The Pennsylvania State University. The Graduate School. Department of Food Science THE DIFFERENTIAL PRO-OXIDANT EFFECTS OF THE TEA (CAMELLIA

Size: px
Start display at page:

Download "The Pennsylvania State University. The Graduate School. Department of Food Science THE DIFFERENTIAL PRO-OXIDANT EFFECTS OF THE TEA (CAMELLIA"

Transcription

1 The Pennsylvania State University The Graduate School Department of Food Science THE DIFFERENTIAL PRO-OXIDANT EFFECTS OF THE TEA (CAMELLIA SINENSIS) CATECHIN, (-)-EPIGALLOCATECHIN-3-GALLATE (EGCG), IN THE CONTEXT OF ORAL CANCER A Dissertation in Food Science by Ling Tao 2015 Ling Tao Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy May 2015

2 The dissertation of Ling Tao was reviewed and approved* by the following: Joshua D. Lambert Associate Professor of Food Science Dissertation Advisor Chair of Committee Gregory R. Ziegler Professor of Food Science Ryan J. Elias Associate Professor of Food Science Karam El-Bayoumy Distinguished Professor of Biochemistry and Molecular Biology Robert F. Roberts Professor of Food Science Head of the Department of Food Science *Signatures are on file in the Graduate School

3 ABSTRACT iii In the United States, an estimated 45,780 new cases and 8,650 deaths from cancers of the oral cavity and pharynx (throat) are expected in Dietary intervention is one potential strategy to reduce cancer burden. (-)-Epigallocatechin-3-gallate (EGCG) is the most abundant polyphenol in green tea. Although widely considered as an antioxidant, recently a growing number of evidence shows that EGCG may exert pro-oxidant effects. EGCG has been found to undergo auto-oxidation upon the exposure to oxygen and transition metals to form reactive oxygen species (ROS). However, the role of EGCGinduced ROS and the differential effects of EGCG-induced ROS in cancer versus normal cells are poorly understood. Therefore, this thesis aims to provide insight into EGCG s pro-oxidant activities, with a focus on the potential differential effects in oral cancer and normal cells. To explore the question, I treated the oral cancer cells with EGCG and detected intracellular ROS. First, I found that in oral cancer cells EGCG initially caused ROS formation localized in mitochondria, which resulted in mitochondrial dysfunction including the loss of mitochondrial membrane potential and the opening of the mitochondrial membrane transition pore. The accumulated mitochondrial ROS (mtros) and mitochondrial dysfunction led to a systemic ROS burst and ultimately cell death. Interestingly, EGCG did not induce significant cell cytotoxicity and apoptosis in normal cells. In contrast to the ROS burst in oral cancer cells, no significant increase of ROS was observed in normal cells as well. PCR array analysis showed that EGCG down-regulated several antioxidant related genes in cancer cells (superoxide dismutase 2/3 and

4 thioredoxin reductase 2), but up-regulated them in normal cells. The data suggest that iv EGCG exerts differential pro-oxidant effects in oral cancer and normal cells, in part through modulating antioxidant signaling. In order to better understand the differential effects of EGCG, I examined the impact of EGCG on sirtuin3 (SIRT3). SIRT3 is a deacetylase localized in mitochondria that regulates the redox balance in that organelle. I found that EGCG suppressed the gene and protein expression as well as the activity of SIRT3 in cancer cells. By contrast, EGCG activated SIRT3 in normal cells, however, no significant changes in the mrna and protein level of SIRT3 were observed. Further, I observed that estrogen-related receptor α (ERRα), a transcriptional factor of SIRT3, was selectively down-regulated by EGCG in cancer cells, indicating that EGCG may differentially modulate the mrna expression of SIRT3 through ERRα. EGCG also differentially modulated the mrna levels of SIRT3-associated downstream genes including glutathione peroxidase 1 and superoxide dismutase 2 in normal and oral cancer cells. To determine the necessity of SIRT3 for EGCG s differential pro-oxidant effects, I knocked down SIRT3 through sirna technology. Interestingly, sirna-mediated knock-down of SIRT3 in cancer cells (SCC-25) resulted in decreased ROS, rendering a cell resistance to EGCG-induced growth inhibition. Accordingly, the mrna levels of MT1G, MT1X and metal regulatory transcription factor 1 (MTF1), a transcriptional factor of MTs were significantly increased. MTs belong to a group of cysteine-rich, low molecular weight proteins. They are localized in cytoplasm and function as antioxidant through oxidation of thiol groups. Therefore, the up-regulated MTs and MTF1 expressions in si-sirt3 cells suggest that MT may be an alternative modulator of

5 intracellular antioxidant signaling. Further, I found EGCG down-regulated most MT v isoforms in oral cancer cells, while up-regulating several MTs in normal cells, particularly MT1G (+20,900%) and MT1X (+350%). On the other hand, knocking down MTF1 in SCC-25 cells significantly decreased mrna expression of MTs, SIRT3, NFE2L1 and NFE2L2. This indicates a crosstalk between SIRT3 and MT signaling that may be mediated by MTF1. Furthermore, EGCG decreased the transcriptional activity of MTF1 in cancer cells but slightly increased the activity in normal cells. In conclusion, EGCG induced oxidative stress and apoptosis in oral cancer cells, but triggered antioxidant responses in normal cells. SIRT3 and MT appear to be molecular mediators of EGCG-induced differential pro-oxidant effects in oral cells. Moreover, a potential crosstalk between SIRT3 and MT signaling was identified and may be mediated by MTF1. Taken together, the current study provides novel mechanisms under which EGCG exerts differential pro-oxidant effects in oral cancer versus normal cells. The mechanistic study will provide helpful information for future work with oral cancer animal model.

6 TABLE OF CONTENTS vi List of Figures... ix List of Tables... xi Acknowledgements... xii Chapter 1 Literature Review and Research Objectives Oral Cancer Oral Cancer Statistics Risk Factors Treatment and Prevention Tea and EGCG Introduction of Tea The uptake, bioavailability and biotransformation of EGCG EGCG/Green Tea and oral cancer prevention Pro-oxidant effects of EGCG Generation of ROS by EGCG Direct antioxidant effects of tea polyphenols Direct pro-oxidant effects of tea polyphenol Indirect antioxidant effects of tea polyphenols Selectivity of EGCG Research Objectives References Chapter 2 The role of the mitochondrial oxidative stress in the pro-oxidant effects of the green tea catechin, (-)-epigallocatechin-3-gallate, in oral cells Abstract Introduction Materials and Methods Chemicals and reagents Cell culture and viability studies Induction of apoptosis Stability and Intracellular Levels of EGCG H2O2 determination in cell culture medium Determination of intracellular ROS Confocal microscopy Determination of mitochondria-specific ROS Mitochondrial membrane potential Detection of MPTP opening Gene expression studies Western blot analysis Statistical Analysis... 50

7 vii 2.4 Results EGCG-induced different levels of growth inhibition and apoptosis in normal and oral cancer cells EGCG-induced differential intracellular oxidative environments in SCC-25 and HGF-1 cells EGCG-induced changes in oxidative stress/antioxidant genes in SCC-25 and HGF-1 cells Effects of EGCG-induced extracellular ROS in cancer cells Role of the mitochondrial ROS in EGCG-induced apoptosis in SCC-25 cells Discussion References Chapter 3 The differential pro-oxidative effects of the green tea polyphenol, (-)- epigallocatechin-3-gallate, in normal and oral cancer cells are related to differences in sirtuin 3 signaling Abstract Introduction Materials and Methods Chemicals and reagents Cell culture Determination of mitochondria-specific ROS Mitochondrial membrane potential Intracellular levels of EGCG Gene expression studies Western blot analysis SIRT3 activity assay Statistical Analysis Results EGCG-induced production of mitochondrial ROS and dysfunction Intracellular EGCG levels EGCG-induced changes in SIRT3 expression and activity EGCG-induced changes in ERRα and PGC-1 expression and localization EGCG-induced differential changes in SIRT3 downstream gene expressions Discussion References Chapter 4 The role of metallothioneins in the differential pro-oxidant effects of (-)- epigallocatechin-3-gallate (EGCG) in oral cells Abstract Introduction Materials and Methods

8 viii Chemicals and reagents Cell culture Determination of total intracellular ROS Knocking down the expression of SIRT3 and MTF Gene expression studies Statistical Analysis Results The knock-down of SIRT3 in SCC-25 cells EGCG-induced differential changes of MTs mrna expression in oral cancer and normal cells The knocked-down of MTF1 in SCC-25 cells The effect of EGCG on mrna expression as well as transcriptional activity of MTF1 in SCC-25 cells Discussion References Chapter 5 Conclusions and Recommendations for Future Work Conclusions Future Work The effect of EGCG on free zinc distribution and concentration in SCC-25 cells The culture of primary epithelial cells The effect of EGCG on oral cancer prevention in an established animal model Reference Appendix A The effects of (-)-epigallocatechin-3-gallate (EGCG) on antioxidant gene expressions and enzyme activities in healthy mice

9 LIST OF FIGURES ix Figure 1-1. Structures of major green tea catechins Figure 1-2. Biotransformation of the green tea catechins... 8 Figure 1-3. Generation of ROS by EGCG Figure 2-1. EGCG-mediated growth inhibition and apoptosis in oral cells Figure 2-2. EGCG-induced differential oxidative environments in SCC-25 and HGF-1 cells Figure 2-3. EGCG stability and production of H2O2 under cell culture conditions Figure 2-4. EGCG-induced mitochondrial ROS in SCC-25 cells Figure 2-5. The role of EGCG-induced mitochondrial ROS in apoptosis Figure 2-6. EGCG-induced differential pro-oxidant effects in oral cancer and normal cells Figure 3-1. EGCG-induced mitochondrial reactive oxygen species and changes in mitochondrial membrane potential in oral cells Figure 3-2. EGCG-induced differential changes of SIRT3 expression and activity in oral cells Figure 3-3. EGCG-induced differential changes of ERRα expression and nuclear localization in oral cells Figure 3-4. EGCG-induced differential changes of PGC-1α expression and nuclear localization in oral cells Figure 3-5. EGCG-induced differential changes of SIRT3-mediated downstream genes in oral cells Figure 3-6. A proposed mechanism for the differential pro-oxidant effects of EGCG in normal and oral cancer cells Figure 4-1. The knock-down of SIRT3 on SCC-25 cells Figure 4-2. The upregulation of MT genes in si-sirt3 cells Figure 4-3. EGCG-induced changes of MTs mrna expression in SCC-25 and HGF-1 cells Figure 4-4. The knock-down of MTF1 on SCC-25 cells

10 x Figure 4-5. The regulation of MTF1 by EGCG Figure 4-6. The scheme of EGCG s differential pro-oxidant effects through mediating MT signaling Figure 5-1. EGCG-mediated differential pro-oxidant effects through mediating MT and SIRT3 signaling

11 LIST OF TABLES xi Table 1-1. Clinical trials with Green tea or EGCG on oral cancer prevention Table 2-1. Expression of oxidative stress-related genes in EGCG-treated oral cells.. 58 Table 3-1. Primer sequences used in qpcr Table 4-1. Primer sequences used in qpcr

12 ACKNOWLEDGEMENTS xii First and foremost, I would like to give my deepest gratitude to my advisor, Dr. Joshua Lambert, a respectable, responsible and resourceful scientist, who has provided me with valuable guidance in every stage of my Ph.D. research during the last four and half years. Without his enlightening instructions, impressive kindness and heartful support, I could not fully accomplish my Ph.D. study. I also feel grateful to Dr. Ryan J. Elias, Dr. Gregory R. Ziegler, and Dr. Karam El-Bayoumy for being my committee members and providing their guidance, equipment, and laboratory techniques. Additionally, I appreciate the helpful suggestions and guidance for my research from scholars at Penn State and other Universities: Dr. Stephen Knabel, Dr. Jack (John) Vanden Heuvel, Dr. Andrew Patterson, Dr. Philip Smith, Dr. Shannon Kelleher, Dr. Cesar Aliaga, Dr. Angelo Azzi, Dr. Xingen Lei, Dr. Xiang-dong Wang, Dr. Thomas Wang, Dr. Robert Chapkin, Dr. Elizabeth H. Jeffery and others. I would like to thank all of my labmates and colleagues in the Food Science and Nutrition Department for their help and support. Particularly, I would like to thank Dr. Sarah Forester, Dr. Sudathip Sae-tan, Dr. Tongtong Xu, Ms. Mingyao Sun, Mr. Jong- Yung Park, Ms. Li Wang and Ms. SooYeon (Jenny) Lee for their tremendous help with my experiments. Not only we had a good time working together, but we also develop an ever-lasting friendship. I also want to give my special thanks to God and the Christian community in State College. My life has changed significantly toward a healthier and better direction after I believe in God. It is God that teaches me to share love with people and to be optimistic

13 xiii when facing difficulties. I sincerely appreciate the guidance of Marleen Ford and Bob Ford to help me get closer to God. I also give thanks to Mary Kay Horton, Sunny Jun, Katie Tenny, Emily Crawford, Dorothy Worden, Noel Habashy and so on for their willingness to hear my concerns and help me out through God s hand. Besides, I shall extend my thanks to my beloved parents. Although they are far away in China, they always encourage me when I feel frustrated. They spend all their life culturing and educating me into a healthy, smart and kind girl. Thank you, Dad and Mom, I love you! Last but not least, I would like to thank all my friends, especially Hongcheng Liu who takes a good care of me at State College, making me feel like home. Other friends I would like to thank include: Rachel Shegog, Kaitlyn Nelson, Tong Zhu, Renzhong Du, Di Lu & Zhaoyong Ba, Lingzi Xiaoli, Lingyan Kong, Yu Zhao, etc. Thank you all for shaping a better Ling!

14 1 Chapter 1 Literature Review and Research Objectives 1.1 Oral Cancer Oral Cancer Statistics Oral cancer as a type of head and neck cancer is any cancerous tissue growth initiated in the oral cavity. In 2012, the worldwide oral cancer incidence and mortality reached 300,000 and 150,000 (both ranked 15 th in all cancers excluding non-melanoma skin cancer) 2. More men than women develop oral cancer and it is more prevalent in developing countries than developed countries 3. Nevertheless, in the United States, an estimated 45,780 new cases and 8,650 deaths from cancers of the oral cavity and pharynx (throat) are expected in Oral squamous cell carcinoma (SCC) is the most common type which accounts for greater than 90% of oral cancers and can develop from oral precancerous lesions including leukoplakia and erythroplakia Risk Factors Tobacco use and alcohol consumption are considered the most important risk factors for oral cancer. All types of Tobacco use including tobacco chewing, high number of cigarettes per day, young age smoking and deep smoke inhalation will increase the risk of oral cancer. Tobacco chewing has been found to cause oral and oropharyngeal SCC in

15 the Indian subcontinent, parts of South-East Asia, China and Taiwan, especially when 2 consumed in betel quids containing areca nut 6. For example, in India, chewing tobacco accounts for nearly 50% of oral and oropharyngeal tumors in men and over 90% in women 7. Heavy consumption of all types of alcoholic beverages (wine, beer, hard liquors) confers an increased risk 8, 9. Moreover, smoking and drinking may have synergistic effects in oral cancer development 10. Human papilloma virus (HPV) infection has also been associated with oral cancer incidence 11. HPV-16 and -18 have been the most common virus types identified 12. In vitro, HPV-16 and HPV-18 have been shown to transform normal human oral keratinocytes to oncogenic cells which show immortality and altered morphology in comparison with their normal counterparts. HPV-immortalized cells contain multiple copies of intact viral genome expressing several viral-specific mrnas and also have low levels of p53 protein and overexpressed cellular myc proto-oncogene 13. However, the transformed cells are non-tumorigenic in nude mice Treatment and Prevention Like other cancers, multiple approaches can be used to treat oral cancer including surgery, radiation and chemotherapy. For early stage disease, removal of tumor tissue along with a small margin of normal tissue may be efficient to prevent the progression of oral cancer 14. If there is any recurrence, radiation therapy is usually required. Chemotherapy may be given with radiation to treat any cancer remaining after surgery 14. No matter what method is used, the treatment will cause severe side effects. For example,

16 surgery may result in facial disfigurement; radiation and chemotherapy may cause 3 damage to healthy cells. Therefore, preventing cancer appears to be a more plausible strategy than cancer treatment. Diet has been closely associated with oral cancer prevention. More than 40 epidemiologic studies 15, systematic reviews 16, 17 and a meta-analysis 18 have reported a potential protective role of vegetables and fruits, particularly citrus fruits, in the prevention of oral cancer. By contrast, researchers have found that consumption of salted meat, processed meat and animal fat increases the risk of developing oral cancer Tea and EGCG Introduction of Tea Tea (Camellia sinensis) is the most widely consumed beverage in the world after water 22. There are four common types of tea: black, oolong, white and green tea which differ in terms of how they are processed. Black tea is processed in such a way as to allow a degree of polyphenol oxidase-catalyzed oxidation to occur and results in catechin condensation yielding theaflavins and thearubigins 22. Theaflavin, theaflavin-3-gallate, theaflavin-3'-gallate, and theaflavin-3,3'-digallate (TFdiG) are the major black tea polyphenols 23. Oolong tea is partially oxidized product that has a unique and understudied chemistry 22. Comparatively, white and green tea are processed in a way that minimizes oxidation (white, directly steam before drying; green, wither, steam or panfry before drying). The process helps preserve the characteristic flavan-3-ols known as catechins. According to the USDA Database for the Flavonoid Content of Selected Foods

17 (2013), brewed green tea (1 g in 100 ml water) contains the highest amount of 4 catechins 24. The major green tea catechins include: (-)-epicatechin (EC), (-)-epigallocatechin (EGC), (-)-epicatechin-3-gallate (ECG), and (-)-epigallocatechin-3-gallate (EGCG) 25 (Figure 1-1). EGCG is the most abundant catechin in green tea: one cup of 1.25% (w/v) green tea (250 ml) has approximately 177 mg EGCG which accounts for 50% of total catechins

18 5 (-)-epicatechin (-)-epigallocatechin (-)-epicatechin-3-gallate (-)-epigallocatechin-3-gallate Figure 1-1. Structures of major green tea catechins.

