preconfigured formats for users who need to print their own self-adhesive labels. Perl feeds the address data to the

More information

Pure and functional JavaScript Developer Conference 2013. Jakob Westhoff (@jakobwesthoff) November 7th, 2013

Pure and functional JavaScript Developer Conference 2013. Jakob Westhoff (@jakobwesthoff) November 7th, 2013 Pure and functional JavaScript Developer Conference 2013 Jakob Westhoff (@jakobwesthoff) November 7th, 2013 I am Jakob Westhoff Senior PHP professional Senior JavaScript professional Open source enthusiast

More information

Oracle Database: SQL and PL/SQL Fundamentals NEW

Oracle Database: SQL and PL/SQL Fundamentals NEW Oracle University Contact Us: + 38516306373 Oracle Database: SQL and PL/SQL Fundamentals NEW Duration: 5 Days What you will learn This Oracle Database: SQL and PL/SQL Fundamentals training delivers the

More information

Ruby - A Brief History

Ruby - A Brief History Ruby on Rails 4 Web development workshop Rick Pannen, Consulting & Development [ pannen@gmail.com ] The history of Ruby A scripting language like perl or python Developed by Yukihiro Matz Matsumoto in

More information

Chapter 2: Elements of Java

Chapter 2: Elements of Java Chapter 2: Elements of Java Basic components of a Java program Primitive data types Arithmetic expressions Type casting. The String type (introduction) Basic I/O statements Importing packages. 1 Introduction

More information

PHP Tutorial From beginner to master

PHP Tutorial From beginner to master PHP Tutorial From beginner to master PHP is a powerful tool for making dynamic and interactive Web pages. PHP is the widely-used, free, and efficient alternative to competitors such as Microsoft's ASP.

More information

Microsoft Windows PowerShell v2 For Administrators

Microsoft Windows PowerShell v2 For Administrators Course 50414B: Microsoft Windows PowerShell v2 For Administrators Course Details Course Outline Module 1: Introduction to PowerShell the Basics This module explains how to install and configure PowerShell.

More information

Now that we have discussed some PHP background

Now that we have discussed some PHP background WWLash02 6/14/02 3:20 PM Page 18 CHAPTER TWO USING VARIABLES Now that we have discussed some PHP background information and learned how to create and publish basic PHP scripts, let s explore how to use

More information

Books for College Students. IT 3203 Introduction to Web Development. Creating Objects. Accessing Property Values. What s in an Object?

Books for College Students. IT 3203 Introduction to Web Development. Creating Objects. Accessing Property Values. What s in an Object? Books for College Students IT 3203 Introduction to Web Development JavaScript II Labeling Systems September 24 Notice: This session is being recorded. Copyright 2007 by Bob Brown The Deluxe Transitive

More information

Java Basics: Data Types, Variables, and Loops

Java Basics: Data Types, Variables, and Loops Java Basics: Data Types, Variables, and Loops If debugging is the process of removing software bugs, then programming must be the process of putting them in. - Edsger Dijkstra Plan for the Day Variables

More information

T-SQL STANDARD ELEMENTS

T-SQL STANDARD ELEMENTS T-SQL STANDARD ELEMENTS SLIDE Overview Types of commands and statement elements Basic SELECT statements Categories of T-SQL statements Data Manipulation Language (DML*) Statements for querying and modifying

More information

(!' ) "' # "*# "!(!' +,

(!' ) ' # *# !(!' +, MATLAB is a numeric computation software for engineering and scientific calculations. The name MATLAB stands for MATRIX LABORATORY. MATLAB is primarily a tool for matrix computations. It was developed

More information

Introduction to Programming

Introduction to Programming Introduction to Programming Lecturer: Steve Maybank Department of Computer Science and Information Systems sjmaybank@dcs.bbk.ac.uk Spring 2015 Week 2b: Review of Week 1, Variables 16 January 2015 Birkbeck

