Universidade Estadual de Maringá



Similar documents
How is genome sequencing done?

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

DNA Sequence Analysis

Concepts and methods in sequencing and genome assembly

- In , Allan Maxam and walter Gilbert devised the first method for sequencing DNA fragments containing up to ~ 500 nucleotides.

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne

Sanger Sequencing. Troubleshooting Guide. Failed sequence

How many of you have checked out the web site on protein-dna interactions?

July 7th 2009 DNA sequencing

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

Reading DNA Sequences:

Dye-Blob message: Example: Generally, this is due to incomplete excess dye removal of the cycle sequence reaction.

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

An Overview of DNA Sequencing

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES

Introduction to next-generation sequencing data

The Biotechnology Education Company

DNA Sequencing & The Human Genome Project

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core

VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10

CHAPTER 5 Troubleshooting DNA Sequencing Data

Fluorescent dyes for use with the

Introduction To Real Time Quantitative PCR (qpcr)

14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2

PrimeSTAR HS DNA Polymerase

DNA sequencing. Dideoxy-terminating sequencing or Sanger dideoxy sequencing

DNA Sequencing Setup and Troubleshooting

Technical Note. Roche Applied Science. No. LC 19/2004. Color Compensation

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR

Illumina Sequencing Technology

Essentials of Real Time PCR. About Sequence Detection Chemistries

1/12 Dideoxy DNA Sequencing

BacReady TM Multiplex PCR System

Automated DNA Sequencing. Chemistry Guide

Genome Sequencer System. Amplicon Sequencing. Application Note No. 5 / February

DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE

Troubleshooting Sequencing Data

Description: Molecular Biology Services and DNA Sequencing

Real-Time PCR Vs. Traditional PCR

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Next Generation Sequencing

Cluster Generation. Module 2: Overview

Analysis of DNA methylation: bisulfite libraries and SOLiD sequencing

Handling next generation sequence data

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website

Procedures For DNA Sequencing

DNA Sequencing Troubleshooting Guide

restriction enzymes 350 Home R. Ward: Spring 2001

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova

Artisan Scientific is You~ Source for: Quality New and Certified-Used/Pre:-awned ECJuiflment

Nucleic Acid Techniques in Bacterial Systematics

A Guide to LAMP primer designing (PrimerExplorer V4)

mircute mirna qpcr Detection Kit (SYBR Green)

PicoMaxx High Fidelity PCR System

Sequencing the Human Genome

A Brief Guide to Interpreting the DNA Sequencing Electropherogram Version 3.0

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna

Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR. Protocol

DNA Core Facility: DNA Sequencing Guide

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476

TaqMan Fast Advanced Master Mix. Protocol

Real-time PCR: Understanding C t

CUSTOM DNA SEQUENCING SERVICES

Next Generation Sequencing for DUMMIES

Electrophoresis, cleaning up on spin-columns, labeling of PCR products and preparation extended products for sequencing

pcas-guide System Validation in Genome Editing

DNA Sequencing Handbook

PNA BRAF Mutation Detection Kit

SYBR Green Realtime PCR Master Mix -Plus-

Troubleshooting Overview

DNA SEQUENCING: A Sequencing Method Based on Real-Time Pyrophosphate. Mostafa Ronaghi, Mathias Uhlén, and Pål Nyrén *

PreciseTM Whitepaper

Algorithms for Next Generation Sequencing Data Analysis

Introduction. Preparation of Template DNA

First Strand cdna Synthesis

HiPer RT-PCR Teaching Kit

ZR DNA Sequencing Clean-up Kit

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.

RT rxns. RT rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053

First generation" sequencing technologies and genome assembly. Roger Bumgarner Associate Professor, Microbiology, UW

Data Analysis for Ion Torrent Sequencing

DNA sequencing is the process of determining the precise order of the nucleotide bases in a particular DNA molecule. In 1974, two methods of DNA

Computational Genomics. Next generation sequencing (NGS)

Automated DNA sequencing 20/12/2009. Next Generation Sequencing

DNA SEQUENCING (using an ABI automated sequencer)

Validating Microarray Data Using RT 2 Real-Time PCR Products

Single Nucleotide Polymorphisms (SNPs)

QPCR Applications using Stratagene s Mx Real-Time PCR Platform

Factors Influencing Multiplex Real-Time PCR

Bio 3A Lab: DNA Isolation and the Polymerase Chain Reaction

Mir-X mirna First-Strand Synthesis Kit User Manual

Beginner s Guide to Real-Time PCR

2.500 Threshold e Threshold. Exponential phase. Cycle Number

DNA FRAGMENT ANALYSIS by Capillary Electrophoresis

Transcription:

Universidade Estadual de Maringá Disciplina: Biologia Molecular Sequenciamento de ácidos nucléicos Profa. Dra. Maria Aparecida Fernandez

Maxan e Gilbert - quebra química Berg, Gilbert and Sanger dideoxinucleotideos

1977 Maxan e Gilbert - quebra química

Berg, Gilbert and Sanger dideoxinucleotideos

Pareamento de fitas de DNA H Invertido e Complementar P H 2 C H2C P H 2 C P H2C P P H 2 C H2C P H

Sanger Method 1. A single strand of DNA to be sequenced (yellow) is hybridized to a 5 end labeled synthetic deoxynucleotide primer(brown). 2. The primer is elongated using DNA polymerase in four separate reaction mixtures containing four normal deoxynucleotide triphosphates (dntps) plus one of dideoxynucleotide triphosphate (ddntps) in a ratio of 100 :1.

Alto peso molecular Filme de raio X Auto-radiograma Leitura manual Baixo peso molecular TGGCTCGGCCTCAAGTCGAG GTTATCAGATCTGCAACTCAA

Reação de seqüênciamento

Fragmentos amplificados na reação de seqüênciamento

Eletroforese no seqüênciamento

Captura do fluorescente e processamento da informação

MegaBACE 1000 array Capillary Array Cathode (-) Anode (+) Capillaries Cuvette Window

MegaBACE System

MegaBACE System

MegaBACE Sequencing System LPA Linear polyacrilamide

Data Processing Raw data electrophoretically separated and collected signal Electropherogram processed sequence

Basecalling Raw data Converting raw data to processed sequence

Basecalling Baseline subtraction Signal from all four channels adjusted to the same baseline

Basecalling Spectral separation Spectral overlap removed by the application of cross-talk values

Basecalling Mobility correction Differences in migration due to terminators corrected by mobility file (ABI) or basecaller (MegaBACE)

Basecalling Base assignment Nucleotide sequence assigned by a peak in the proper space

Electropherogram view

Sequence view

Peak spacing

ESD Fasta Sc Text fabd Start PointStop Point Confidence Adjustment

MegaBACE Sequence Analyzer v3.0 Viewing Ambiguous Bases in Ambiguous Mode

New DNA Sequencing Methods 1. Sequencing by MALDI-TF Mass Spectrometry 2. Sequencing by Hybridization 3. Pyrosequencing 4. Nanopore Sequencing 5. Atomic-Force Microscopy 6. Single-Molecule Fluorescence Microscopy

Sequencing by MALDI-TF Mass Spectrometry MW spectrum of 33-mer 5 -ACT AAT GGC AGT TCA TTG CAT GAA TTT TAA AAG-3

DNA Sequencing by Hybridization This strategy involved annealing a labeled unknown DNA fragment to a complete array of short oligonucleotides (e.g. all 65,336 combinations of 8mers) and deciphering the unknown sequence from the annealing pattern.

Emulsion Based Clonal Amplification A + PCR Reagents B Mix DNA Library & capture beads (limited dilution) + Emulsion il Create Water-in-oil emulsion Micro-reactors Break micro-reactors Isolate DNA containing beads Perform emulsion PCR Generation of millions of clonally amplified sequencing templates on each bead No cloning and colony picking

Depositing DNA Beads into the PicoTiter Plate Load beads into PicoTiter Plate Load Enzyme Beads Centrifuge Step 44 μm

Elegant ptics Design - No Alignment or Focus Ever! PicoTiterPlate Wells Reagent Flow Sequencing By Synthesis Photons Generated are Captured by Camera Sequencing Image Created

454 Sequencing Instrument 2. Load PicoTiter plate into instrument 3. Load Reagents in a single rack 4. Sequence Entire Genome at once, in real-time 1. Genome is loaded into a PicoTiter plate

Summary of Pyrosequencing Pyrosequencing is to sequence DNA by enzymatic DNA synthesis, and the DNA sequence is determined the from the signal peak of released photons during the synthesis.

454 Sequencing: BaseCalling Count the photons generated for each flow Base call using signal thresholds Delivery of one nucleotide per flow ensures accurate base calling 4-mer Flow rder T A C G Measures the presence or absence of each nucleotide at any given position 3-mer KEY (TCAG) 2-mer 1-mer

Three Examples of Read Length E. coli (51% GC) C. jejuni (30%GC) T. thermophilus (69% GC)

PIRSEQUENCIADRES