19 1.2.2 The uptake, bioavailability and biotransformation of EGCG 6 Hong et al. analyzed the uptake and distribution of EGCG in HT-29 colon cancer cells 29. After adding [ 3 H] EGCG to the cell culture system, the uptake of EGCG by HT- 29 cells increased in a concentration-dependent manner and did not plateau, suggesting a passive diffusion process. EGCG is predicted to have poor oral absorption according to Lipinski s Rule of 5: compounds that have five or more hydrogen bond donors (OH and NH groups), 10 or more hydrogen bond acceptors (notably N and O), and a molecular weight greater than 500 usually have poor absorption due to their large nominal size (high molecular weight) and large effective size (due to the formation of a large hydration shell) 30. In rats, treatment with a green tea polyphenol preparation (0.6% w/v) in the drinking fluid resulted in increasing plasma levels of EGCG, EGC and EC up to 14 days 31. The highest EGCG levels were found in the rat esophagus, intestine and colon, whereas EGCG levels were lower in the bladder, kidney, lung and prostate. Following a single oral dose of EGCG, the absolute oral bioavailability of EGCG in mouse was examined to be 26.5%, which was significantly greater than the bioavailability in rats (1%) given the same dose 32. Several studies have also examined the bioavailability of EGCG in human volunteers. For example, oral administration of 20 mg green tea solids/kg body weight resulted in maximum plasma concentration (Cmax) of EGCG, EGC, and EC to be 170.1, and nm 31. After ingestion, EGCG and other tea catechins undergoes glucuronidation, sulfation, methylation and ring fission metabolism (Figure ) 34. EGCG-4 -O-glucuronide is the major metabolite formed in human, mouse and rat microsomes 35. Besides, EGCG was found to be time- and concentration-dependently

20 7 sulfated in human, mouse and rat liver 36. Methylated EGCG has been found in humans as well (Forester et al., unpublished data). In addition to these conjugation reactions, the tea catechins undergo metabolism in the gut to form the ring fission products 5-(3,4,5 - trihydroxyphenyl)-γ-valerolactone (M4) and 5-(3,4 -dihydroxyphenyl)-γ-valerolactone (M6) 37. These ring fission products were found to present in human urine (4 8 μm/l) and plasma ( μm/l) approximately 13 h after oral ingestion of 20 mg/kg decaffeinated green tea. The extensive metabolism results in low systemic bioavailability. In contrast to the low systemic bioavailability, chewing or holding green tea leaves orally can achieve local salivary concentrations of 180 µm EGCG in saliva (elimination halflife = 31 min) 38. We have also found that chewing green tea extract-containing chewing gum (50 mg extract) can result in salivary concentrations of EGCG in excess of 5 mm (Lambert et al., unpublished data).

21 8 Figure 1-2. Biotransformation of the green tea catechins. 4 -MeEGC, 4 -O-methyl- (-)-epigallocatechin; 4,4 -di-o-methyl EGCG, 4,4 -di-o-methyl-(-)-epigallocatechin- 3-gallate; COMT, catechol-o-methyltransferase; EGC, (-)-epigallocatechin; EGCG, (-)- epigallocatechin-3-gallate; SAH, S-adenosylhomocysteine; SAM, S-adenosylmethionine; SULT, sulfotransferase; UGT, UDP-glucuronosyltransferase (cited from Yang et al. 33 ).

22 1.3 EGCG/Green Tea and oral cancer prevention 9 A number of studies have suggested the potential beneficial effects of EGCG/green tea on oral cancer. This review will summarize cell culture, animal, epidemiological as well as clinical studies. EGCG has been reported to cause cytotoxicity in oral cancer cells in culture. The cytotoxic effects appear to be specific to cancer cells. For example, Weisburg et al. examined the effects of EGCG and tea extracts on multiple cancer and normal cells from the human oral cavity 39. They found that tea polyphenolic extracts and EGCG had antiproliferative effects in immortalized cells (CAL27, HSC-2, HSG1 and S-G). The effects were more pronounced toward cancer cells than normal (GN56 and HGF-1) fibroblasts. In addition to cell culture studies, EGCG has also been reported to exert inhibitory effects on oral carcinogenesis in various animal models. For instance, a recent study found that EGCG suppressed tumor growth and induce apoptosis in C3H/HeJ syngeneic mice 40. EGCG also inhibited 7,12-dimethylbenz[a]anthracene (DMBA)-induced carcinogenesis in the hamster cheek pouch 41. A prospective cohort study followed 20,550 men and 29,671 women for an average of 10.3 years and estimated the hazard ratios (HRs) (95% CI) of green tea consumption in oral cancer incidence in Japan 42. For women, HRs (95% CI) were 0.51 ( ), 0.60 ( ) and 0.31 ( ) for green tea consumption of 1-2, 3-4 and 5 cups per day respectively, compared with those who consumed less than one cup per day (P for trend, 0.08). For men, no trend was observed. Interestingly, another study pooled individual-level data from nine case control studies of head and neck cancers,

23 10 including 5,139 cases and 9,028 controls, and showed no association of tea intake with head and neck cancer risk but an inverse association between caffeinated coffee intake and the risk of cancer of the oral cavity and pharynx 43. The authors explained that this may be attributed to the low consumption of tea, compared to caffeinated coffee, in European and American populations and the higher likelihood of misclassification. The number of clinical trials involving EGCG or green tea and oral cancer is very limited. As of 2010, there are only two reported green tea-related oral cancer trials 44. Both of the reported revealed positive effects of green tea in oral leukoplakia 45 or high risk oral premalignant lesions 46. As of Oct. 2014, two more trials are on-going. The updated clinical trials are listed in Table 1-1. In a six-month crossover chemoprevention clinical trial of tea in smokers and non-smokers, a high rate of attrition, especially among smokers, was observed 47. Therefore, no further clinical data could be achieved. The other study investigated the feasibility of using EGCG, in a form of swish-and-spit mouthwash to prevent recurrence of oral neoplastic lesions 48. Although not statistically significant, the researchers observed overall decrease in expression levels of cancerassociated markers such as pegfr (27.5%), cox-2 (15.9%) and ki-67 positive cells (51.8%) following EGCG treatment.

24 Table 1-1. Clinical trials with Green tea or EGCG on oral cancer prevention. 11 (updated from Kim et al. 44 ) Oral Cancer Reference Type of Clinical Trial Subjects Treatments Results Leukoplakia Li et al., Randomized, 59 patients with 3 g of mixed tea daily 37.9% double oral mucosa (760 mg mixed tea response rate blinded, leukoplakia capsule, q.i.d.) plus in treatment placebo topical treatment with arm vs 10% controlled trial mixed tea in glycerin at in control 10%, t.i.d. arm Cancer at Pisters et Phase I trial 49 patients ( g/m 2 Green tea No major different al., had non-small- extract (GTE) with dose clinical sites cell lung, 19 had escalation scheme up to 8 Response; including head and neck cancer head & neck cancer, 3 had mesothelioma, and 6 had others) g/m 2 GTE; Each GTE capsule contained 13.2% EGCG) The maximumtolerated dose was 4.2 g/m 2 once daily or 1.0 g/m 2 three times daily.

25 Table 1-1 Con t 12 Oral Cancer Reference Type of Clinical Trial Subjects Treatments Results High-risk Tsao et Phase II trial 41 patients with Placebo TID, vs GTE 50% response oral al., high risk OPLs capsule, 500 mg/m 2 t.i.d. rate in premalignan vs 750 mg/m 2 t.i.d. vs treatment arm t lesions 1,000 mg/m 2 t.i.d. (132 vs 18.2% in (OPLs) mg/m 2 t.i.d. EGCG) placebo arm No Dash et Randomized, 65 participants Green tea, black tea, High rate of evidence of al., placeobo (32 smokers and caffeinated water and dropout OPLs or controlled, 33 non-smokers) placebo each for 4 wks (51%) from cancer crossover trial with 2 wks of washout the study; Smokers have higher dropout rate; Multi-arm crossover trial might pose a high burden on participants

26 13 Recurrent Yoon et Pilot trial 7 patients with EGCG mouse wash (1.4g Not oral al., evidence of oral P-70A containing 800 statistically neoplastic field mg EGCG with 15 ml significant lesion cancerization Ora-Blend; but overall but no evidence of active oral Once a day for 7 days decrease of pegfr, cox- squamous 2 and ki-67 carcinoma positive cells after EGCG treatment; EGCG was found in saliva but not in plasma after 1 wk treatment

27 1.4 Pro-oxidant effects of EGCG 14 A number of studies have examined the putative mechanisms of cancer prevention by EGCG. As reviewed by Yang et al. 51, these mechanisms include targeting a number of signaling modulators involved in cell growth, proliferation, apoptosis, migration and metastasis, as well as antioxidant and pro-oxidant effects. Although, EGCG is widely considered as an antioxidant, recently, increasing evidence indicates a role for prooxidant effects of EGCG in cancer inhibition 1, 52. Especially, in the oral cavity which is exposed to oxygen, EGCG is prone to oxidation and producing ROS that may trigger redox signaling to modulate oral carcinogenesis Generation of ROS by EGCG Figure 1-3. Generation of ROS by EGCG. Oxidative reaction between EGCG, superoxide, and ferric iron resulting in the production of oxidative stress, EGCG dimers, and EGCG-cysteine conjugates (EGCG-SR). PhO = semiquinone radical (cited from Lambert and Elias, ). As shown in Figure 1-3, EGCG interacts with the superoxide anion resulting in an autooxidation that produces an EGCG semiquinone and hydrogen peroxide (H2O2) 53. The semiquinone is rather active and it can either react with EGCG to form reactive dimers or produce a more stable quinone which may further bind to thiol-containing proteins (or amino

28 15 acids) to form EGCG-protein conjugates (i.e. EGCG-cysteine conjugate). These reactions occur both in vitro and in vivo 29, Addition of superoxide dismutase (SOD) has been shown to reduce the auto-oxidation of EGCG and increase EGCG stability 54. In vivo, the redox effects of EGCG become increasingly complicated since EGCG can cause 1) inhibition of the redox-sensitive transcription factors such as nuclear factor NF-κB and activator protein-1; 2) inhibition of pro-oxidant enzymes, such as inducible nitric oxide synthase, lipoxygenases, cyclooxygenases and xanthine oxidase; and 3) induction of phase II and antioxidant enzymes (glutathiones-transferases and superoxide dismutases, etc) which may be regulated by nuclear factor (erythroid-derived 2)-like 2 (Nrf2) 52, 57. In the following sections, I will discuss the antioxidant and pro-oxidant activities of tea polyphenols and their relevance to cancer, with a focus on human studies, as well as, mechanism-driven in vitro and animal studies Direct antioxidant effects of tea polyphenols In vitro In different systems, tea catechins have been identified as effective scavengers of physiologically relevant reactive oxygen and nitrogen species, including superoxide 58, 59, peroxyl radicals, singlet oxygen 60, peroxynitrite 61-63, and hypochlorous acid 64. Tea polyphenols also show strong antioxidant activity against lipid peroxidation in large unilammelar liposomes composed of egg yolk phosphatidylcholine 65. Chelation of metal ions, such as iron and copper, was associated with antioxidant activity of tea polyphenols. However, the interaction between tea polyphenols and metals remains

29 unclear since tea catechins have been reported to have antioxidant activity in corn oil 16 triglycerides and soy lecithin liposomes but show pro-oxidant activity in corn-in-oil emulsions containing trace transition metals. Whether tea catechins act as antioxidants or pro-oxidants seems to be dependent on the lipid system and the presence of metal catalysts 69. Green tea and tea polyphenols have shown antioxidant activity in various cell culture systems, especially in those with preexisting oxidative stress. For example, supplementation of the Jurkat T-cells with 10 mg/l green tea extract significantly decreased lipid peroxidation and DNA damage induced by ferrous ions (Fe 2+ ) 70. Since only green tea was used, no information was obtained as to which component or components in green tea were most important. Another study examined the effects of green tea extract, Polyphenon-60 (PP-60, extract containing 60% polyphenols), ECG and EGCG in normal (UROtsa) and tumorigenic human bladder cells (RT4, SW780, TCCSUP, T24) following 1 mm H2O2 treatment. The results showed that treatment with PP-60, ECG and EGCG significantly alleviated H2O2-induced cytotoxicity in all three cell lines, with strongest effects elicited by ECG 71. Similarly, ECG was reported to protect human keratinocytes against ultraviolet A (UVA) light-induced H2O2 and cell death 72. Besides, EGCG has been reported to have protective effects against oxidative membrane damage 73 and genotoxicity 74 in cell culture. A comparative study of green tea, black tea or other herbal tea showed that green tea had significantly higher antioxidant activity than black tea under the same brewing conditions 75. Green tea has also been shown to have higher nitric oxide (NO) scavenging activity than rosemary (Rosmarinus officinalis), sweet osmanthus (Osmanthus fragrans), rose (Rosa spp.), lavender (Lavandula

30 angustifolia), jasmine (Jasminum officinale), lemongrass (Cymbopogon citratus) and 17 daisy (Bellis perennis) tea In vivo A number of in vivo studies have examined the antioxidant activity of tea polyphenols. In UV-B-radiated C3H/HeN mice, topical pretreatment with EGCG decreased the production of H2O2 and NO in both epidermis and dermis at a UV-Birradiated site 77. In another study, green tea treatment (6.5 mg/kg bw per day for 5 d) reduced markers of oxidative stress in the lymphocytes, colon, and liver of treated rats, while no effect was seen with a lower dose (1.3 mg/kg bw per day, 5 d) 78. Green tea catechins (0.1% w/v) also reduced N-nitrosobis (2-oxopropyl) amine (BOP)-induced oxidative stress in pancreas and liver of hamsters 79. Ozercan et al., found that EGCG decreased liver levels of malondialdehyde and tumor necrosis factor alpha concentration in a quail model of human fibroid tumors, indicating a reduction of oxidative stress 80. Several human intervention studies have demonstrated the potential antioxidant activity of green tea and its polyphenols. Katiyar et al found that topical EGCG treatment reduced lymphocyte infiltration and oxidative stress in UVB-irradiated skin 81. There is also data suggesting that regular green tea consumption can protect smokers from oxidative damage induced by smoking 82. These effects were most significant in a subgroup of smokers who are glutathione S-transferase mu 1 and/or glutathione S- transferase theta 1 positive 83. A blinded human cross-over intervention study showed that 3 wk treatment with green tea extract (18.6 mg catechins/d) increased plasma antioxidant

31 18 capacity from 1.35 to 1.56 (P<0.02), most prominently in smokers 84. Another study on 10 healthy subjects revealed that total antioxidant capacity of plasma was significantly increased by consumption of green tea (brewed with 5-7 g green tea leaves per serving) 85. Nevertheless, it should be noticed that the increase of antioxidant capacity may also be caused by EGCG-induced antioxidant responses in the system. Hence, further evidence such as EGCG bioavailability and antioxidant signaling should be provided to elucidate the specific role of EGCG Direct pro-oxidant effects of tea polyphenol In vitro Tea polyphenols have been shown to be unstable under cell culture media. For example, EGCG (20 μm) decreased rapidly in Ham s F12 and RPMI-1640 (50:50) medium with a half-life of 30 min. After 6 h, EGCG could not be detected 86. Yang et al. reported that decreasing extracellular level of H2O2 by addition of catalase (50 units/ml) in RPMI 1640 medium partially blocked EGCG-induced cell growth inhibition but abolished EGCG-induced apoptosis in human lung adenocarcinoma cell lines (H661 and H1299) 87. The same group later found that the addition of catalase partially eliminated the apoptotic effects of EGCG and EGC in Ha-ras-transformed 21BES human bronchial epithelial cells 88. There are conflicting results from inclusion of exogenous superoxide dismutase (SOD). Some studies have shown suppressive effects of SOD on EGCGmediated growth inhibition and apoptosis, while others have found that SOD can enhance growth inhibition 89. This may be explained by the dual effects of SOD: reduction of the

32 auto-oxidation and increase of EGCG stability 54. In summary, the extracellular ROS - 19 produced by auto-oxidation of EGCG may play a role in EGCG-induced cancer cell growth inhibition and/or apoptosis. Yet, this role could be largely impacted by the cell type and growth conditions. Because SOD and catalase are not cell permeable, it is possible that tea polyphenols can undergo auto-oxidation inside the cell, and these may impact cell viability 90, 91. Elbling et al. have reported the dose-dependent intracellular ROS production and concomitant DNA damage after EGCG treatment 90. Treatment with N-acetyl cysteine (NAC) is hypothesized to eliminate intracellular ROS, however, the effects of NAC appear to vary depending on cell type and experimental conditions. In some cell lines, NAC reduces intracellular ROS, whereas in others, NAC reacts with EGCG and enhances EGCG-mediated cell killing effects In vivo Very few studies have investigated the pro-oxidant effects of tea polyphenols in vivo. One study found that oral administration of EGCG to H1299 human lung cancer xenograft-bearing nu/nu mice dose-dependently inhibited tumor growth and induced tumor cell apoptosis. These effects correlated with tumor cell-specific increases in 8- hydroxy-2-deoxyguanosine (8-OHdG) and phosphorylated histone 2A variant X (γ- H2AX) 95. In another study of prostate cancer, treatment of Lobund-Wistar rats with decaffeinated green tea extract for up to 26 months reduced tumor incidence by approximately 50% compared with an age-matched cohort receiving just water. The

33 decrease in tumor formation was associated with an increase in 8-OHdG and 4-20 hydroxynonenal content (lipid peroxidation) in the epithelium of the ventral prostate in aging animals. In addition, there was an increase in 8-OHdG expression, but no change in 4-hydroxynonenal expression in the seminal vesicles of older animals 96. Lambert et al. found that salivary H2O2 levels increased when healthy subjects either held tea solution in the oral cavity or chewed green tea leaves. Although no further oxidative markers were analyzed, this study provides support for a pro-oxidant activity of green tea Indirect antioxidant effects of tea polyphenols In vitro Most of the indirect antioxidant effects of tea polyphenols were observed in normal cells. Yamamoto et al. compared ROS production in oral squamous cell carcinoma (OSC-2 and OSC-4) and normal human primary epidermal keratinocytes (NHEKs) and found that EGCG produced lower levels of ROS in normal cells compared to cancer cells, in part due to increases in CAT and SOD activity in NHEK cells 98. In HepG2 cells, green tea polyphenol extract (GTP) induced chloramphenicol acetyltransferase activity and stimulated the transcription of Phase II detoxifying enzymes. Activation of extracellular signal-regulated kinase 2 (ERK2) and c-jun N-terminal kinase 1 (JNK1) indicated that MAPK/ERK and JNK may be involved in GTP-mediated changes in phase II enzymes 99.