More information

Better PHP Security Learning from Adobe. Bill Condo @mavrck PHP Security: Adobe Hack

Better PHP Security Learning from Adobe. Bill Condo @mavrck PHP Security: Adobe Hack Better PHP Security Learning from Adobe Quickly, about me Consultant! Senior Engineer! Developer! Senior Developer! Director of Tech! Hosting Manager! Support Tech 2014: Digital Director Lunne Marketing

More information

Manage2 API. by: J. Nick Koston

Manage2 API. by: J. Nick Koston Manage2 API by: J. Nick Koston Training Seminar 2006 Introduction! Hello, My name is Nick! This presentation is about the Manage2 API.! This also covers basic ideas behind our Manage2 system.! Our Manage2

More information

Data Structures Using C++ 2E. Chapter 5 Linked Lists

Data Structures Using C++ 2E. Chapter 5 Linked Lists Data Structures Using C++ 2E Chapter 5 Linked Lists Doubly Linked Lists Traversed in either direction Typical operations Initialize the list Destroy the list Determine if list empty Search list for a given

More information

Today. Binary addition Representing negative numbers. Andrew H. Fagg: Embedded Real- Time Systems: Binary Arithmetic

Today. Binary addition Representing negative numbers. Andrew H. Fagg: Embedded Real- Time Systems: Binary Arithmetic Today Binary addition Representing negative numbers 2 Binary Addition Consider the following binary numbers: 0 0 1 0 0 1 1 0 0 0 1 0 1 0 1 1 How do we add these numbers? 3 Binary Addition 0 0 1 0 0 1 1

More information

Udacity cs101: Building a Search Engine. Extracting a Link

Udacity cs101: Building a Search Engine. Extracting a Link Udacity cs101: Building a Search Engine Unit 1: How to get started: your first program Extracting a Link Introducing the Web Crawler (Video: Web Crawler)... 2 Quiz (Video: First Quiz)...2 Programming (Video:

More information

Excel: Introduction to Formulas

Excel: Introduction to Formulas Excel: Introduction to Formulas Table of Contents Formulas Arithmetic & Comparison Operators... 2 Text Concatenation... 2 Operator Precedence... 2 UPPER, LOWER, PROPER and TRIM... 3 & (Ampersand)... 4

More information

Chapter 10: Virtual Memory. Lesson 03: Page tables and address translation process using page tables

Chapter 10: Virtual Memory. Lesson 03: Page tables and address translation process using page tables Chapter 10: Virtual Memory Lesson 03: Page tables and address translation process using page tables Objective Understand page tables Learn the offset fields in the virtual and physical addresses Understand

More information

Introduction to Python

Introduction to Python Introduction to Python Sophia Bethany Coban Problem Solving By Computer March 26, 2014 Introduction to Python Python is a general-purpose, high-level programming language. It offers readable codes, and

More information

Oracle Database 12c: Introduction to SQL Ed 1.1

Oracle Database 12c: Introduction to SQL Ed 1.1 Oracle University Contact Us: 1.800.529.0165 Oracle Database 12c: Introduction to SQL Ed 1.1 Duration: 5 Days What you will learn This Oracle Database: Introduction to SQL training helps you write subqueries,

More information

The C Programming Language course syllabus associate level

The C Programming Language course syllabus associate level TECHNOLOGIES The C Programming Language course syllabus associate level Course description The course fully covers the basics of programming in the C programming language and demonstrates fundamental programming

More information

Computer Programming I & II*

Computer Programming I & II* Computer Programming I & II* Career Cluster Information Technology Course Code 10152 Prerequisite(s) Computer Applications, Introduction to Information Technology Careers (recommended), Computer Hardware

More information

CS2043 - Unix Tools & Scripting Lecture 9 Shell Scripting

CS2043 - Unix Tools & Scripting Lecture 9 Shell Scripting CS2043 - Unix Tools & Scripting Lecture 9 Shell Scripting Spring 2015 1 February 9, 2015 1 based on slides by Hussam Abu-Libdeh, Bruno Abrahao and David Slater over the years Announcements Coursework adjustments

More information

10.1 The Common Gateway Interface

10.1 The Common Gateway Interface 10.1 The Common Gateway Interface - Markup languages cannot be used to specify computations, interactions with users, or to provide access to databases - CGI is a common way to provide for these needs,

More information

Scaling up = getting a better machine. Scaling out = use another server and add it to your cluster.

Scaling up = getting a better machine. Scaling out = use another server and add it to your cluster. MongoDB 1. Introduction MongoDB is a document-oriented database, not a relation one. It replaces the concept of a row with a document. This makes it possible to represent complex hierarchical relationships

More information

Perl in a nutshell. First CGI Script and Perl. Creating a Link to a Script. print Function. Parsing Data 4/27/2009. First CGI Script and Perl

Perl in a nutshell. First CGI Script and Perl. Creating a Link to a Script. print Function. Parsing Data 4/27/2009. First CGI Script and Perl First CGI Script and Perl Perl in a nutshell Prof. Rasley shebang line tells the operating system where the Perl interpreter is located necessary on UNIX comment line ignored by the Perl interpreter End

More information

Cryptography and Network Security Department of Computer Science and Engineering Indian Institute of Technology Kharagpur

Cryptography and Network Security Department of Computer Science and Engineering Indian Institute of Technology Kharagpur Cryptography and Network Security Department of Computer Science and Engineering Indian Institute of Technology Kharagpur Module No. # 01 Lecture No. # 05 Classic Cryptosystems (Refer Slide Time: 00:42)

More information

Oracle Database: SQL and PL/SQL Fundamentals

Oracle Database: SQL and PL/SQL Fundamentals Oracle University Contact Us: 1.800.529.0165 Oracle Database: SQL and PL/SQL Fundamentals Duration: 5 Days What you will learn This course is designed to deliver the fundamentals of SQL and PL/SQL along

More information

DATA STRUCTURES USING C

DATA STRUCTURES USING C DATA STRUCTURES USING C QUESTION BANK UNIT I 1. Define data. 2. Define Entity. 3. Define information. 4. Define Array. 5. Define data structure. 6. Give any two applications of data structures. 7. Give

More information

PKI, Git and SVN. Adam Young. Presented by. Senior Software Engineer, Red Hat. License Licensed under http://creativecommons.org/licenses/by/3.

PKI, Git and SVN. Adam Young. Presented by. Senior Software Engineer, Red Hat. License Licensed under http://creativecommons.org/licenses/by/3. PKI, Git and SVN Presented by Adam Young Senior Software Engineer, Red Hat License Licensed under http://creativecommons.org/licenses/by/3.0/ Agenda Why git Getting started Branches Commits Why? Saved

More information

Computer Programming I

Computer Programming I Computer Programming I Levels: 10-12 Units of Credit: 1.0 CIP Code: 11.0201 Core Code: 35-02-00-00-030 Prerequisites: Secondary Math I, Keyboarding Proficiency, Computer Literacy requirement (e.g. Exploring

More information

A Simple Perl Script

A Simple Perl Script Perl What is Perl? Practical Extraction and Report Language Scripting language created by Larry Wall in the mid-80s Functionality and speed somewhere between low-level languages (like C) and high-level

More information

A Simple Shopping Cart using CGI

A Simple Shopping Cart using CGI A Simple Shopping Cart using CGI Professor Don Colton, BYU Hawaii March 5, 2004 In this section of the course, we learn to use CGI and Perl to create a simple web-based shopping cart program. We assume

More information

Last not not Last Last Next! Next! Line Line Forms Forms Here Here Last In, First Out Last In, First Out not Last Next! Call stack: Worst line ever!