34 In vivo 21 Oral supplementation with EGCG (100 mg/kg for 30 d) significantly decreased lipid peroxides and protein carbonyls in aged rats, possibly by enhancing the GSH redox status, and levels of both enzymatic (SOD, CAT, GSH-Px, etc) and non-enzymatic antioxidants (ascorbate, α-tocopherol, etc) 100. The same group reported similar results using a significantly lower dose of EGCG (2 mg/kg, i.g.) over a relatively long period of time (30 d) 101. Another study found that feeding mice with 0.2% (w/v) GTP for 30 d significantly increased the activities of glutathione peroxidase, catalase, and quinone reductase in small bowel, liver, and lungs, and glutathione S-transferase in small bowel and liver. GTP feeding also resulted in considerable enhancement of glutathione reductase activity in liver 102. In a study of mice bearing orthotopically-implanted human colon tumors, EGCGtreatment increased colon protein levels of Nrf2 and the mrna levels of Nrf2, UGT1A, UGT1A8 and UGT1A10 compared to control mice (all p<0.01). In the same study, EGCG was able to inhibit liver and pulmonary metastases to varying degrees. These results demonstrate that EGCG may prevent liver and pulmonary metastases of orthotopic colon cancer in part by activating the Nrf2-UGT1A signal pathway 103. In a study of normal mice, microarray analysis showed that EGCG regulated 671 genes in an Nrf2-dependent manner in liver and 228 Nrf2-dependent genes in the small intestine, including Nrf2-mediated antioxidant genes 104. Those results support the potential role of Nrf2 in EGCG-triggered antioxidant effects. Chandra Mohan et al. have evaluated the chemopreventive efficacies of green tea polyphenols (Polyphenon E) and black tea polyphenols (Polyphenon B) in the DMBA-

35 22 induced hamster buccal pouch (HBP) carcinogenesis. They found that both Polyphenon E and B inhibited HBP-induced carcinomas associated with a significant decrease in phase I enzymes, modulation of lipid peroxidation and enhanced antioxidant and phase II enzyme activities, with Polyphenon B having a greater efficacy 105. In humans, GTP has been shown to modulate biomarkers of aflatoxin B1 (AFB1) metabolism in human subjects chronically exposed to AFB1. Treatment for 3 months with GTP (500 or 1000 mg) significantly reduced levels of AFB1-albumin adducts (AFB1- AA), significantly reduced median AFB1 levels (42-43% reduction), and increased median AFB N-acetylcysteine conjugate levels. These results indicate that GTP can enhance the detoxification of AFB In a study involving human subjects, Polyphenon E administration resulted in differential effects on GST activity/level based on baseline enzyme activity/level, with GST activity and GST-pi level increased significantly in individuals with low baseline enzyme activity/level. This suggests that green tea polyphenol intervention may enhance the detoxification of carcinogens in individuals with low baseline detoxification capacity 107. In conclusion, green tea polyphenols appear to exert both antioxidant and prooxidant effects in vitro and in vivo. It seems that the polyphenols often exert antioxidant activity in cells under oxidative stress resulting in protection of cells from oxidative damage. On the other hand, these polyphenols tend to have pro-oxidant effects in cancer cells which already bear high levels of ROS due to rapid proliferation. The extra ROS produced by tea polyphenols exert a greater burden on cancer cells, leading to cell death. Some studies also pointed out that the antioxidant or pro-oxidant activity can be affected

36 23 by concentration, the tea polyphenol under study, cell type, and experimental conditions (i.e. ph and redox status) 1, 52, 108. Hence, there is no standardized protocol to judge whether a polyphenol is more likely to act as an antioxidant or a pro-oxidant in vivo. More studies are needed to systematically identify the mechanism of antioxidant and prooxidant effects, and to determine under what conditions these mechanisms occur. Data related to redox-dependent mechanisms derived from in vitro studies must be validated using appropriate in vivo models. Last but not least, additional human clinical data are needed to demonstrate the relevance of the redox effects of tea polyphenols to human health. 1.5 Selectivity of EGCG EGCG has been reported to exert differential effects in cancer versus normal cells. Topical applications of EGCG increased the apoptotic cells in nonmalignant skin tumors and squamous cell carcinomas 72% and 56%, respectively, but there was no effect on apoptosis in nontumor areas of the epidermis 109. Hsu et al. reported that EGCG alone or as part of a mixture of green tea polyphenols could induce apoptosis in oral squamous carcinoma cells, but not in normal human epidermal keratinocytes (NHEK) 110. The differential response between normal and cancer cells may be correlated with the differential expression of p57, a cell cycle regulator. In humans, reduced expression of p57 is often associated with advanced tumors. EGCG potently induced p57 in NHEK but not in oral carcinoma cells via the p38 mitogen-activated signaling pathway 110, 111. Besides p57, NFκB was found to be another potential mechanism of differential apoptotic

37 effects of EGCG in cancer versus normal cells 112, 113. EGCG inhibited the constitutive 24 expression and activity of NFκB in human epidermoid carcinoma (A431) cells, whereas this happened at much higher concentration in NHEK. Additionally, endogenous CAT was reported to involve in EGCG-induced differential levels of ROS and cytotoxic effects 91, 98. By far, the mechanisms under which EGCG exerts differential anti-cancer effects, particularly from the perspective of pro-oxidant effects, remain poorly understood. 1.6 Research Objectives Based on the literature review, I designed and conducted several preliminary experiments and found that EGCG induced differential cytotoxic effects in oral cells. EGCG also triggered ROS production in oral cancer cells, whereas it did not induce significant ROS in normal cells. These results agree with previous studies. My thesis research focused on exploring the mechanisms underlying the differential prooxidant effects of EGCG in oral cancer versus normal cells. The mitochondrion is the major site of ROS production 114. During ATP production, the electrons can leak from electron transport chain and form ROS. Accumulation of ROS may lead to mitochondrial damage. Additionally, ROS will leak out to cytosols and induce other cellular damages. Under normal condition, cells develop mature antioxidant defense system to balance intracellular ROS. However, under the condition of excessive ROS which surpass the cellular antioxidant capacity, cells will be damaged and undergoing apoptosis.

38 25 SIRT3, belonging to sirtuin family, is a mitochondrial deacetylase. SIRT3 is able to mitigate mitochondrial ROS through the activation of downstream antioxidant enzymes (i.e. SOD2) or transcription factor that regulates the transcription of antioxidant enzymes (i.e. Forkhead box O3 (FOXO3a)) 115, 116. In addition to SIRT3, metallothionein is a group of cysteine-rich proteins localized in cytoplasm. They can scavenge the cytosol ROS through the oxidation of thiol groups 117. Therefore, I hypothesize that EGCG exerts differential pro-oxidant effects in oral cancer and normal cells through modulation of mitochondrial function and antioxidant response signaling (i.e. SIRT3 or MT signaling). To test the hypothesis, three specific objectives are proposed: 1) To identify the role of the mitochondria in EGCG-mediated differential pro-oxidant effects in oral cells. 2) To determine the role of SIRT3 signaling in EGCG-mediated differential pro-oxidant effects in oral cells. 3) To explore the role of MT signaling in EGCG-mediated differential pro-oxidant effects in oral cells.

39 1.7 References 26 [1] Lambert, J. D., Elias, R. J., The antioxidant and pro-oxidant activities of green tea polyphenols: a role in cancer prevention. Arch Biochem Biophys 2010, 501, [2] International Agency for Research on Cancer [3] Johnson, N., Tobacco use and oral cancer: a global perspective. J Dent Educ 2001, 65, [4] American Cancer Society, GA, USA [5] Chen, I. C., Chiang, W. F., Liu, S. Y., Chen, P. F., Chiang, H. C., Role of SIRT3 in the regulation of redox balance during oral carcinogenesis. Mol Cancer 2013, 12, 68. [6] Znaor, A., Brennan, P., Gajalakshmi, V., Mathew, A., et al., Independent and combined effects of tobacco smoking, chewing and alcohol drinking on the risk of oral, pharyngeal and esophageal cancers in Indian men. Int J Cancer 2003, 105, [7] Thompson, L., World Health Organization classification of tumours: pathology and genetics of head and neck tumours. Ear Nose Throat J 2006, 85, 74. [8] Weikert, C., Dietrich, T., Boeing, H., Bergmann, M. M., et al., Lifetime and baseline alcohol intake and risk of cancer of the upper aero-digestive tract in the European Prospective Investigation into Cancer and Nutrition (EPIC) study. Int J Cancer 2009, 125, [9] La Vecchia, C., Franceschi, S., Favero, A., Talamini, R., Negri, E., Alcohol intake and cancer of the upper digestive tract. Pattern of risk in Italy is different from that in Denmark. BMJ 1999, 318, ; author reply 1291.

40 [10] Tanaka, T., Tanaka, M., Tanaka, T., Oral carcinogenesis and oral cancer 27 chemoprevention: a review. Patholog Res Int 2011, 2011, [11] Meurman, J. H., Infectious and dietary risk factors of oral cancer. Oral Oncol 2010, 46, [12] Miller, C. S., Johnstone, B. M., Human papillomavirus as a risk factor for oral squamous cell carcinoma: A meta-analysis, Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2001, 91, [13] Park, N. H., Li, S. L., Xie, J. F., Cherrick, H. M., In vitro and animal studies of the role of viruses in oral carcinogenesis. Eur J Cancer B Oral Oncol 1992, 28B, [14] American Cancer Society [15] Chainani-Wu, N., Epstein, J., Touger-Decker, R., Diet and prevention of oral cancer: strategies for clinical practice. J Am Dent Assoc 2011, 142, [16] Chainani-Wu, N., Diet and oral, pharyngeal, and esophageal cancer. Nutr Cancer 2002, 44, [17] Block, G., Patterson, B., Subar, A., Fruit, vegetables, and cancer prevention: a review of the epidemiological evidence. Nutr Cancer 1992, 18, [18] Pavia, M., Pileggi, C., Nobile, C. G., Angelillo, I. F., Association between fruit and vegetable consumption and oral cancer: a meta-analysis of observational studies. Am J Clin Nutr 2006, 83, [19] De Stefani, E., Oreggia, F., Ronco, A., Fierro, L., Rivero, S., Salted meat consumption as a risk factor for cancer of the oral cavity and pharynx: a case-control study from Uruguay. Cancer Epidemiol Biomarkers Prev 1994, 3,

41 [20] Levi, F., Pasche, C., Lucchini, F., Bosetti, C., La Vecchia, C., Processed 28 meat and the risk of selected digestive tract and laryngeal neoplasms in Switzerland. Ann Oncol 2004, 15, [21] Peters, E. S., Luckett, B. G., Applebaum, K. M., Marsit, C. J., et al., Dairy products, leanness, and head and neck squamous cell carcinoma. Head Neck 2008, 30, [22] Graham, H. N., Green tea composition, consumption, and polyphenol chemistry. Prev Med 1992, 21, [23] Chung, J. Y., Huang, C., Meng, X., Dong, Z., Yang, C. S., Inhibition of activator protein 1 activity and cell growth by purified green tea and black tea polyphenols in H-ras-transformed cells. Cancer Res 1999, 59, [24] USDA Database for the Flavonoid Content of Selected Foods [25] Jankun, J., Selman, SH., Swiercz, R and Skrzypczak-Jankun, E, Why drinking green tea could prevent cancer. Nature 1997, 387, 561. [26] Khan, N., Afaq, F., Saleem, M., Ahmad, N., Mukhtar, H., Targeting multiple signaling pathways by green tea polyphenol (-)-epigallocatechin-3-gallate. Cancer Res 2006, 66, [27] Wang, Z. Y., Huang, M. T., Ferraro, T., Wong, C. Q., et al., Inhibitory Effect of Green Tea in the Drinking-Water on Tumorigenesis by Ultraviolet-Light and 12-O- Tetradecanoylphorbol-13-Acetate in the Skin of Skh-1 Mice. Cancer Res 1992, 52, [28] Cao, Y., Cao, R., Angiogenesis inhibited by drinking tea. Nature 1999, 398, 381.

42 [29] Hong, J., Lu, H., Meng, X., Ryu, J. H., et al., Stability, cellular uptake, 29 biotransformation, and efflux of tea polyphenol (-)-epigallocatechin-3-gallate in HT-29 human colon adenocarcinoma cells. Cancer Res 2002, 62, [30] Lipinski, C. A., Lombardo, F., Dominy, B. W., Feeney, P. J., Experimental and computational approaches to estimate solubility and permeability in drug discovery and development settings. Adv Drug Deliv Rev 2001, 46, [31] Lee, M. J., Maliakal, P., Chen, L., Meng, X., et al., Pharmacokinetics of tea catechins after ingestion of green tea and (-)-epigallocatechin-3-gallate by humans: formation of different metabolites and individual variability. Cancer Epidemiol Biomarkers Prev 2002, 11, [32] Lambert, J. D., Lee, M. J., Lu, H., Meng, X. F., et al., Epigallocatechin-3- gallate is absorbed but extensively glucuronidated following oral administration to mice. J Nutr 2003, 133, [33] Yang, C. S., Sang, S., Lambert, J. D., Lee, M.-J., Bioavailability issues in studying the health effects of plant polyphenolic compounds. Mol Nutr Food Res 2008, 52 Suppl 1, S [34] Sang, S., Lambert, J. D., Yang, C. S., Bioavailability and stability issues in understanding the cancer preventive effects of tea polyphenols. J Sci Food Agr 2006, 86, [35] Lu, H., Meng, X. F., Li, C., Sang, S. M., et al., Glucuronides of tea catechins: Enzymology of biosynthesis and biological activities. Drug Metab Dispos 2003, 31, [36] H, L., Rutgers, The State University of New Jersey, New Brunswick 2002.