Last not not Last Last Next! Next! Line Line Forms Forms Here Here Last In, First Out Last In, First Out not Last Next! Call stack: Worst line ever! ECE 551 C++ Programming, Data structures, and Algorithms Abstract Data Type: Stack Last In First Out (LIFO) 1 2 2 1 4 3 1 3 4 Stacks in Programming Worst line ever! 5 3 1 5 Stacks are not useful for waiting

More information

ARIZONA CTE CAREER PREPARATION STANDARDS & MEASUREMENT CRITERIA SOFTWARE DEVELOPMENT, 15.1200.40

ARIZONA CTE CAREER PREPARATION STANDARDS & MEASUREMENT CRITERIA SOFTWARE DEVELOPMENT, 15.1200.40 SOFTWARE DEVELOPMENT, 15.1200.40 1.0 APPLY PROBLEM-SOLVING AND CRITICAL THINKING SKILLS TO INFORMATION TECHNOLOGY 1.1 Describe methods and considerations for prioritizing and scheduling software development

More information

An Incomplete C++ Primer. University of Wyoming MA 5310

An Incomplete C++ Primer. University of Wyoming MA 5310 An Incomplete C++ Primer University of Wyoming MA 5310 Professor Craig C. Douglas http://www.mgnet.org/~douglas/classes/na-sc/notes/c++primer.pdf C++ is a legacy programming language, as is other languages

More information

XML::DT - a Perl down translation module

XML::DT - a Perl down translation module SGMLDocuments:WhereDoesQualityGo? 1 XML::DT - a Perl down translation module José Carlos Ramalho jcr@di.uminho.pt José João Dias de Almeida jj@di.uminho.pt Table of Contents XML::DT, what? Context of use

More information

#820 Computer Programming 1A

#820 Computer Programming 1A Computer Programming I Levels: 10-12 Units of Credit: 1.0 CIP Code: 11.0201 Core Code: 35-02-00-00-030 Prerequisites: Secondary Math I, Keyboarding Proficiency, Computer Literacy requirement Semester 1

More information

Content. Chapter 4 Functions 61 4.1 Basic concepts on real functions 62. Credits 11

Content. Chapter 4 Functions 61 4.1 Basic concepts on real functions 62. Credits 11 Content Credits 11 Chapter 1 Arithmetic Refresher 13 1.1 Algebra 14 Real Numbers 14 Real Polynomials 19 1.2 Equations in one variable 21 Linear Equations 21 Quadratic Equations 22 1.3 Exercises 28 Chapter

More information

Lecture 9. Semantic Analysis Scoping and Symbol Table

Lecture 9. Semantic Analysis Scoping and Symbol Table Lecture 9. Semantic Analysis Scoping and Symbol Table Wei Le 2015.10 Outline Semantic analysis Scoping The Role of Symbol Table Implementing a Symbol Table Semantic Analysis Parser builds abstract syntax

More information

Introduction to Perl Programming

Introduction to Perl Programming Introduction to Perl Programming Oxford University Computing Services 2 Revision Information Version Date Author Changes made 1.0 09 Feb 2011 Christopher Yau Created 1.1 18 Apr 2011 Christopher Yau Minor

More information

TWO-WAY EMAIL & SMS MESSAGING SMS WEB SERVICE. Product White Paper. Website: www.m-science.com Telephone: 01202 241120 Email: enquiries@m-science.

TWO-WAY EMAIL & SMS MESSAGING SMS WEB SERVICE. Product White Paper. Website: www.m-science.com Telephone: 01202 241120 Email: enquiries@m-science. TWO-WAY EMAIL & SMS MESSAGING SMS WEB SERVICE Product White Paper Website: www.m-science.com Telephone: 01202 241120 Email: enquiries@m-science.com Contents Introduction... 3 Product Components... 3 Web

More information

Solving Linear Equations in One Variable. Worked Examples

Solving Linear Equations in One Variable. Worked Examples Solving Linear Equations in One Variable Worked Examples Solve the equation 30 x 1 22x Solve the equation 30 x 1 22x Our goal is to isolate the x on one side. We ll do that by adding (or subtracting) quantities

More information

Itelpop Simple Screenpop Web Application Installation & Configuration Guide Version 1.0

Itelpop Simple Screenpop Web Application Installation & Configuration Guide Version 1.0 5 Enmore Gardens London SW14 8RF www.iteloffice.com e: support@iteloffice.com Tel: +44 (0) 20 8878 7367 Fax: +44 (0) 20 8876 7257 Itelpop Simple Screenpop Web Application Installation & Configuration Guide

More information

Introduction to MIPS Assembly Programming

Introduction to MIPS Assembly Programming 1 / 26 Introduction to MIPS Assembly Programming January 23 25, 2013 2 / 26 Outline Overview of assembly programming MARS tutorial MIPS assembly syntax Role of pseudocode Some simple instructions Integer

More information

Introduction to Python

Introduction to Python WEEK ONE Introduction to Python Python is such a simple language to learn that we can throw away the manual and start with an example. Traditionally, the first program to write in any programming language

More information

Introduction to scripting with Unity

Introduction to scripting with Unity Introduction to scripting with Unity Scripting is an essential part of Unity as it defines the behaviour of your game. This tutorial will introduce the fundamentals of scripting using Javascript. No prior

More information

A vector is a directed line segment used to represent a vector quantity.

A vector is a directed line segment used to represent a vector quantity. Chapters and 6 Introduction to Vectors A vector quantity has direction and magnitude. There are many examples of vector quantities in the natural world, such as force, velocity, and acceleration. A vector

More information

MEP Y9 Practice Book A

MEP Y9 Practice Book A 1 Base Arithmetic 1.1 Binary Numbers We normally work with numbers in base 10. In this section we consider numbers in base 2, often called binary numbers. In base 10 we use the digits 0, 1, 2, 3, 4, 5,

More information

Example of a Java program

Example of a Java program Example of a Java program class SomeNumbers static int square (int x) return x*x; public static void main (String[] args) int n=20; if (args.length > 0) // change default n = Integer.parseInt(args[0]);

More information

a storage location directly on the CPU, used for temporary storage of small amounts of data during processing.

a storage location directly on the CPU, used for temporary storage of small amounts of data during processing. CS143 Handout 18 Summer 2008 30 July, 2008 Processor Architectures Handout written by Maggie Johnson and revised by Julie Zelenski. Architecture Vocabulary Let s review a few relevant hardware definitions:

More information

First Bytes Programming Lab 2

First Bytes Programming Lab 2 First Bytes Programming Lab 2 This lab is available online at www.cs.utexas.edu/users/scottm/firstbytes. Introduction: In this lab you will investigate the properties of colors and how they are displayed

More information

Chapter 3: Restricted Structures Page 1

Chapter 3: Restricted Structures Page 1 Chapter 3: Restricted Structures Page 1 1 2 3 4 5 6 7 8 9 10 Restricted Structures Chapter 3 Overview Of Restricted Structures The two most commonly used restricted structures are Stack and Queue Both

More information

CRM Rules! User Guide. Version 3.0.2 Prepared October, 2012 By: David L. Carr, President, Visionary Software

CRM Rules! User Guide. Version 3.0.2 Prepared October, 2012 By: David L. Carr, President, Visionary Software CRM Rules! User Guide Version 3.0.2 Prepared October, 2012 By: David L. Carr, President, Visionary Software Table Of Contents Chapter 1: Overview... 5 What s a CRM Rule?... 5 What Can I Do With CRM Rules!?...