43 30 [37] Li, C., Lee, M. J., Sheng, S., Meng, X., et al., Structural identification of two metabolites of catechins and their kinetics in human urine and blood after tea ingestion. Chem Res Toxicol 2000, 13, [38] Lee, M. J., Lambert, J. D., Prabhu, S., Meng, X., et al., Delivery of tea polyphenols to the oral cavity by green tea leaves and black tea extract. Cancer Epidemiol Biomarkers Prev 2004, 13, [39] Weisburg, J. H., Weissman, D. B., Sedaghat, T., Babich, H., In vitro cytotoxicity of epigallocatechin gallate and tea extracts to cancerous and normal cells from the human oral cavity. Basic Clin Pharmacol Toxicol 2004, 95, [40] Koh, Y. W., Choia, E. C., Kang, S. U., Hwang, H. S., et al., Green tea (-)- epigallocatechin-3-gallate inhibits HGF-induced progression in oral cavity cancer through suppression of HGF/c-Met. J Nutr Biochem 2011, 22, [41] Li, N., Chen, X., Liao, J., Yang, G., et al., Inhibition of 7,12- dimethylbenz[a]anthracene (DMBA)-induced oral carcinogenesis in hamsters by tea and curcumin. Carcinogenesis 2002, 23, [42] Ide, R., Fujino, Y., Hoshiyama, Y., Mizoue, T., et al., A prospective study of green tea consumption and oral cancer incidence in Japan. Ann Epidemiol 2007, 17, [43] Al-Dakkak, I., Tea, coffee and oral cancer risk. Evid Based Dent 2011, 12, [44] Kim, J. W., Amin, A. R., Shin, D. M., Chemoprevention of head and neck cancer with green tea polyphenols. Cancer Prev Res (Phila) 2010, 3,

44 [45] Li, N., Sun, Z., Han, C., Chen, J., The chemopreventive effects of tea on 31 human oral precancerous mucosa lesions. Proc Soc Exp Biol Med 1999, 220, [46] Tsao, A. S., Liu, D., Martin, J., Tang, X. M., et al., Phase II Randomized, Placebo-Controlled Trial of Green Tea Extract in Patients with High-Risk Oral Premalignant Lesions. Cancer Prevention Research 2009, 2, [47] Dash, C., Chung, F. L., Rohan, J. A. P., Greenspan, E., et al., A six-month crossover chemoprevention clinical trial of tea in smokers and non-smokers: methodological issues in a feasibility study. BMC Complement Altern Med 2012, 12. [48] Yoon, A. J., Shen, J., Santella, R. M., Philipone, E. M., et al., Topical Application of Green Tea Polyphenol (-)-Epigallocatechin-3-gallate (EGCG) for Prevention of Recurrent Oral Neoplastic Lesions. J Orofac Sci 2012, 4, [49] Pisters, K. M., Newman, R. A., Coldman, B., Shin, D. M., et al., Phase I trial of oral green tea extract in adult patients with solid tumors. J Clin Oncol 2001, 19, [50] Tsao, A. S., Liu, D., Martin, J., Tang, X. M., et al., Phase II Randomized, Placebo-Controlled Trial of Green Tea Extract in Patients with High-Risk Oral Premalignant Lesions. Cancer Prev Res (Phila) 2009, 2, [51] Yang, C. S., Wang, X., Lu, G., Picinich, S. C., Cancer prevention by tea: animal studies, molecular mechanisms and human relevance. Nature Reviews Cancer 2009, 9, [52] Forester, S. C., Lambert, J. D., The role of antioxidant versus pro-oxidant effects of green tea polyphenols in cancer prevention. Mol Nut Food Res 2011, 55,

45 32 [53] Danilewicz, J. C., Review of Reaction Mechanisms of Oxygen and Proposed Intermediate Reduction Products in Wine : Central Role of Iron and Copper. Am J Enol Vitic 2003, 54, [54] Sang, S. M., Lee, M. J., Hou, Z., Ho, C. T., Yang, C. S., Stability of tea polyphenol (-)-epigallocatechin-3-gallate and formation of dimers and epimers under common experimental conditions. J Agric Food Chem 2005, 53, [55] Long, L. H., Clement, M. V., Halliwell, B., Artifacts in cell culture: rapid generation of hydrogen peroxide on addition of (-)-epigallocatechin, (-)-epigallocatechin gallate, (+)-catechin, and quercetin to commonly used cell culture media. Biochem Biophys Res Commun 2000, 273, [56] Lambert, J. D., Kennett, M. J., Sang, S., Reuhl, K. R., et al., Hepatotoxicity of high oral dose (-)-epigallocatechin-3-gallate in mice. Food Chem Toxicol 2010, 48, [57] Frei, B., Higdon, J. V., Antioxidant activity of tea polyphenols in vivo: Evidence from animal studies. J Nutr 2003, 133, 3275s-3284s. [58] Nakagawa, T., Yokozawa, T., Direct scavenging of nitric oxide and superoxide by green tea. Food Chem Toxicol 2002, 40, [59] Nanjo, F., Honda, M., Okushio, K., Matsumoto, N., et al., Effects of dietary tea catechins on alpha-tocopherol levels, lipid peroxidation, and erythrocyte deformability in rats fed on high palm oil and perilla oil diets. Biol Pharm Bull 1993, 16,

46 [60] Guo, Q., Zhao, B., Shen, S., Hou, J., et al., ESR study on the structure 33 antioxidant activity relationship of tea catechins and their epimers. Biochim Biophys Acta 1999, 1427, [61] Haenen, G. R., Paquay, J. B., Korthouwer, R. E., Bast, A., Peroxynitrite scavenging by flavonoids. Biochem Biophys Res Commun 1997, 236, [62] Paquay, J. B., Haenen, G. R., Stender, G., Wiseman, S. A., et al., Protection against nitric oxide toxicity by tea. J Agric Food Chem 2000, 48, [63] Heijnen, C. G., Haenen, G. R., Vekemans, J. A., Bast, A., Peroxynitrite scavenging of flavonoids: structure activity relationship. Environ Toxicol Pharmacol 2001, 10, [64] Scott, B. C., Butler, J., Halliwell, B., Aruoma, O. I., Evaluation of the antioxidant actions of ferulic acid and catechins. Free Radic Res Commun 1993, 19, [65] Terao, J., Piskula, M., Yao, Q., Protective Effect of Epicatechin, Epicatechin Gallate, and Quercetin on Lipid-Peroxidation in Phospholipid-Bilayers. Arch Biochem Biophys 1994, 308, [66] Rice-Evans, C., Miller, N., Paganga, G., Antioxidant properties of phenolic compounds. Trends Plant Sci 1997, 2, [67] Kumamoto, M., Sonda, T., Nagayama, K., Tabata, M., Effects of ph and metal ions on antioxidative activities of catechins. Biosci Biotechnol Biochem 2001, 65,

47 [68] Brown, J. E., Khodr, H., Hider, R. C., Rice-Evans, C. A., Structural 34 dependence of flavonoid interactions with Cu2+ ions: implications for their antioxidant properties. Biochem J 1998, 330, [69] Huang, S. W., Frankel, E. N., Antioxidant activity of tea catechins in different lipid systems. J Agric Food Chem 1997, 45, [70] Erba, D., Riso, P., Colombo, A., Testolin, G., Supplementation of Jurkat T cells with green tea extract decreases oxidative damage due to iron treatment. J Nutr 1999, 129, [71] Coyle, C. H., Philips, B. J., Morrisroe, S. N., Chancellor, M. B., Yoshimura, N., Antioxidant effects of green tea and its polyphenols on bladder cells. Life Sci 2008, 83, [72] Huang, C. C., Fang, J. Y., Wu, W. B., Chiang, H. S., et al., Protective effects of (-)-epicatechin-3-gallate on UVA-induced damage in HaCaT keratinocytes. Arch Dermatol Res 2005, 296, [73] Saffari, Y., Sadrzadeh, S. M., Green tea metabolite EGCG protects membranes against oxidative damage in vitro. Life Sci 2004, 74, [74] Glei, M., Pool-Zobel, B. L., The main catechin of green tea, (-)- epigallocatechin-3-gallate (EGCG), reduces bleomycin-induced DNA damage in human leucocytes. Toxicol In Vitro 2006, 20, [75] Hernaez, J. F., Xu, M., Dashwood, R. H., Antimutagenic activity of tea towards 2-hydroxyamino-3-methylimidazo[4,5-f]quinoline: effect of tea concentration and brew time on electrophile scavenging. Mutat Res 1998, 402,

48 35 [76] Tsai, P. J., Tsai, T. H., Yu, C. H., Ho, S. C., Comparison of NO-scavenging and NO-suppressing activities of different herbal teas with those of green tea. Food Chem 2007, 103, [77] Katiyar, S. K., Mukhtar, H., Green tea polyphenol (-)-epigallocatechin-3- gallate treatment to mouse skin prevents UVB-induced infiltration of leukocytes, depletion of antigen-presenting cells, and oxidative stress. J Leukoc Biol 2001, 69, [78] Kager, N., Ferk, F., Kundi, M., Wagner, K. H., et al., Prevention of oxidative DNA damage in inner organs and lymphocytes of rats by green tea extract. Eur J Nutr 2010, 49, [79] Takabayashi, F., Harada, N., Tahara, S., Kaneko, T., Hara, Y., Effect of green tea catechins on the amount of 8-hydroxydeoxyguanosine (8-OHdG) in pancreatic and hepatic DNA after a single administration of N-nitrosobis(2-oxopropyl)amine (BOP). Pancreas 1997, 15, [80] Ozercan, I. H., Sahin, N., Akdemir, F., Onderci, M., et al., Chemoprevention of fibroid tumors by [-]-epigallocatechin-3-gallate in quail. Nutr Res 2008, 28, [81] Katiyar, S. K., Matsui, M. S., Elmets, C. A., Mukhtar, H., Polyphenolic antioxidant (-)-epigallocatechin-3-gallate from green tea reduces UVB-induced inflammatory responses and infiltration of leukocytes in human skin. Photochem Photobiol 1999, 69, [82] Hakim, I. A., Harris, R. B., Brown, S., Chow, H. H., et al., Effect of increased tea consumption on oxidative DNA damage among smokers: a randomized controlled study. J Nutr 2003, 133, 3303S-3309S.

49 [83] Hakim, I. A., Harris, R. B., Chow, H. H., Dean, M., et al., Effect of a 4-36 month tea intervention on oxidative DNA damage among heavy smokers: role of glutathione S-transferase genotypes. Cancer Epidemiol Biomarkers Prev 2004, 13, [84] Young, J. F., Dragstedt, L. O., Haraldsdottir, J., Daneshvar, B., et al., Green tea extract only affects markers of oxidative status postprandially: lasting antioxidant effect of flavonoid-free diet. Br J Nutr 2002, 87, [85] Sung, H., Nah, J., Chun, S., Park, H., et al., In vivo antioxidant effect of green tea. Eur J Clin Nutr 2000, 54, [86] Sang, S. L. M. H. Z., Ho CT and Yang CS Stability of tea polyphenol (-)- epigallocatechin-3-gallate and formation of dimers and epimers under common experimental conditions. J Agric Food Chem 2005, 53, [87] Yang, G. Y., Liao, J., Kim, K., Yurkow, E. J., Yang, C. S., Inhibition of growth and induction of apoptosis in human cancer cell lines by tea polyphenols. Carcinogenesis 1998, 19, [88] Yang, G. Y., Liao, J., Li, C., Chung, J., et al., Effect of black and green tea polyphenols on c-jun phosphorylation and H2O2 production in transformed and nontransformed human bronchial cell lines: possible mechanisms of cell growth inhibition and apoptosis induction. Carcinogenesis 2000, 21, [89] Hou, Z., Sang, S., You, H., Lee, M.-J., et al., Mechanism of action of (-)- epigallocatechin-3-gallate: auto-oxidation-dependent inactivation of epidermal growth factor receptor and direct effects on growth inhibition in human esophageal cancer KYSE 150 cells. Cancer Res 2005, 65,

50 37 [90] Elbling, L., Weiss, R. M., Teufelhofer, O., Uhl, M., et al., Green tea extract and (-)-epigallocatechin-3-gallate, the major tea catechin, exert oxidant but lack antioxidant activities. FASEB J 2005, 19, [91] Yamamoto, T., Lewis, J., Wataha, J., Dickinson, D., et al., Roles of catalase and hydrogen peroxide in green tea polyphenol-induced chemopreventive effects. J Pharmacol Exp Ther 2004, 308, [92] Huang, D., Zhang, Y., Qi, Y., Chen, C., Ji, W., Global DNA hypomethylation, rather than reactive oxygen species (ROS), a potential facilitator of cadmium-stimulated K562 cell proliferation. Toxicol Lett 2008, 179, [93] Yoon, Y. S., Lee, J. H., Hwang, S. C., Choi, K. S., Yoon, G., TGF β1 induces prolonged mitochondrial ROS generation through decreased complex IV activity with senescent arrest in Mv1Lu cells. Oncogene 2005, 24, [94] Lambert, J. D., Sang, S., Yang, C. S., N-Acetylcysteine enhances the lung cancer inhibitory effect of epigallocatechin-3-gallate and forms a new adduct. Free radical biology & medicine 2008, 44, [95] Li, G.-X., Chen, Y.-K., Hou, Z., Xiao, H., et al., Pro-oxidative activities and dose-response relationship of (-)-epigallocatechin-3-gallate in the inhibition of lung cancer cell growth: a comparative study in vivo and in vitro. Carcinogenesis 2010, 31, [96] O'Sullivan, J., Sheridan, J., Mulcahy, H., Tenniswood, M., Morrissey, C., The effect of green tea on oxidative damage and tumour formation in Lobund-Wistar rats. Eur J Cancer Prev 2008, 17,

51 [97] Lambert, J. D., Kwon, S. J., Hong, J., Yang, C. S., Salivary hydrogen 38 peroxide produced by holding or chewing green tea in the oral cavity. Free Radic Res 2007, 41, [98] Yamamoto, T., Hsu, S., Lewis, J., Wataha, J., et al., Green Tea Polyphenol Causes Differential Oxidative Environments in Tumor versus Normal Epithelial Cells. Pharmacology 2003, 307, [99] Yu, R., Jiao, J. J., Duh, J. L., Gudehithlu, K., et al., Activation of mitogenactivated protein kinases by green tea polyphenols: potential signaling pathways in the regulation of antioxidant-responsive element-mediated phase II enzyme gene expression. Carcinogenesis 1997, 18, [100] Kumaran, V. S., Arulmathi, K., Srividhya, R., Kalaiselvi, P., Repletion of antioxidant status by EGCG and retardation of oxidative damage induced macromolecular anomalies in aged rats. Exp Gerontol 2008, 43, [101] Srividhya, R., Jyothilakshmi, V., Arulmathi, K., Senthilkumaran, V., Kalaiselvi, P., Attenuation of senescence-induced oxidative exacerbations in aged rat brain by ( )-epigallocatechin-3-gallate. Int J Dev Neurosci 2008, 26, [102] Khan, S. G., Katiyar, S. K., Agarwal, R., Mukhtar, H., Enhancement of antioxidant and phase II enzymes by oral feeding of green tea polyphenols in drinking water to SKH-1 hairless mice: possible role in cancer chemoprevention. Cancer Res 1992, 52, [103] Yuan, J. H., Li, Y. Q., Yang, X. Y., Inhibition of epigallocatechin gallate on orthotopic colon cancer by upregulating the Nrf2-UGT1A signal pathway in nude mice. Pharmacology 2007, 80,

52 [104] Shen, G., Xu, C., Hu, R., Jain, M. R., et al., Comparison of (-)- 39 epigallocatechin-3-gallate elicited liver and small intestine gene expression profiles between C57BL/6J mice and C57BL/6J/Nrf2 (-/-) mice. Pharm Res 2005, 22, [105] Chandra Mohan, K. V., Hara, Y., Abraham, S. K., Nagini, S., Comparative evaluation of the chemopreventive efficacy of green and black tea polyphenols in the hamster buccal pouch carcinogenesis model. Clin Biochem 2005, 38, [106] Tang, L., Tang, M., Xu, L., Luo, H., et al., Modulation of aflatoxin biomarkers in human blood and urine by green tea polyphenols intervention. Carcinogenesis 2008, 29, [107] Chow, H. H., Hakim, I. A., Vining, D. R., Crowell, J. A., et al., Modulation of human glutathione s-transferases by polyphenon e intervention. Cancer Epidemiol Biomarkers Prev 2007, 16, [108] Zhou, L., Elias, R. J., Factors influencing the antioxidant and pro-oxidant activity of polyphenols in oil-in-water emulsions. J Agric Food Chem 2012, 60, [109] Lu, Y. P., Lou, Y. R., Xie, J. G., Peng, Q. Y., et al., Topical applications of caffeine or (-)-epigallocatechin gallate (EGCG) inhibit carcinogenesis and selectively increase apoptosis in UVB-induced skin tumors in mice. Proc Natl Acad Sci U S A 2002, 99, [110] Hsu, S. D., Singh, B. B., Lewis, J. B., Borke, J. L., et al., Chemoprevention of oral cancer by green tea. Gen Dent 2002, 50,

53 40 [111] Yamamoto, T., Digumarthi, H., Aranbayeva, Z., Wataha, J., et al., EGCGtargeted p57/kip2 reduces tumorigenicity of oral carcinoma cells: role of c-jun N- terminal kinase. Toxicol Appl Pharmacol 2007, 224, [112] Ahmad, N., Feyes, D. K., Nieminen, A. L., Agarwal, R., Mukhtar, H., Green tea constituent epigallocatechin-3-gallate and induction of apoptosis and cell cycle arrest in human carcinoma cells. J Natl Cancer Inst 1997, 89, [113] Ahmad, N., Gupta, S., Mukhtar, H., Green tea polyphenol epigallocatechin- 3-gallate differentially modulates nuclear factor kappa B in cancer cells versus normal cells. Arch Biochem Biophys 2000, 376, [114] Murphy, M. P., How mitochondria produce reactive oxygen species. Biochemical Journal 2009, 417, [115] Alhazzazi, T. Y., Kamarajan, P., Joo, N., Huang, J. Y., et al., Sirtuin-3 (SIRT3), a novel potential therapeutic target for oral cancer. Cancer 2011, 117, [116] Bause, A. S., Haigis, M. C., SIRT3 regulation of mitochondrial oxidative stress. Exp Gerontol 2013, 48, [117] Ruttkay-Nedecky, B., Nejdl, L., Gumulec, J., Zitka, O., et al., The role of metallothionein in oxidative stress. Int J Mol Sci 2013, 14,

54 41 Chapter 2 The role of the mitochondrial oxidative stress in the pro-oxidant effects of the green tea catechin, (-)-epigallocatechin-3-gallate, in oral cells 2.1 Abstract The tea catechin, EGCG, has potential cancer preventive effects. The pro-oxidant activity of EGCG may play a role in these effects. Here, I identified that EGCG exerted cytotoxic effects against oral cancer cell lines (IC50 =83-95 µm). EGCG treatment resulted in formation of extracellular reactive oxygen species (ROS), however these ROS were rapidly cleared (half-life=1.7 h). EGCG treatment increased the production of mitochondrial H2O2 in SCC-25 cells (0 6 h) before the induction of apoptosis. Subsequently, an opening of the mitochondrial transition pore and a decrease in mitochondrial membrane potential were observed. The mitochondria-specific antioxidant, MitoTEMPO, reduced these effects. HGF-1 human gingival fibroblasts were resistant to EGCG (IC50>200 µm) and EGCG-induced ROS. EGCG induced differential expression of genes related to antioxidant defense in oral cancer cells and gingival fibroblasts: superoxide dismutase 2/3, and thioredoxin reductase 2 were down-regulated in SCC-25 cells, but up-regulated in HGF-1 cells. As a summary, the induction of mitochondrial ROS and mitochondrial dysfunction by EGCG play a role in the inhibition of oral cancer, and that gingival fibroblasts are spared from these effects in part because of a selective induction of antioxidant responsive genes. This study was published in Mol Nutr Food Res, 2014, 58 (4):