More information

Binonymizer A Two-Way Web-Browsing Anonymizer

Binonymizer A Two-Way Web-Browsing Anonymizer Binonymizer A Two-Way Web-Browsing Anonymizer Tim Wellhausen Gerrit Imsieke (Tim.Wellhausen, Gerrit.Imsieke)@GfM-AG.de 12 August 1999 Abstract This paper presents a method that enables Web users to surf

More information

Quick Questions. Skills and Knowledge. Overview. Preparation and Materials. Suggested Procedure

Quick Questions. Skills and Knowledge. Overview. Preparation and Materials. Suggested Procedure Quick Questions Overview Quick Questions describes a simple activity type that can be used for students to practise and revise a wide range of in the head skills. Quick Questions are short sets of questions,

More information

Teaching Non-majors Computer Programming Using Games as Context and Flash ActionScript 3.0 as the Development Tools

Teaching Non-majors Computer Programming Using Games as Context and Flash ActionScript 3.0 as the Development Tools Teaching Non-majors Computer Programming Using Games as Context and Flash ActionScript 3.0 as the Development Tools Yue-Ling Wong Wake Forest University Computer Science Department Winston-Salem, NC 27109

More information

I think that a smaller radius of curvature will produce more lift using the Coanda Effect.

I think that a smaller radius of curvature will produce more lift using the Coanda Effect. The Coanda Conundrum Mackenzie Carter Background My experiment was constructed to test the Coanda effect which occurs when a fluid that is traveling parallel to a nearby surface adheres to that surface.

More information

Lecture 4: Writing shell scripts

Lecture 4: Writing shell scripts Handout 5 06/03/03 1 Your rst shell script Lecture 4: Writing shell scripts Shell scripts are nothing other than les that contain shell commands that are run when you type the le at the command line. That

More information

BASH Scripting. A bash script may consist of nothing but a series of command lines, e.g. The following helloworld.sh script simply does an echo.

BASH Scripting. A bash script may consist of nothing but a series of command lines, e.g. The following helloworld.sh script simply does an echo. BASH Scripting bash is great for simple scripts that automate things you would otherwise by typing on the command line. Your command line skills will carry over to bash scripting and vice versa. bash comments

More information

Compilers I - Chapter 4: Generating Better Code

Compilers I - Chapter 4: Generating Better Code Compilers I - Chapter 4: Generating Better Code Lecturers: Paul Kelly (phjk@doc.ic.ac.uk) Office: room 304, William Penney Building Naranker Dulay (nd@doc.ic.ac.uk) Materials: Office: room 562 Textbook

More information

JavaScript: Introduction to Scripting. 2008 Pearson Education, Inc. All rights reserved.

JavaScript: Introduction to Scripting. 2008 Pearson Education, Inc. All rights reserved. 1 6 JavaScript: Introduction to Scripting 2 Comment is free, but facts are sacred. C. P. Scott The creditor hath a better memory than the debtor. James Howell When faced with a decision, I always ask,

More information

Introduction to Server-Side Programming. Charles Liu

Introduction to Server-Side Programming. Charles Liu Introduction to Server-Side Programming Charles Liu Overview 1. Basics of HTTP 2. PHP syntax 3. Server-side programming 4. Connecting to MySQL Request to a Static Site Server: 1. Homepage lookup 2. Send

More information

Name: Class: Date: 9. The compiler ignores all comments they are there strictly for the convenience of anyone reading the program.

Name: Class: Date: 9. The compiler ignores all comments they are there strictly for the convenience of anyone reading the program. Name: Class: Date: Exam #1 - Prep True/False Indicate whether the statement is true or false. 1. Programming is the process of writing a computer program in a language that the computer can respond to

More information

Layer Four Traceroute (and related tools) A modern, flexible path-discovery solution with advanced features for network (reverse) engineers

Layer Four Traceroute (and related tools) A modern, flexible path-discovery solution with advanced features for network (reverse) engineers Layer Four Traceroute (and related tools) A modern, flexible path-discovery solution with advanced features for network (reverse) engineers So, what is path discovery and why is it important? Path discovery