55 Introduction EGCG is the most abundant and well-studied polyphenol in green tea. One cup of green tea (1.25% (w/v), 250 ml) has approximately 177 mg EGCG 1, 2. Many studies have demonstrated the chemopreventive effects of EGCG against cancers at a number of sites including the skin, lung, breast, colon, liver, stomach, prostate, and oral cavity 3, 4. A number of potential mechanisms have been proposed to account for this activity including the ability of EGCG to modulate redox status in cells. Although EGCG is a well-known chemical antioxidant, there is increasing evidence that EGCG has pro-oxidant activity. Under cell culture conditions, EGCG undergoes oxidative polymerization and produces reactive oxygen species (ROS) such as H2O The role of EGCG-mediated ROS in cancer prevention is still unclear, and the relevance of these effects in vivo is still debated. On one hand, the O2 tension under cell culture conditions (155 mmhg) is much higher than that found in most locations in the body (less than mmhg) and thus many effects of EGCG-mediated ROS in vitro may be artifactual 8. On the other hand, recent studies in lung cancer xenograft-bearing nu/nu mice have indicated that orally-administered EGCG can selectively induce oxidative stress in distal tumor sites 9. The mitochondrion has been widely considered as the major site for production of endogenous ROS. Incomplete metabolism of approximately 1-3% of consumed oxygen leads to production of superoxide, hydrogen peroxide and hydroxyl radical. Damage to complex I and III, which have been reported as important sites of electron leakage, may lead to the increased production of ROS Mitochondrial ROS has been repeatedly

56 43 described to induce the opening of mitochondrial permeability transition pore (mptp), accompanied with collapse of mitochondrial membrane potential, mitochondrial swelling, and release of cytochrome c Ultimately, this sequence of events can lead to apoptosis. Although EGCG has been reported to induce mitochondria-mediated apoptosis 18, to our knowledge, the role of mitochondrial ROS in EGCG-induced apoptosis has not previously been documented. Whereas EGCG induces cytotoxic effects in cancer cells, it has been shown to exert protective effects in normal cells. Hsu et al., have been reported that EGCG alone or as part of a mixture of green tea polyphenols was able to induce apoptosis in oral squamous carcinoma cells, but not in normal human epidermal keratinocytes (NHEK) 19. The differential response between normal and cancer cells correlated with the expression of p57. This cell cycle regulator was selectively induced by EGCG in NHEK via the p38 mitogen-activated signaling pathway, but not altered in oral carcinoma cells 19, 20. In addition, EGCG induced oxidative stress only in tumor cells, but reduced ROS in normal cells 21. Although endogenous catalase (CAT) may play a role in the differential prooxidant effects of EGCG, many questions remain unclear regarding to the differential effects of EGCG in cancer and normal cells 22. In the present study, the effects of EGCG was compared against human oral cancer cell lines and human gingival fibroblast cells in culture. Given the high oxygen tension in the oral cavity and the possibility for direct contact between oral epithelial cells and high concentrations of EGCG 23, I hypothesized that this type of cancer represents a biologically-relevant system to study the role of EGCG-mediated oxidative stress in its cytotoxic effects.

57 Materials and Methods Chemicals and reagents EGCG (93% pure) was purchased from Taiyo Green Power (Wuxi, Jiangsu, China). All the other chemicals and reagents were purchased from Sigma Chemical Co. (St. Louis, MO, USA), unless specified Cell culture and viability studies Human oral squamous cell carcinoma cells (SCC-25 and SCC-9) and human gingival fibroblast cells (HGF-1) were purchased from the American Type Culture Collection (Rockville, MD, USA). SCC-25 and SCC-9 cells were cultured in Dulbecco's Modified Eagle Medium: nutrient mixture F-12 (DMEM/F12 (1:1)) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin (Mediatech, Inc., Manassas, VA, USA) at 37 C under a 5% CO2 atmosphere. HGF-1 cells were cultured in DMEM medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. During treatments, all cell lines were incubated in DMEM/F12 (1:1) medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. The impact of EGCG on cell viability was determined by the 3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. In brief, cells were treated with EGCG (0-200 μm) in serum-complete medium. Following treatment, cells were washed with fresh medium once, and MTT (1 mg/ml)-containing medium was added to the cells, and cells were incubated for 1 h. Development of the formazan dye, which correlates

58 45 with viability, was measured by Multiskan GO microplate spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA) at 540 nm. The cell viability of EGCGtreated cells was normalized to vehicle-treated controls Induction of apoptosis Early-stage apoptosis was determined using an ApoDETECT Annexin V-FITC kit (Life Technologies, Carlsbad, CA, USA) according to the manufacturer s protocol. In brief, cells were harvested and washed with PBS after EGCG treatment. Cells were resuspended in 190 µl binding buffer (10 mm Hepes/NaOH, ph=7.4, 140 mm NaCl, 2.5 mm CaCl2), and combined with 10 µl Annexin V-FITC. Following incubation for 10 min at room temperature, cells were washed once with binding buffer, and resuspended in 190 µl binding buffer. Propidium iodide was added to a final concentration of 2 μg/ml and cells were immediately analyzed by flow cytometry. Late-stage apoptosis (DNA fragmentation) was analyzed by the terminal deoxynucleotidyltransferase ddutp nick end labeling (TUNEL) assay (Roche Applied Sciences, Indianapolis, IN, USA). Following EGCG treatment, cells were fixed in fresh 4% buffered paraformaldehyde (ph 7.4) for at least 1 h, washed with PBS, and then permeabilized with 0.1% Triton X-100 in 0.1% sodium citrate for 2 min on ice. Cells were then washed twice with PBS and incubated with TUNEL reaction mixture for 1 h at 37 C in the dark. Cells were washed twice with PBS and quantified by fluorescence microscope using an Olympus BX-51 microscope supplied with reflected fluorescence system (Olympus Imaging America Inc., Center Valley, PA, USA).

59 Stability and Intracellular Levels of EGCG To determine the stability of EGCG under cell culture conditions, EGCG was added to DMEM/F12 (1:1) medium at a final concentration of 100 μm and incubated at 37 o C for h. The media samples were collected and mixed with an equal volume of cold methanol (containing 0.2% ascorbic acid). SCC-25 cells were plated in 6-well plates (9x10 4 /well) and allowed to attach for 24 h. To determine the cytosolic levels of EGCG, cells were then treated with 100 µm EGCG for h. The cells were scraped into 0.2 % ascorbic acid in water, sonicated, and centrifuged at 14,000 g for 10 min (4 C). The supernatant was combined with an equal volume of cold methanol to precipitate protein, and centrifuged at 14,000 g for 10 min (4 C). The media samples and supernatant were then filtered and analyzed for EGCG by an established LC-MS method 24. Concentrations of intracellular EGCG were normalized to cytosolic protein content H2O2 determination in cell culture medium H2O2 levels in the cell culture medium were measured using the ferrous oxidationxylenol orange (FOX) assay as previously described with minor modifications 25, 26. Following treatment with EGCG, media samples were collected, combined with 10% methanol, 20% FOX solution (1 mm xylenol orange, 2.5 mm ferrous sulfate, 1 M sorbitol and 250 mm sulfuric acid), and incubated at room temperature for 30 min. Color

60 47 development was determined spectrophotometrically (λmax= 540 nm) and H2O2 concentration was determined by comparison to an H2O2 standard curve Determination of intracellular ROS Visualization of total intracellular ROS was accomplished by staining with 6- carboxy-2',7'-dichlorodihydrofluorescein diacetate, di(acetoxymethyl Ester) (H2DCFDA) (Life Technologies, Carlsbad, CA, USA) in combination with fluorescent microscopy 27. Cells were grown on glass coverslips overnight and treated with 100 µm EGCG. Following treatment, cells were incubated with 10 µm H2DCFDA for 30 min at 37 C, and rinsed twice with PBS. Coverslips were placed on microscope slides and examined by microscope (λex= 480 nm; λem= 520 nm). Fluorescence was quantified using Image J software (National Institutes of Health, Bethesda, MD, USA). The corrected total cell fluorescence (CTCF) was calculated by the formula below: CTCF=Integrated density-(area Mean fluorescence of background) Confocal microscopy To examine the localization of intracellular ROS, cells were treated with EGCG, washed with PBS, and then concurrently stained with 10 µm H2DCFDA and 200 nm MitoTracker Red (to visualized the mitochondria, Life Technologies, Carlsbad, CA, USA) for 30 min. Cells were then observed by confocal microscope (FV1000, Olympus

61 Imaging America Inc., Center Valley, PA, USA). MitoTracker Red was detected at λex= 579 nm and λem= 599 nm; H2DCFDAwas detected at λex= 480 nm and λem= 520 nm Determination of mitochondria-specific ROS To determine mitochondria-specific levels of H2O2, cells were stained with [4-[4-[3- Oxo-6'-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)spiro[isobenzofuran-1(3H), 9'- [9H]xanthen]-3'-yl]-1-piperazinyl]butyl]triphenyl-phosphonium iodide (MitoPY1) (Tocris Bioscience, Bristol, United Kingdom) 28. SCC-25 cells were treated with 0 or 100 µm EGCG for 0, 1, 3 or 6 h. After washing with PBS, the cells were stained with 10 µm MitoPY1 at 37 C for 30 min. The fluorescence was detected by confocal microscope FV1000 (Olympus Imaging America Inc., Center Valley, PA, USA) at excitation and emission wavelength of 510 nm and 528 nm, respectively, and quantified as described above Mitochondrial membrane potential Mitochondrial membrane potential was determined by MitoTracker Red 29. SCC-25 cells were treated with 0 or 100 µm EGCG for 1, 6, 24 or 72 h and then incubated with 200 nm MitoTracker at 37 C for 30 min. Fluorescence was detected at λex= 579 nm and λem= 599 nm. Levels of fluorescence were quantified using Image J software.

62 Detection of mptp opening Cells were preloaded with 0.5 µm calcein AM in the presence or absence of CoCl2 (1 mm) for 15 min. After washing with PBS twice, the cells were treated with 0 or 100 EGCG for 1 h. Then, control and treated cells were observed under fluorescence microscope (λex= 480 nm; λem= 520 nm) and quantified by Image J Gene expression studies SCC-25 and HGF-1 cells were treated with 0 or 100 µm EGCG for 12 h. RNA was isolated by RNeasy Mini kit (QIAGEN Inc., Valencia, CA, USA) followed by reverse transcription (RT²HT First Strand Kit, QIAGEN Inc.). Gene expressions were evaluated using the oxidative stress RT 2 profiler PCR array system (QIAGEN Inc.) and ABI-7300 real time PCR machine (Applied Biosystems, Foster City, CA, USA). Data was analyzed by ABI-7300 software and analysis package from SABiosciences Western blot analysis After treatment, cells were harvested and lysed in MENG buffer (25 mm MOPS, 2 mm EDTA, 0.02% NaN3 and 10% Glycerol) with addition of 1% (v/v) phosphatase and protease inhibitor cocktails. Protein concentration was determined by the Bradford assay. Protein samples (30 μg protein) were resolved by SDS polyacrylamide gel electrophoresis (PAGE) and transferred to a nitrocellulose membrane. Following transfer, the membrane was incubated with blocking buffer (LI-COR Corporate, Lincoln, NE,

63 50 USA) for 1 h and then probed with phospho-histone H2A.X (γh2a.x) antibody (Cell Signaling Technology, Inc., Danvers, MA, USA) at the appropriate dilution overnight at 4 o C. After washing 3 times with PBS buffer containing 0.05 % Tween-20, the membrane was probed with fluorescent conjugated secondary antibody (LI-COR Corporate, Lincoln, NE, USA) at room temperature in the dark for 30 min. Protein bands were visualized and quantified using Licor Odyssey Imaging System (LI-COR Corporate, Lincoln, NE, USA). Target protein expression was normalized to β-actin (Cell Signaling Technology, Inc., Danvers, MA, USA) as a protein loading control Statistical Analysis All experiments were repeated at least three times with at least two replicates for each treatment and time point. GraphPad Prism 5.0 was used for statistical analysis. Oneway ANOVA with Tukey s post-test was used to compare differences between control and treatments. Two-way ANOVA with Bonferroni post-test was used to compare the variations when there are more than one factor (i.e. time) between control and treatments. Data were expressed as mean±sd or mean±sem as indicated, and significance was reached at P<0.05.

64 Results EGCG-induced different levels of growth inhibition and apoptosis in normal and oral cancer cells Treatment of oral squamous carcinoma cells (SCC-25 and SCC-9) and normal gingival fibroblasts (HGF-1) with EGCG for 72 h resulted in dose-dependent loss of cell viability (Figure 2-1A). The IC50 of EGCG in SCC-25 and SCC-9 was 95 and 83 µm, respectively. HGF-1 cells were significantly less sensitive to the effects of EGCG than either cancer cell line (IC50> 200 µm). Treatment with 100 µm EGCG resulted in externalization of phosphatidylserine, as determined by Annexin V-positivity, in SCC-9 (2-fold increase) and SCC-25 cells (2.3- fold increase) indicating early apoptosis. No such increase was observed in HGF-1 cells (Figure 2-1B). Apoptosis was confirmed by measuring DNA fragmentation using the TUNEL assay. Treatment with 100 µm EGCG caused a significant increase in DNA fragmentation (9 to 48-fold increase) in the two cancer cell lines but not in HGF-1 cells (Figure 2-1B).

65 Figure 2-1. EGCG-mediated growth inhibition and apoptosis in oral cells. (A) SCC-25 and SCC-9 human oral cancer cells and HGF-1 non-malignant gingival fibroblasts were treated with µm EGCG for 72 h. Cell viability was determined by MTT assay and normalized to vehicle-treated controls. (B) Apoptosis was determined by Annexin V and TUNEL positivity after treatment with 100 µm EGCG for 24 h and 72 h, respectively. Error bars represent standard deviation. * indicates p<0.05; ** indicates p <0.01 compared to control. 52

66 EGCG-induced differential intracellular oxidative environments in SCC-25 and HGF-1 cells Incubation of SCC-25 cells with 100 µm EGCG resulted in a time-dependent increase in intracellular ROS even after EGCG could no longer be detected (after 12 h) in either the cell culture medium (data not shown) or the intracellular compartment (Figure 2-2A). In SCC-25 cells, treatment with EGCG for 24 h resulted in a concentrationdependent increase in γh2a.x, a marker of oxidative stress and double-strand DNA break; NAC reduced the expression (Figure 2-2B). Similarly, addition of NAC was found to prevent EGCG-induced apoptosis (Figure 2-2C). Treatment with EGCG for up to 72 h did not significantly increase oxidative stress in HGF-1 cells (Figure 2-2D).

67 54 Figure 2-2. EGCG-induced differential oxidative environments in SCC-25 and HGF-1 cells. (A) SCC-25 cells were treated with 100 µm EGCG for 0-72 h and intracellular ROS were quantified by fluorescence microscopy after staining with H 2DCFDA. Intracellular EGCG was determined by HPLC and normalized by total protein content after treatment with 100 µm EGCG

68 55 for h. (B)Western blot analysis of γh 2AX was determined in SCC-25 cells after treatment with EGCG for 24 h. These effects were reduced by inclusion of NAC. (C) NAC co-treatment reduced EGCG-induced apoptosis as determined by Annexin V staining (at 24 h) or TUNEL assay (at 72 h). (D) ROS was determined in SCC-25 and HGF-1 cells following treatment with 0 or 100 µm EGCG for 72 h. ROS were visualized by fluorescence microscopy and quantified by Image J. Data represent the mean ±SD.* indicates p<0.05; ** indicates p<0.01 compared to control.

69 EGCG-induced changes in oxidative stress/antioxidant genes in SCC-25 and HGF-1 cells A global examination of oxidative stress/antioxidant responsive genes showed that 44 out of 84 genes were differentially regulated by EGCG in SCC-25 and HGF-1 cells including 7 genes that were significantly down-regulated in SCC-25 cells but upregulated in HGF-1 cells and 26 genes that were significantly down-regulated in SCC-25 cells but not significantly changed in HGF-1 cells. Those with the most dramatic changes are shown in Table 2-1. For example, metallothionein 3 (MT3) was significantly upregulated in HGF-1 cells (8.92-fold), whereas it was not significantly changed in SCC-25 cells. SOD2 and SOD3 were significantly down-regulated (1.27- and 1.68-fold, respectively) in SCC-25 cells while in HGF-1 cells both genes were up-regulated (1.49- and 2.82-fold, respectively). Selenoprotein P, plasma, 1 (SEPP1) and thyroid peroxidase (TPO) were significantly down- (3.17-fold) and up-regulated (5.76-fold) by EGCG in SCC-25 cells, respectively, without significant change in HGF-1 cells Effects of EGCG-induced extracellular ROS in cancer cells EGCG was unstable in DMEM/F12 (1:1) medium (Figure 2-3A) and rapidly produced H2O2, however, this H2O2 was rapidly eliminated (half-life =1.7 h, Figure 2-3A). Exogenous CAT can scavenge H2O2 and exogenous SOD can reduce EGCGmediated production of H2O2 by stabilizing EGCG. Neither exogenous CAT nor SOD

70 57 reduced the growth inhibitory activity of EGCG, whereas addition of NAC, a cellpermeable antioxidant, significantly reduced growth inhibitory potency (Figure 2-3B).

71 58 Table 2-1. Expression of oxidative stress-related genes in EGCG-treated oral cells *. Symbol Gene Name Fold Change SCC-25 HGF-1 CAT Catalase CYBA Cytochrome b-245, alpha polypeptide CYGB Cytoglobin DHCR24 24-dehydrocholesterol reductase DUOX1 Dual oxidase DUOX2 Dual oxidase GPR156 G protein-coupled receptor GPX1 Glutathione peroxidase GPX2 Glutathione peroxidase 2 (gastrointestinal) GPX3 Glutathione peroxidase 3 (plasma) GPX4 Glutathione peroxidase 4 (phospholipid hydroperoxidase) GPX5 Glutathione peroxidase 5 (epididymal androgen-related protein) GPX6 Glutathione peroxidase 6 (olfactory) GPX7 Glutathione peroxidase GSR Glutathione reductase GSTZ1 Glutathione transferase zeta MPV17 MpV17 mitochondrial inner membrane protein MSRA Methionine sulfoxidereductase A MT3 Metallothionein NCF2 Neutrophil cytosolic factor NOS2 Nitric oxide synthase 2, inducible NOX5 NADPH oxidase, EF-hand calcium binding domain PRDX1 Peroxiredoxin

72 59 Table 2-1 Con t Symbol Gene Name Fold Change SCC-25 HGF-1 PRDX2 Peroxiredoxin PRDX3 Peroxiredoxin PRDX4 Peroxiredoxin PRDX5 Peroxiredoxin PRDX6 Peroxiredoxin PTGS1 Prostaglandin-endoperoxide synthase PTGS2 Prostaglandin-endoperoxide synthase SEPP1 Selenoprotein P, plasma, SOD1 Superoxide dismutase 1, soluble SOD2 Superoxide dismutase 2, mitochondrial SOD3 Superoxide dismutase 3, extracellular TPO Thyroid peroxidase TXNRD1 Thioredoxinreductase TXNRD2 Thioredoxinreductase * Cells were treated with 100 µm EGCG for 12 h. + indicates up-regulation and - indicates down-regulation of EGCG versus control. = P<0.05.

73 Figure 2-3. EGCG stability and production of H2O2 under cell culture conditions. (A) Initially 100 µm EGCG was added to DMEM/F12 (1:1) medium. Concentration of EGCG was measured by HPLC at h. H2O2 was measured by FOX assay after 0-12 h treatment. (B) The viability of SCC-25 cells treated with 0 or 100 µm EGCG in the presence of or absence of 10 U/ml CAT, 10 U/ml SOD or 2 mm NAC for 72 h was determined by MTT assay. Cell viability was normalized to vehicle-treated controls. Error bars represent standard deviation. Different letters indicate significance (p<0.05). 60

74 Role of the mitochondrial ROS in EGCG-induced apoptosis in SCC-25 cells Analysis by confocal microscopy revealed that EGCG-induced ROS initially colocalized with the mitochondria (at 1 h) followed by a ROS burst throughout the cytoplasm (Figure 2-4A). A fluorescence probe specific for mitochondrial H2O2 (MitoPY1) confirmed that EGCG induced ROS in the mitochondrial within 1 h and that the level increased with treatment time (Figure 2-4B).We observed that production of mitochondrial ROS preceded induction of both early late apoptosis (Figure 2-4C and D), or significant loss of mitochondrial membrane potential (Δψ, Figure 2-4A). Addition of a mitochondria-specific ROS scavenger (MitoTEMPO, 2 µm) reduced EGCG-mediated opening of the mptp compared to cells treated only with EGCG (Figure 2-5A). Simultaneously, the EGCG-mediated decreases in Δψ were also prevented by coincubation with MitoTEMPO (Figure 2-5A). Co-incubation with MitoTEMPO also significantly reduced the induction of apoptosis by EGCG (Figure 2-5B).

75 62 Figure 2-4. EGCG-induced mitochondrial ROS in SCC-25 cells. (A) SCC-25 cells were treated with 0 or 100 µm EGCG for 0, 1, 6, 24 or 72 h. Intracellular ROS were detected by

76 63 H 2DCFDA and mitochondria were stained with MitoTracker Red. (B) Mitochondria-specific ROS was examined by MitoPY1 staining following treatment of SCC-25 cells with 0 or 100 µm EGCG for 0-6 h. The time-dependent induction of early (C) and (D) late apoptosis was determined after treatment with 0 or 100 µm EGCG by Annexin V/PI and TUNEL assay, respectively. Images were quantified by Image J. Data represent the mean ± SD (for apoptosis) or mean ± SEM (for image analysis). ** indicates p <0.01 compared to control.

77 64 Figure 2-5. The role of EGCG-induced mitochondrial ROS in apoptosis. (A) SCC-25 cells were treated with 0 or 100 µm EGCG in the presence or absence of 2 µm MitoTEMPO for 1 h.

78 65 The opening of mptp and Δψ change were determined using Calcein-AM and 200 nm MitoTracker Red, respectively. Images were quantified by Image J. (B) Early apoptosis was determined in SCC-25 cells by Annexin V/PI staining following treatment with 0 or 100 µm EGCG in the presence or absence of 2 µm MitoTEMPO for 9 h. Data represent the mean± SD (for apoptosis) or mean ± SEM (for image analysis). * indicates p<0.05; ** indicates p<0.01 compared to control.

79 Discussion In the present study, I examined the inhibitory effects of EGCG against human oral cancer cells in culture and sought to elucidate the role of EGCG-mediated oxidative stress and mitochondrial dysfunction in these effects. EGCG selectively inhibited the growth of human oral cancer cells (IC50=83-95µM) compared to non-malignant gingival fibroblasts (IC50 greater than 200 µm). These results are similar to previous studies 30, 31. Previous studies by our group and others have shown that salivary levels of EGCG can reach μm in human volunteers after chewing 2 g green tea leaves for 5 min 32. These previous results indicate that the concentrations of EGCG used in the present study are achievable in human subjects. Previous studies have demonstrated that EGCG is unstable in most cell culture medium, undergoing oxidative polymerization and forming ROS. The role of this extracellular ROS in the anticancer effects remains controversial, and appears to vary greatly depending on the cell type and the culture conditions. Here, incubation of EGCG in DMEM/F12 (1:1) medium resulted in the rapid production of H2O2, but that this H2O2 was also rapidly eliminated. The peak levels observed here are similar to those that we previously observed in the saliva of human subjects after chewing 2 g green tea leaves 23. Although the production of H2O2 by EGCG in DMEM, RPMI 1640, and McCoy s 5A cell culture medium have been previously reported, this rapid degradation has not been reported in cell culture system 5, 6. I determined that DMEM/F12 (1:1) medium (0.3 U/µg protein, data not shown) had significant peroxidase activity perhaps due to supplement of sodium pyruvate 33, but it is still much lower than the level observed in human saliva

80 67 (66.8 U/µg protein, data not shown). Because EGCG-generated extracellular ROS are rapidly degraded, it likely does not play a significant role in cancer cell inhibition in our cell model. Supporting this conclusion, I found that addition of exogenous CAT or SOD, which are expected to stabilize EGCG and quench EGCG-mediated O2 - and H2O2, had no significant effect on EGCG-mediated growth inhibitory potency. These results differ from previous reports that found that addition of CAT (50 U/mL) mitigated EGCGinduced cell growth inhibition and apoptosis in H661 human lung cancer cells or partially eliminated the apoptotic effects of EGCG in Ha-ras-transformed human bronchial epithelial cells 34, 35. In contrast to the kinetics observed for EGCG-mediated extracellular ROS production, EGCG treatment resulted in a continuous increase in the intracellular levels of ROS in oral cancer cells. Intracellular ROS continued to increase even after EGCG could no longer be detected (after 12 h) in either the cytoplasm or in the cell culture medium. Intracellular ROS initially co-localized with the mitochondria (1 h), spread throughout the cytoplasm (6-24 h) and then into the nucleus (48-72 h). Previous studies in oral cancer cells (OSC2 and OSC4), as well as myeloma and lymphoma cells have reported that EGCG treatment could increase intracellular ROS, but these reports provided no kinetic information beyond 2 h 21, 36. Interestingly, a specific stain for mitochondrial H2O2 revealed that EGCG induced mitochondrial ROS before the induction of apoptosis. These results suggest that EGCG may perturb mitochondrial function leading to the increase in mitochondrial ROS. This early production of ROS in the mitochondria may lead to even greater ROS in a selfamplifying manner 37. Based on a process previously described as ROS-induced ROS

81 68 release (RIRR), when accumulated mitochondrial ROS reach a threshold level, they would trigger the opening of mptp and the inner membrane anion channel with a simultaneous collapse of Δψ to release ROS to cytosol 15, 16. The released ROS can then function as second messengers to activate RIRR in neighboring mitochondria 15, or to activate cellular NADPH oxidase 38, resulting in ROS burst and further detrimental effects on mitochondria and cells. Our observation of initial mitochondrial ROS and later cytosolic ROS burst supported a role of this RIRR theory in the cytotoxic effects of EGCG against oral cancer cells. Co-treatment with NAC, but not SOD or CAT, significantly reduced the inhibitory effect of EGCG, suggesting that EGCG-induced intracellular ROS, in contrast to extracellular ROS, play a role in EGCG-induced cell growth inhibition and apoptosis. The mitochondria-specific radical scavenger, MitoTEMPO, represented a more precise way to investigate the role of EGCG-mediated mitochondrial oxidative stress in EGCGmediated apoptosis in SCC-25 cells. MitoTEMPO reduced collapse of Δψ and opening of mptp, both of which were associated with reduced apoptosis. Very recently, Satoh et al. has reported that EGCG can induce mitochondrial ROS in human mesothelioma cells after 24 h treatment 39. However, the induction of apoptosis was detected before 18 h, rendering the source of mitochondrial ROS, and its potential causative role, unclear. Our data provide a kinetic basis to suggest a causative role of EGCG-induced mitochondrial ROS in apoptosis. To our knowledge, this has not been reported before. In contrast to oral squamous cell carcinoma cells, normal HGF-1 cells were insensitive to EGCG-induced cell growth inhibition or apoptosis: almost no induction of oxidative stress in HGF-1 cells after even 72 h treatment with EGCG. PCR array analysis

82 69 showed that HGF-1 cells had a robust induction of antioxidant defense genes in response to EGCG treatment, whereas SCC-25 cells did not. Of particular interest is MT3 which was the up-regulated to the greatest extent by EGCG in HGF-1 cells (8.92-fold) whereas there was no significant modulation in SCC-25 cells. The MT3 protein has been reported to exhibit free radical scavenging activity and regulatory control of zinc metabolism in the brain resulting in neuronal protection against toxic metals 40, 41. In addition to MT3, cytoglobin (CYGB), G protein-coupled receptor 156 (GPR156), Peroxiredoxin 5 (PRDX5), prostaglandin-endoperoxide synthase 1 (PTGS1), SOD2, SOD3 and TXNRD2 were significantly up-regulated in HGF-1 cells, but down-regulated by EGCG in SCC-25. Although the function of GPR156 remains unknown, the decreased levels of CYGB, PRDX5, SOD2, SOD3 and TXNRD2 may indicate the reduced antioxidant defense in SCC-25 cells. Interestingly, I also observed the down-regulations of ROS productionrelated genes in cancer cells (cytochrome b-245, alpha polypeptide (CYBA), dual oxidase 1 (DUOX1), dual oxidase 2 (DUOX2), neutrophil cytosolic factor 2 (NCF2) and NADPH oxidase, EF-hand calcium binding domain 5 (NOX5)). It is possible that the cells induced a feed-back response in attempt to prevent further ROS production. While EGCG treatment largely down-regulated genes related to antioxidant response in SCC-25 cells, thyroid peroxidase (TPO) was noticeably up-regulated (5.76- fold) by EGCG. This enzyme is expressed mainly in the thyroid for producing thyroid hormones, thyroxine (T4) or triiodothyronine (T3) 42. TPO was also reported to be expressed in most thyroid adenoma and some thyroid carcinoma samples 43, 44. The function of this gene in oral cancer remains to be determined, but given its role as a peroxidase, up-regulation is likely a response to EGCG-mediated increases in

83 70 intracellular ROS. The expression of TPO was not significantly changed in HGF-1 cells, and thus, this gene may serve as a potential biomarker of oral cancer. In summary, the gene array data could in part explain the differential effects on cancer and normal cells by EGCG. More studies involving protein expression and activity of these genes, as well as the key transcriptional regulator(s), are needed to fully understand this differential response. In summary, as shown in Figure 2-6, EGCG shows selective inhibitory activity against human oral cancer cells in culture. This inhibitory activity was associated with a profound increase in intracellular oxidative stress that appears to originate from the mitochondria, which triggers opening of mptp, immediate loss of Δψ, and induction of early apoptosis. By comparison, EGCG treatment induced a significant antioxidant response in non-malignant human gingival fibroblast which may protect them from oxidative damage. Further studies are required to identify upstream targets responsible for these differential effects.

84 71 Figure 2-6. EGCG-induced differential pro-oxidant effects in oral cancer and normal cells. In cancer cells, EGCG induced early production of mtros which were associated with the mitochondrial dysfunction including the loss of membrane potential and the opening of mptp. This was further followed by cellular ROS burst and ultimate apoptosis. By contrast, in normal cells, EGCG did not induce oxidative stress nor apoptosis. However, it remains unknown if EGCG would produce mtros in normal cells and how EGCG modulates the mtros production in cancer versus normal cells.

85 References [1] Lambert, J. D., Yang, C. S., Cancer chemopreventive activity and bioavailability of tea and tea polyphenols. Mutat Res 2003, 523, [2] Yang, C. S., Lambert, J. D., Ju, J., Lu, G., Sang, S., Tea and cancer prevention: molecular mechanisms and human relevance. Toxicol Appl Pharmacol 2007, 224, [3] Mukhtar, H., Ahmad, N., Tea polyphenols: prevention of cancer and optimizing health. Am J Clin Nutr 2000, 71, 1698S-1702S; discussion 1703S-1694S. [4] Yang, C. S., Maliakal, P., Meng, X., Inhibition of carcinogenesis by tea. Annu Rev Pharmacol Toxicol 2002, 42, [5] Long, L. H., Clement, M. V., Halliwell, B., Artifacts in cell culture: rapid generation of hydrogen peroxide on addition of (-)-epigallocatechin, (-)-epigallocatechin gallate, (+)-catechin, and quercetin to commonly used cell culture media. Biochem Biophys Res Commun 2000, 273, [6] Hong, J., Lu, H., Meng, X., Ryu, J. H., et al., Stability, cellular uptake, biotransformation, and efflux of tea polyphenol (-)-epigallocatechin-3-gallate in HT-29 human colon adenocarcinoma cells. Cancer Res 2002, 62, [7] Sang, S. M., Lee, M. J., Hou, Z., Ho, C. T., Yang, C. S., Stability of tea polyphenol (-)-epigallocatechin-3-gallate and formation of dimers and epimers under common experimental conditions. J Agric Food Chem 2005, 53, [8] Sherwood, L., Human Physiology: From Cells to Systems, Wadsworth Publishing Co., Belmont, CA 1997.