More information

LabTalk Programming Guide for Origin 8.5.1

LabTalk Programming Guide for Origin 8.5.1 LabTalk Programming Guide for Origin 8.5.1 Table of Contents 1 LabTalk Scripting Guide... 1 2 Introduction... 3 3 Getting Started with LabTalk... 5 3.1 Hello World...5 3.1.1 Script Window...5 3.1.2 Custom

More information

Data Structures and Algorithms V22.0102. Otávio Braga

Data Structures and Algorithms V22.0102. Otávio Braga Data Structures and Algorithms V22.0102 Otávio Braga We use a stack When an operand is read, output it When an operator is read Pop until the top of the stack has an element of lower precedence Then push

More information

CS 241 Data Organization Coding Standards

CS 241 Data Organization Coding Standards CS 241 Data Organization Coding Standards Brooke Chenoweth University of New Mexico Spring 2016 CS-241 Coding Standards All projects and labs must follow the great and hallowed CS-241 coding standards.

More information

Introduction to Matlab

Introduction to Matlab Introduction to Matlab Social Science Research Lab American University, Washington, D.C. Web. www.american.edu/provost/ctrl/pclabs.cfm Tel. x3862 Email. SSRL@American.edu Course Objective This course provides

More information

Detect and Sanitise Encoded Cross-Site Scripting and SQL Injection Attack Strings Using a Hash Map

Detect and Sanitise Encoded Cross-Site Scripting and SQL Injection Attack Strings Using a Hash Map Detect and Sanitise Encoded Cross-Site Scripting and SQL Injection Attack Strings Using a Hash Map Erwin Adi and Irene Salomo School of Computer Science BINUS International BINUS University, Indonesia

More information

Memory Systems. Static Random Access Memory (SRAM) Cell

Memory Systems. Static Random Access Memory (SRAM) Cell Memory Systems This chapter begins the discussion of memory systems from the implementation of a single bit. The architecture of memory chips is then constructed using arrays of bit implementations coupled

More information

Chapter 5 Names, Bindings, Type Checking, and Scopes

Chapter 5 Names, Bindings, Type Checking, and Scopes Chapter 5 Names, Bindings, Type Checking, and Scopes Chapter 5 Topics Introduction Names Variables The Concept of Binding Type Checking Strong Typing Scope Scope and Lifetime Referencing Environments Named

More information

MATLAB Basics MATLAB numbers and numeric formats

MATLAB Basics MATLAB numbers and numeric formats MATLAB Basics MATLAB numbers and numeric formats All numerical variables are stored in MATLAB in double precision floating-point form. (In fact it is possible to force some variables to be of other types

More information

THE VIKINGS. bbc.co.uk/handsonhistory

THE VIKINGS. bbc.co.uk/handsonhistory The Vikings are coming! The Vikings came from three countries, Denmark, Norway and Sweden. The name Viking comes from a language called Old Norse and means a pirate raid. People who went off raiding in

More information

TELE 301 Lecture 7: Linux/Unix file

TELE 301 Lecture 7: Linux/Unix file Overview Last Lecture Scripting This Lecture Linux/Unix file system Next Lecture System installation Sources Installation and Getting Started Guide Linux System Administrators Guide Chapter 6 in Principles

More information

Retrieving Data Using the SQL SELECT Statement. Copyright 2006, Oracle. All rights reserved.

Retrieving Data Using the SQL SELECT Statement. Copyright 2006, Oracle. All rights reserved. Retrieving Data Using the SQL SELECT Statement Objectives After completing this lesson, you should be able to do the following: List the capabilities of SQL SELECT statements Execute a basic SELECT statement

More information

Windows PowerShell Essentials

Windows PowerShell Essentials Windows PowerShell Essentials Windows PowerShell Essentials Edition 1.0. This ebook is provided for personal use only. Unauthorized use, reproduction and/or distribution strictly prohibited. All rights

More information

Web Services for Management Perl Library VMware ESX Server 3.5, VMware ESX Server 3i version 3.5, and VMware VirtualCenter 2.5

Web Services for Management Perl Library VMware ESX Server 3.5, VMware ESX Server 3i version 3.5, and VMware VirtualCenter 2.5 Technical Note Web Services for Management Perl Library VMware ESX Server 3.5, VMware ESX Server 3i version 3.5, and VMware VirtualCenter 2.5 In the VMware Infrastructure (VI) Perl Toolkit 1.5, VMware

More information

Hands-on Exercise 1: VBA Coding Basics

Hands-on Exercise 1: VBA Coding Basics Hands-on Exercise 1: VBA Coding Basics This exercise introduces the basics of coding in Access VBA. The concepts you will practise in this exercise are essential for successfully completing subsequent

More information

Oracle Database 10g: Introduction to SQL

Oracle Database 10g: Introduction to SQL Oracle University Contact Us: 1.800.529.0165 Oracle Database 10g: Introduction to SQL Duration: 5 Days What you will learn This course offers students an introduction to Oracle Database 10g database technology.

More information

SOME EXCEL FORMULAS AND FUNCTIONS

SOME EXCEL FORMULAS AND FUNCTIONS SOME EXCEL FORMULAS AND FUNCTIONS About calculation operators Operators specify the type of calculation that you want to perform on the elements of a formula. Microsoft Excel includes four different types

More information

Instruction Set Architecture (ISA)

Instruction Set Architecture (ISA) Instruction Set Architecture (ISA) * Instruction set architecture of a machine fills the semantic gap between the user and the machine. * ISA serves as the starting point for the design of a new machine

More information

Instant SQL Programming

Instant SQL Programming Instant SQL Programming Joe Celko Wrox Press Ltd. INSTANT Table of Contents Introduction 1 What Can SQL Do for Me? 2 Who Should Use This Book? 2 How To Use This Book 3 What You Should Know 3 Conventions

More information

10CS35: Data Structures Using C

10CS35: Data Structures Using C CS35: Data Structures Using C QUESTION BANK REVIEW OF STRUCTURES AND POINTERS, INTRODUCTION TO SPECIAL FEATURES OF C OBJECTIVE: Learn : Usage of structures, unions - a conventional tool for handling a

More information

Skills for Employment Investment Project (SEIP)

Skills for Employment Investment Project (SEIP) Skills for Employment Investment Project (SEIP) Standards/ Curriculum Format for Web Application Development Using DOT Net Course Duration: Three Months 1 Course Structure and Requirements Course Title:

More information

Here is a quick diagram of the ULV SSO/Sync Application. Number 3 is what we deal with in this document.

Here is a quick diagram of the ULV SSO/Sync Application. Number 3 is what we deal with in this document. University of La Verne Single-SignOn Project How this Single-SignOn thing is built, the requirements, and all the gotchas. Kenny Katzgrau, August 25, 2008 Contents: Pre-requisites Overview of ULV Project

More information

Debugging JavaScript and CSS Using Firebug. Harman Goei CSCI 571 1/27/13

Debugging JavaScript and CSS Using Firebug. Harman Goei CSCI 571 1/27/13 Debugging JavaScript and CSS Using Firebug Harman Goei CSCI 571 1/27/13 Notice for Copying JavaScript Code from these Slides When copying any JavaScript code from these slides, the console might return

More information

BHARATHIAR UNIVERSITY COIMBATORE 641 046. SCHOOL OF DISTANCE EDUCATION

BHARATHIAR UNIVERSITY COIMBATORE 641 046. SCHOOL OF DISTANCE EDUCATION Anx.31 M - PG Dip WebSer (SDE) 2007-08 Page 1 of 6 BHARATHIAR UNIVERSITY COIMBATORE 641 046. SCHOOL OF DISTANCE EDUCATION PG DIPLOMA IN WEB SERVICES (PGDWS) (Effective from the Academic Year 2007-2008)

More information