86 73 [9] Li, G.-X., Chen, Y.-K., Hou, Z., Xiao, H., et al., Pro-oxidative activities and dose-response relationship of (-)-epigallocatechin-3-gallate in the inhibition of lung cancer cell growth: a comparative study in vivo and in vitro. Carcinogenesis 2010, 31, [10] Boveris, A., Chance, B., The mitochondrial generation of hydrogen peroxide. General properties and effect of hyperbaric oxygen. Biochem J 1973, 134, [11] Turrens, J. F., Boveris, A., Generation of superoxide anion by the NADH dehydrogenase of bovine heart mitochondria. Biochem J 1980, 191, [12] Turrens, J. F., Freeman, B. A., Levitt, J. G., Crapo, J. D., The effect of hyperoxia on superoxide production by lung submitochondrial particles. Arch Biochem Biophys 1982, 217, [13] Stowe, D. F., Camara, A. K., Mitochondrial reactive oxygen species production in excitable cells: modulators of mitochondrial and cell function. Antioxid Redox Signal 2009, 11, [14] Costantini, P., Belzacq, A. S., Vieira, H. L., Larochette, N., et al., Oxidation of a critical thiol residue of the adenine nucleotide translocator enforces Bcl-2- independent permeability transition pore opening and apoptosis. Oncogene 2000, 19, [15] Zorov, D. B., Filburn, C. R., Klotz, L. O., Zweier, J. L., Sollott, S. J., Reactive oxygen species (ROS)-induced ROS release: a new phenomenon accompanying induction of the mitochondrial permeability transition in cardiac myocytes. J Exp Med 2000, 192,

87 74 [16] Zorov, D. B., Juhaszova, M., Sollott, S. J., Mitochondrial ROS-induced ROS release: an update and review. Biochim Biophys Acta 2006, 1757, [17] Marchi, S., Giorgi, C., Suski, J. M., Agnoletto, C., et al., Mitochondria-ros crosstalk in the control of cell death and aging. J Signal Transduct 2012, 2012, [18] Berindan-Neagoe, I., Braicu, C., Tudoran, O., Balacescu, O., Irimie, A., Early apoptosis signals induced by a low dose of epigallocatechin 3-gallate interfere with apoptotic and cell death pathways. J Nanosci Nanotechnol 2012, 12, [19] Hsu, S. D., Singh, B. B., Lewis, J. B., Borke, J. L., et al., Chemoprevention of oral cancer by green tea. Gen Dent 2002, 50, [20] Yamamoto, T., Digumarthi, H., Aranbayeva, Z., Wataha, J., et al., EGCGtargeted p57/kip2 reduces tumorigenicity of oral carcinoma cells: role of c-jun N- terminal kinase. Toxicol Appl Pharmacol 2007, 224, [21] Yamamoto, T., Hsu, S., Lewis, J., Wataha, J., et al., Green Tea Polyphenol Causes Differential Oxidative Environments in Tumor versus Normal Epithelial Cells. Pharmacology 2003, 307, [22] Yamamoto, T., Lewis, J., Wataha, J., Dickinson, D., et al., Roles of catalase and hydrogen peroxide in green tea polyphenol-induced chemopreventive effects. J Pharmacol Exp Ther 2004, 308, [23] Lambert, J. D., Kwon, S. J., Hong, J., Yang, C. S., Salivary hydrogen peroxide produced by holding or chewing green tea in the oral cavity. Free Radic Res 2007, 41,

88 75 [24] Lu, H., Meng, X., Yang, C. S., Enzymology of methylation of tea catechins and inhibition of catechol-o-methyltransferase by (-)-epigallocatechin gallate. Drug Metab Dispos 2003, 31, [25] Ahmed, M. N., Codipilly, C., Hogg, N., Auten, R. L., The protective effect of overexpression of extracellular superoxide dismutase on nitric oxide bioavailability in the lung after exposure to hyperoxia stress. Exp Lung Res 2011, 37, [26] Wolff, S. P., Ferrous Ion Oxidation in Presence of Ferric Ion Indicator Xylenol Orange for Measurement of Hydroperoxides. Meth Enzymol 1994, 233, [27] Negre-Salvayre, A., Auge, N., Duval, C., Robbesyn, F., et al., Detection of intracellular reactive oxygen species in cultured cells using fluorescent probes. Meth Enzymol 2002, 352, [28] Dickinson, B. C., Chang, C. J., A targetable fluorescent probe for imaging hydrogen peroxide in the mitochondria of living cells. J Am Chem Soc 2008, 130, [29] Matsuda, N., Sato, S., Shiba, K., Okatsu, K., et al., PINK1 stabilized by mitochondrial depolarization recruits Parkin to damaged mitochondria and activates latent Parkin for mitophagy. J Cell Biol 2010, 189, [30] Elattar, T. M., Virji, A. S., Effect of tea polyphenols on growth of oral squamous carcinoma cells in vitro. Anticancer Res 2000, 20, [31] Weisburg, J. H., Weissman, D. B., Sedaghat, T., Babich, H., In vitro cytotoxicity of epigallocatechin gallate and tea extracts to cancerous and normal cells from the human oral cavity. Basic Clin Pharmacol Toxicol 2004, 95,

89 76 [32] Lee, M. J., Lambert, J. D., Prabhu, S., Meng, X., et al., Delivery of tea polyphenols to the oral cavity by green tea leaves and black tea extract. Cancer Epidemiol Biomarkers Prev 2004, 13, [33] Odiatou, E. M., Skaltsounis, A. L., Constantinou, A. I., Identification of the factors responsible for the in vitro pro-oxidant and cytotoxic activities of the olive polyphenols oleuropein and hydroxytyrosol. Cancer Lett 2013, 330, [34] Yang, G. Y., Liao, J., Kim, K., Yurkow, E. J., Yang, C. S., Inhibition of growth and induction of apoptosis in human cancer cell lines by tea polyphenols. Carcinogenesis 1998, 19, [35] Yang, G. Y., Liao, J., Li, C., Chung, J., et al., Effect of black and green tea polyphenols on c-jun phosphorylation and H2O2 production in transformed and nontransformed human bronchial cell lines: possible mechanisms of cell growth inhibition and apoptosis induction. Carcinogenesis 2000, 21, [36] Nakazato, T., Ito, K., Ikeda, Y., Kizaki, M., Green tea component, catechin, induces apoptosis of human malignant B cells via production of reactive oxygen species. Clin Cancer Res 2005, 11, [37] Brady, N. R., Hamacher-Brady, A., Westerhoff, H. V., Gottlieb, R. A., A wave of reactive oxygen species (ROS)-induced ROS release in a sea of excitable mitochondria. Antioxid Redox Signal 2006, 8, [38] Doughan, A. K., Harrison, D. G., Dikalov, S. I., Molecular mechanisms of angiotensin II-mediated mitochondrial dysfunction: linking mitochondrial oxidative damage and vascular endothelial dysfunction. Circ Res 2008, 102,

90 77 [39] Satoh, M., Takemura, Y., Hamada, H., Sekido, Y., Kubota, S., EGCG induces human mesothelioma cell death by inducing reactive oxygen species and autophagy. Cancer Cell Int 2013, 13, 19. [40] Hussain, S., Slikker, W., Ali, S. F., Role of metallothionein and other antioxidants in scavenging superoxide radicals and their possible role in neuroprotection. Neurochem Int 1996, 29, [41] Masters, B. A., Quaife, C. J., Erickson, J. C., Kelly, E. J., et al., Metallothionein-Iii Is Expressed in Neurons That Sequester Zinc in Synaptic Vesicles. J Neurosci 1994, 14, [42] Ruf, J., Carayon, P., Structural and functional aspects of thyroid peroxidase. Arch Biochem Biophys 2006, 445, [43] De Micco, C., Ruf, J., Chrestian, M. A., Gros, N., et al., Immunohistochemical study of thyroid peroxidase in normal, hyperplastic, and neoplastic human thyroid tissues. Cancer 1991, 67, [44] Smanik, P. A., Fithian, L. J., Jhiang, S. M., Thyroid peroxidase expression and DNA polymorphisms in thyroid cancer. Biochem Biophys Res Commun 1994, 198,

91 78 Chapter 3 The differential pro-oxidative effects of the green tea polyphenol, (-)- epigallocatechin-3-gallate, in normal and oral cancer cells are related to differences in sirtuin 3 signaling 3.1 Abstract I have previously identified that the green tea catechin, EGCG, can induce oxidative stress in oral cancer cells but exerts antioxidant effects in normal cells. Mitochondria and particularly EGCG-induced mtros appear to play an important role as mtros were found to be associated with mitochondrial dysfunction, the following cellular ROS burst and apoptosis in oral cancer cells. However, it is unclear whether EGCG could induce mtros in normal cells. Here, I found that EGCG did not significantly induce mtros in normal HGF-1 cells. By contrast, EGCG did not only induce mtros in SCC-25 cells, but also in SCC-9 and premalignant leukoplakia cells (MSK-Leuk1). Mitochondrial deacetylase sirtuin 3 (SIRT3) has been reported as an important regulator to mitigate mtros. I further found that EGCG-mediated differential pro-oxidative effects are associated with SIRT3 signaling. EGCG suppressed SIRT3 mrna and protein expression, as well as, SIRT3 activity in SCC-25 cells, whereas it increased SIRT3 activity in HGF-1 cells. EGCG selectively decreased the nuclear localization of the estrogen-related receptor α (ERRα), the transcription factor regulating SIRT3 expression, in SCC-25 cells. This indicates that EGCG may regulate SIRT3 transcription in oral This study was published in Mol Nutr Food Res, 2015, 59 (2):

92 79 cancer cells through ERRα. EGCG also differentially modulated the mrna expressions of SIRT3-associated downstream targets including glutathione peroxidase 1 and superoxide dismutase 2 in normal and oral cancer cells. In summary, SIRT3 represents a novel potential target through which EGCG exerts differential pro-oxidant effects in cancer and normal cells Introduction In 2014, an estimated 42,440 new cases and 8390 deaths from oral cancer are expected in the United States 1. Tobacco use is a major etiological factor in oral cancer and can induce genetic changes that irreversibly increase cancer risk 2. Base on this, development of dietary preventive interventions represent a potentially efficacious approach to reduce oral cancer. EGCG is the most abundant polyphenol in green tea (Camellia sinensis) and has been shown to have cancer chemopreventive effects both in vitro and in vivo 3-6. Although studies have attributed these effects to the antioxidant activity of EGCG, there is increasing evidence that EGCG-mediated oxidative stress may also play an important role 7-9. In lung tumor xenograft-bearing nu/nu mice, orally-administered EGCG induced dose-dependent oxidative stress, DNA damage, and apoptosis in tumor but not normal tissue 10. Given the pro-oxidant roles of EGCG identified both in vitro and in vivo, the underlying biologically-plausible mechanism remains unclear. Previously, EGCG induced intracellular reactive oxygen species (ROS) and apoptosis in oral cancer cells. These effects were not mitigated by inclusion of cell-impermeable superoxide dismutase

93 80 and catalase, but were reduced by inclusion of the mitochondria-specific antibody, MitoTEMPO, suggesting that the pro-oxidant effects of EGCG arise from mitochondrial dysfunction 11. EGCG has been shown to induce differential redox effects and cytotoxicity in cancer and normal tissues/cells. In vitro, EGCG induced oxidative stress in oral squamous carcinoma cells but reduced ROS in normal epidermal keratinocytes to background levels 12. Differences in endogenous catalase activity may in part explain the differential pro-oxidant effects of EGCG: normal human keratinocytes have higher catalase activity and were least susceptible to hydrogen peroxide. P57, a cyclin-dependent kinase inhibitor, may also play a role. P57 expression was up-regulated by EGCG in normal keratinocytes but not in oral carcinoma cells 13, 14. SIRT3 plays an important role in maintaining mitochondrial redox balance 15. SIRT3 physically interacts with at least one of the known subunits of Complex I, enhances the activity by deacetylation, and reduces the formation of excess ROS 16. Cytochrome c (CYC) is another important component of the electron transport chain which helps control ROS leakage, and SIRT3 activity is required for CYC mrna expression 17, 18. SIRT3 can also modulate the expression and activity of antioxidant response proteins. For example, SIRT3 can modify the binding activity of FOXO3a and increase the expression of downstream antioxidant genes 19, 20. SIRT3 has also been shown to enhance SOD2 activity by lysine deacetylation 18, 21. Estrogen-related receptor (ERRα) is a nuclear receptor that regulates the expression of genes involved in mitochondrial biogenesis 22 and oxidative phosphorylation 23. ERRα, in conjunction with peroxisome proliferator-activated receptor gamma, coactivator 1

94 81 alpha (PGC-1α), acts as a transcription factor for SIRT3 18, 24. The impact of EGCG on the SIRT3 expression and SIRT3-mediated signaling in normal or oral cancer cells has not been examined. In the present study, I examined the induction of mitochondrial oxidative stress, SIRT3 expression and signaling in normal, leukoplakia, and oral cancer cells by EGCG and reported that the differential pro-oxidative effects of EGCG in oral cells are associated with SIRT3 signaling. 3.3 Materials and Methods Chemicals and reagents EGCG (93% pure) was purchased from Taiyo Green Power (Wuxi, Jiangsu, China). Anti-GAPDH and anti-histone 3 antibodies were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). Anti-PGC-1α and anti-errα antibodies were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA) and EMD Millipore Corporation (Temecula, CA, USA), respectively. All the other reagents were of the highest grade commercially-available Cell culture Human oral squamous cell carcinoma cells (SCC-25 and SCC-9) and gingival fibroblast cells (HGF-1) were purchased from the American Type Culture Collection (Rockville, MD, USA). Human leukoplakia cells (MSK-Leuk1) were obtained from the

95 82 Monoclonal Antibody Core Facility at Memorial Sloan-Kettering Cancer Center (New York, NY, USA). SCC-25 and -9 cells were cultured in DMEM:F-12 (1:1) medium supplemented with 10% fetal bovine serum (FBS), 1% penicillin-streptomycin (pen/strep) (Mediatech, Inc., Manassas,VA, USA) and 400 ng/ml hydrocortisone as a growth factor at 37 C under a 5% CO2 atmosphere. HGF-1 cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) and 1% pen/strep. MSK-Leuk1 cells were cultured in Defined Keratinocyte-SFM medium (Life Technologies, Carlsbad, CA, USA) supplemented with 5 μg/ml gentamicin. For all experiments, the initial cell density was 1.6 x 10 4 cells/cm 2 and cell lines were incubated in DMEM: F-12 (1:1) supplemented with 10% FBS, 1% pen/strep and 400 ng/ml hydrocortisone. The concentrations of EGCG used in this study are physiologically-relevant in the context of the oral cavity: we have found that green tea extract-containing gum (50 mg extract per stick) can result in salivary concentrations of EGCG in excess of 5 mm (Lambert, unpublished data) Determination of mitochondria-specific ROS Mitochondria-specific hydrogen peroxide was determined by staining with MitoPY1 (Tocris Bioscience, Bristol, United Kingdom) 25. Cells were treated with EGCG for 0-6 h. After washing with PBS, the cells were stained with 10 µm MitoPY1 at 37 C for 30 min. The fluorescence was detected by FV1000 confocal microscope (Olympus Imaging America Inc., Center Valley, PA, USA) at λex = 510 nm and λem = 528 nm. Images were captured by Fluoview (Olympus Imaging America Inc.) and were quantified using Image

96 83 J software (National Institutes of Health, Bethesda, MD, USA). The corrected total cell fluorescence (CTCF) was calculated as: CTCF = Integrated density (Area Mean fluorescence of background) Mitochondrial membrane potential Mitochondrial membrane potential was determined by staining with MitoTracker Red 26. Cells were treated with EGCG for 0-6 h and then incubated with 200 nm MitoTracker at 37 C for 30 min. Fluorescence was detected by FV1000 confocal microscope (λex= 579 nm and λem= 599 nm). Images were captured by Fluoview and were quantified using Image J software Intracellular levels of EGCG Cells were treated with EGCG for min. The cells were scraped into 0.2% ascorbic acid in water, sonicated, and centrifuged at 14,000 g for 10 min at 4 C. The supernatant was combined with an equal volume of cold methanol to precipitate protein, and centrifuged at 14,000 g for 10 min. The supernatant was then filtered and analyzed for EGCG by HPLC with electrochemical detection 27. Intracellular EGCG was normalized to total protein content.

97 Gene expression studies Cells were treated with EGCG for 0-24 h. RNA was isolated by RNeasy Mini kit (QIAGEN Inc., Valencia, CA, USA). Following reverse transcription (RT²HT First Strand Kit, QIAGEN Inc.), genes of interest were amplified by real-time reversetranscriptase PCR (qpcr) using RT²SYBR Green ROX qpcr Mastermix (QIAGEN Inc.) and ABI-7300 real time PCR machine (Applied Biosystems, Foster City, CA, USA). SIRT3, ERRα and PGC-1α primers were obtained from QIAGEN Inc. The others were obtained from the Genomics Core Facility at Pennsylvania State University (Table 3-1). GAPDH was used as an internal standard. Expression data was analyzed by 2 Ct method and is presented relative gene expression. Table 3-1. Primer sequences used in qpcr. Genes Primer sequence (5-3 ) CYC Forward ACATGGCGAAACCCTGTCTCTACA Reverse GCTTGAGTGCAGTGGCACAATCTT FOXO3a Forward ACAAACGGCTCACTCTGTCCCAG Reverse AGCTCTTGCCAGTTCCCTCATTCTG GAPDH Forward TGGGTGTGAACCATGAGAAG Reverse GCTAAGCAGTTGGTGGTGC GPX1 Forward CGCCACCGCGCTTATGACCG Reverse GCAGCACTGCAACTGCCAAGCAG SOD2 Forward TGACAAGTTTAAGGAGAAGC Reverse GAATAAGGCCTGTTGTTCC

98 Western blot analysis Cells were lysed in MENG buffer with containing 2% phosphatase and protease inhibitor cocktails. Protein concentration was determined by the Bradford assay. Cells were fractionated using the NE-PER Nuclear and Cytoplasmic Extraction Kit (Thermo Scientific Inc., Waltham, MA, USA). The lysates were resolved by SDS polyacrylamide gel electrophoresis, transferred to nitrocellulose membrane, and blocked as previously described 11. The membrane was then probed with an appropriate primary and fluorescentconjugated secondary antibodies (LI-COR Corporate, Lincoln, NE, USA). Protein bands were visualized using a LI-COR Odyssey Imaging System. Target protein expression was normalized to GAPDH or Histone SIRT3 activity assay SIRT3 was first immunoprecipitated using the Pierce Crosslink Immunoprecipitation Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) and SIRT3 activity was measured by SIRT3 Direct Fluorescent Screening Assay Kit (Cayman Chemical Company, Ann Arbor, MI, USA). Activity was normalized to total SIRT3 protein Statistical Analysis One-way ANOVA with Tukey s or Dunnett s post-test was used to compare differences between control and treatments. Two-way ANOVA with Bonferroni post-test

99 86 was used to compare the variations when there are more than one factor (i.e. time) between control and treatments. Data are expressed as mean ± SD or SEM, and significance was reached at P<0.05 or P<0.01. All the experiments were repeated at least twice and had at least duplicates for each experiment. 3.4 Results EGCG-induced production of mitochondrial ROS and dysfunction EGCG induced a significant time-dependent increase of mtros in SCC-25 cells, but not HGF-1 cells (Figure 3-1A). Similarly, EGCG dose-dependently increased the production of mtros in SCC-9 and MSK-Leuk1 cells after 6 h (Figure 3-1B). EGCG reduced the mitochondrial membrane potential in SCC-25 cells, but increased it in HGF- 1 cells (Figure 3-1A) Intracellular EGCG levels To determine if these differential mitochondrial effects were due to selective accumulation of EGCG in SCC-25 cells compared to HGF-1 cells, intracellular EGCG in both cell lines was measured. The results showed no significant difference in EGCG accumulation between normal and cancer cells (Figure 3-1C). By 3 h, EGCG could not be detected (Figure 3-1C).

100 87 Figure 3-1. EGCG-induced mitochondrial reactive oxygen species and changes in mitochondrial membrane potential in oral cells. (A) SCC-25 and HGF-1 cells were treated with 0 or 100 µm EGCG for 0-6 h. mtros were examined by MitoPY1 staining and changes of mitochondrial membrane potential were indicated by MitoTracker Red staining. Images were quantified by Image J. Error bars represent SEM. (B) SCC-9 and MSK-Leuk1 cells were treated with µm EGCG for 6 h. mtros was detected by MitoPY1 staining. (C) Intracellular EGCG was measured by HPLC after 100 µm EGCG treatment for 5 min-6 h. Error bars represent SD. * indicates p<0.05; ** indicates p<0.01 compared to control.

101 EGCG-induced changes in SIRT3 expression and activity SIRT3 is the key regulator of mitochondrial oxidative stress. EGCG significantly reduced the mrna levels of SIRT3 in SCC-25, -9, and MSK-Leuk1 cells but caused no significant changes in SIRT3 expression in HGF-1 cells (Figure 3-2A). Co-treatment with NAC or MitoTEMPO for 6 h significantly blunted the effects of EGCG on SIRT3 expression (Figure 3-2B). Subsequently, EGCG time-dependently reduced SIRT3 protein levels in SCC-25, but not in HGF-1 cells (Figure 3-2C). Likewise, EGCG exerted differential time-dependent changes in SIRT3 activity in SCC-25 compared to that in HGF-1 cells. In SCC-25 cells, SIRT3 activity was increased compared to the baseline after 1 h treatment with EGCG, but it was suppressed after 12 h (Figure 3-2D). SIRT3 activity in HGF-1 cells was time-dependently increased by EGCG treatment (Figure 3-2E).

102 89 Figure 3-2. EGCG-induced differential changes of SIRT3 expression and activity in oral cells. (A) SCC-25 and HGF-1 cells were treated with 100 µm EGCG for 0-6 h. SCC-9 and MSK- Leuk1 cells were treated with µm EGCG for 6 or 12 h. mrna levels of SIRT3 were measured by qpcr. (B) SCC-25 cells were treated with 0 or 100 µm EGCG in the presence or absence of 2 µm MitoTEMPO or 2 mm NAC for 6 h. mrna levels of SIRT3 were measured by qpcr. (C) SCC-25 and HGF-1 cells were treated with 100 µm EGCG for 0-24 h. SIRT3 were detected by western blot and quantified by Licor Odyssey Imaging System. SCC-25 (D) or HGF-

103 90 1 cells (E) were treated with 0 or 100 µm EGCG for 1 or 12 h. The SIRT3 protein was immunoprecipitated and its activity was measured by SIRT3 Direct Fluorescent Screening Assay Kit. Error bars represent SD. * indicates p<0.05; ** indicates p<0.01 compared to control EGCG-induced changes in ERRα and PGC-1 expression and localization ERR and PGC-1 play key roles in the expression of SIRT3. EGCG significantly reduced the ERRa mrna levels in SCC-25 cells without causing a significant change in ERRa expression in HGF-1 cells (Figure 3-3A). These effects were mitigated by NAC and MitoTEMPO (Figure 3-3B). EGCG also attenuated total cellular protein expression and nuclear localization of ERRα in SCC-25 but not in HGF-1 cells (Figure 3-3C and D). EGCG treatment reduced the mrna levels of PGC1α by 84% in SCC-25 cells, but no remarkable reduction was observed in HGF-1 cells (Figure 3-4A). These effects were blunted by co-treatment with either NAC or MitoTEMPO (Figure 3-4B). EGCG did not alter protein expression or localization of PGC-1α (Figure 3-4C and D) EGCG-induced differential changes in SIRT3 downstream gene expressions SIRT3 controls the expression of a number of antioxidant response and mitochondria-associated genes. EGCG time-dependently reduced GPX1, SOD2 and CYC mrna in SCC-25 cells, whereas SOD2 and GPX1 expression were increased in HGF-1 cells. FOXO3a mrna expression were reduced in SCC-25 cells, but increased in HGF-1 cells (Figure 3-5A). EGCG-mediated suppression of GPX1 and FOXO3a expression in

104 SCC-9 and MSK-Leuk1 cells was also observed. EGCG induced the expression of SOD2 in both cell lines at 6 h but suppressed it at 12 h (Figure 3-5B and C). 91

105 92 Figure 3-3. EGCG-induced differential changes of ERRα expression and nuclear localization in oral cells. (A) Cells were treated with 100 µm EGCG for 0-6 h. mrna levels of ERRα were measured by qpcr. (B) SCC-25 cells were treated with 0 or 100 µm EGCG in the presence or absence of 2 µm MitoTEMPO or 2 mm NAC for 6 h. mrna levels of ERRα were measured by qpcr. (C) Cells were treated with 100 µm EGCG for 0-24 h. ERRα were detected by western blot and quantified by Licor Odyssey Imaging System. (D) Cells were treated with 0 or 100 µm EGCG for 0-6 h. Nuclear and cytoplasmic ERRα were detected by western blot and quantified by Licor Odyssey Imaging System. Error bars represent SD. * indicates p<0.05; ** indicates p<0.01 compared to control.

106 93 Figure 3-4. EGCG-induced differential changes of PGC-1α expression and nuclear localization in oral cells. (A) SCC-25 and HGF-1 cells were treated with 100 µm EGCG for 0, 1, 3, or 6 h. mrna levels of PGC-1α were measured by qpcr. (B) SCC-25 cells were treated with 0 or 100 µm EGCG in the presence or absence of 2 µm MitoTEMPO or 2 mm NAC for 6 h. mrna levels of PGC-1α were measured by qpcr. (C) SCC-25 and HGF-1 cells were treated with 100 µm EGCG for 0-24 h. PGC-1α was detected by western blot and quantified by LiCor Odyssey Imaging System. (D) SCC-25 and HGF-1 cells were treated with 0 or 100 µm EGCG for 0-6 h. Nuclear and cytoplasmic PGC-1α were detected by western blot. The ratio of nuclear to cytoplasmic PGC-1α was calculated as an indicator of PGC-1α activity. Error bars represent SD. * indicates p<0.05; ** indicates p<0.01 compared to control.

107 Figure 3-5. EGCG-induced differential changes of SIRT3-mediated downstream genes in oral cells. (A) SCC-25 and HGF-1 cells were treated with 100 µm EGCG for 0-24 h. mrna levels of GPX1, SOD2, TRXR2, CYC and FOXO3a were measured by qpcr. (B) SCC-9 cells were treated with 0, 50 or 100 µm EGCG for 6 or 12 h. mrna levels of GPX1, SOD2, and FOXO3a were determined by qpcr. (C) MSK-Leuk1 cells were treated with µm EGCG for 6 or 12 h. mrna levels of GPX1, SOD2, and FOXO3a were determined by qpcr. Error bars represent SD. * indicates p<0.05; ** indicates p<0.01 compared to control. 94

108 Discussion We and others have reported that EGCG can selectively reduce the viability of cancer cells compared to normal cells 11, 28. However, there is no clear mechanism for the selective effects of EGCG in cancer cells compared to normal cells. Here, I found that EGCG rapidly induced mtros in oral cancer cells, but not in normal oral cells. In HGF-1 cells, EGCG increased mitochondrial membrane potential, indicating a mitochondrial protective effect. Previously, I observed that EGCG differentially induced the expression of a number of antioxidant-related genes in normal versus oral cancer cells. Here, I identified the changes in SIRT3 expression and activity as a potential mechanism for these differential effects. EGCG significantly reduced mrna and protein levels of SIRT3 in cancer and leukoplakia cells, but had no effect on SIRT3 expression in normal cells. Interestingly, EGCG initially induced SIRT3 activity in both cancer and normal cells. Yet, by 12 h, activity was suppressed in cancer cells whereas it was continued to increase in normal cells. The differential kinetic effects of EGCG on SIRT3 expression and activity in SCC- 25 cells suggest that EGCG may mediate expression (transcriptional regulation) and activation (post-translational regulation) by different mechanisms. The rapid, but transient, increase in activity may represent post-translational activation and a response to EGCG-induced cytotoxicity, whereas the down-regulation of SIRT3 expression may represent a later response to EGCG treatment resulting in an overall decrease in antioxidant response. Further studies are needed to explore these underlying mechanisms.

109 96 EGCG-mediated induction of mtros in SCC-25 cells (at 3 h) preceded significant changes in SIRT3 expression, and these changes in SIRT3 mrna expression were mitigated by addition of MitoTEMPO and NAC. These results indicate that EGCGmediated changes in SIRT3 in oral cancer cells are driven by mtros. ERRα in combination with PGC-1α mediates SIRT3 transcription 18. We report for the first time that EGCG significantly reduced the expression and nuclear translocation of ERRα in SCC-25 cells, but it had no effect on expression or translocation in HGF-1 cells. The pattern of change for ERRα correlates with that of SIRT3, suggesting that EGCG may mediate the transcription of SIRT3 through ERRα. EGCG also significantly decreased PGC-1α mrna levels in SCC-25 cells, but it did not affect protein expression or localization. Inclusion of MitoTEMPO and NAC blocked EGCG-mediated changes in mrna levels of PGC1α and ERRα, indicating a key role for EGCG-mediated ROS. In SCC-25 cells, EGCG caused a time-dependent reduction in SOD2 and GPX1 mrna levels, as well as, a transient reduction in the mrna expression of FOXO3a. Similar results for GPX1 and FOXO3a were observed in SCC-9 and MSK-Leuk1 cells, suggesting that these effects are generalizable across pre-malignant and malignant oral cell lines. This overall reduction of mitochondria-associated antioxidant responsive genes by EGCG would potentially impair antioxidant defense and may explain in part the progressive increase of mtros in SCC-25 cells. By contrast, EGCG time dependently increased GPX1 and FOXO3a transcription in HGF-1 cells, and transiently increased SOD2. Overall, these changes provide a mechanistic explanation for the absence of EGCG-mediated mitochondrial dysfunction and oxidative stress in this normal oral cell line. Given the established role that SIRT3 plays in regulating the expression of these

110 97 genes, the results also indicate that EGCG-mediated differential changes in SIRT3 expression and activity result in differential effects on downstream stress response. Previously, Hsu et al. reported that differential effects of EGCG in normal keratinocytes and oral cancer cells were due to the selective up-regulation of p57 in the normal keratinocytes 13, 14, 19. Since SIRT3 may modulate the transcription of p57 through FOXO3a, our findings indicate that the effects of EGCG on p57 are driven in part by EGCG-mediated changes in SIRT3. This relationship remains speculative since our studies involved a normal mesenchymal cell line, whereas Hsu et al., employed normal epithelial cells. Based on the results, I propose a mechanism by which EGCG exerts differential prooxidative effects in normal and oral cancer cells (Figure 3-6). In oral cancer cells, EGCG inhibits the expression and activity of SIRT3, resulting in decreased antioxidant response and increased mtros. The accumulation of mtros leads to mitochondrial dysfunction and cell death. By contrast, in normal cells, EGCG rapidly increase SIRT3 enzyme activity as well as SIRT3-modulated downstream antioxidant response genes. This prevents the accumulation of mtros and reduces EGCG cytotoxicity in normal cells. One limitation of our studies is that the comparisons are made between epitheliumderived cancer and pre-cancerous cell lines, and mesenchymal-derived normal cells. Although additional studies are needed to confirm these differential effects between normal primary oral epithelial cells and cancer cells, the current results are consistent with previous studies showing differential effects of EGCG in normal and cancer cells and provide support for the proposed mechanistic effects

111 98 In summary, EGCG induces differential mitochondrial dysfunction and oxidative stress in normal versus oral cancer cells, and these effects are related to differential modulation of SIRT3 and its downstream targets. These results provide a novel mechanism by which EGCG can selectively target cancer cells compared to normal cells. Future studies are needed to determine the extent to which SIRT3 mediates the effects of EGCG in normal and cancer tissue in vivo.

112 99 Figure 3-6. A proposed mechanism for the differential pro-oxidant effects of EGCG in normal and oral cancer cells. In oral cancer cells, EGCG inhibits SIRT3 activity and expression, resulting in the accumulation of mtros, mitochondrial dysfunction, and ultimately cell death. In normal oral cells, EGCG activates SIRT3 and related downstream antioxidant responsive genes (A/O genes), preventing the cells from oxidative damage.

113 References [1] American Cancer Society, GA, USA [2] Zain, R. B., Karen-Ng, L. P., Cheong, S. C., Anwar, A., et al., Effects of smoking on oral cancer transcriptome. Oral Oncol 2011, 47, S48-S48. [3] Graham, H. N., Green tea composition, consumption, and polyphenol chemistry. Prev Med 1992, 21, [4] Muto, S., Fujita, K., Yamazaki, Y., Kamataki, T., Inhibition by green tea catechins of metabolic activation of procarcinogens by human cytochrome P450. Mutat Res 2001, 479, [5] Yang, C. S., Lambert, J. D., Sang, S. M., Antioxidative and anti-carcinogenic activities of tea polyphenols. Arch Toxicol 2009, 83, [6] Kanwar, J., Taskeen, M., Mohammad, I., Huo, C., et al., Recent advances on tea polyphenols. Front Biosci 2012, 4, [7] Elbling, L., Weiss, R. M., Teufelhofer, O., Uhl, M., et al., Green tea extract and (-)-epigallocatechin-3-gallate, the major tea catechin, exert oxidant but lack antioxidant activities. FASEB J 2005, 19, [8] Lambert, J. D., Elias, R. J., The antioxidant and pro-oxidant activities of green tea polyphenols: a role in cancer prevention. Arch Biochem Biophys 2010, 501, [9] Forester, S. C., Lambert, J. D., The role of antioxidant versus pro-oxidant effects of green tea polyphenols in cancer prevention. Mol Nut Food Res 2011, 55,

114 101 [10] Li, G.-X., Chen, Y.-K., Hou, Z., Xiao, H., et al., Pro-oxidative activities and dose-response relationship of (-)-epigallocatechin-3-gallate in the inhibition of lung cancer cell growth: a comparative study in vivo and in vitro. Carcinogenesis 2010, 31, [11] Tao, L., Forester, S. C., Lambert, J. D., The role of the mitochondrial oxidative stress in the cytotoxic effects of the green tea catechin, (-)-epigallocatechin-3- gallate, in oral cells. Mol Nutr Food Res 2014, 58, [12] Yamamoto, T., Hsu, S., Lewis, J., Wataha, J., et al., Green Tea Polyphenol Causes Differential Oxidative Environments in Tumor versus Normal Epithelial Cells. Pharmacology 2003, 307, [13] Hsu, S. D., Singh, B. B., Lewis, J. B., Borke, J. L., et al., Chemoprevention of oral cancer by green tea. Gen Dent 2002, 50, [14] Hsu, S., Lewis, J. B., Borke, J. L., Singh, B., et al., Chemopreventive effects of green tea polyphenols correlate with reversible induction of p57 expression. Anticancer Res 2001, 21, [15] Bause, A. S., Haigis, M. C., SIRT3 regulation of mitochondrial oxidative stress. Exp Gerontol 2013, 48, [16] Ahn, B. H., Kim, H. S., Song, S., Lee, I. H., et al., A role for the mitochondrial deacetylase Sirt3 in regulating energy homeostasis. Proc Natl Acad Sci U.S.A. 2008, 105, [17] St-Pierre, J., Drori, S., Uldry, M., Silvaggi, J. M., et al., Suppression of reactive oxygen species and neurodegeneration by the PGC-1 transcriptional coactivators. Cell 2006, 127,

115 102 [18] Kong, X., Wang, R., Xue, Y., Liu, X., et al., Sirtuin 3, a new target of PGC- 1alpha, plays an important role in the suppression of ROS and mitochondrial biogenesis. PLoS One 2010, 5, e [19] Jacobs, K. M., Pennington, J. D., Bisht, K. S., Aykin-Burns, N., et al., SIRT3 interacts with the daf-16 homolog FOXO3a in the mitochondria, as well as increases FOXO3a dependent gene expression. Int J Biol Sci 2008, 4, [20] Sundaresan, N. R., Gupta, M., Kim, G., Rajamohan, S. B., et al., Sirt3 blocks the cardiac hypertrophic response by augmenting Foxo3a-dependent antioxidant defense mechanisms in mice. J Clin Invest 2009, 119, [21] Qiu, X., Brown, K., Hirschey, M. D., Verdin, E., Chen, D., Calorie restriction reduces oxidative stress by SIRT3-mediated SOD2 activation. Cell Metab 2010, 12, [22] Wu, Z. D., Puigserver, P., Andersson, U., Zhang, C. Y., et al., Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell 1999, 98, [23] Mootha, V. K., Handschin, C., Arlow, D., Xie, X., et al., Erralpha and Gabpa/b specify PGC-1alpha-dependent oxidative phosphorylation gene expression that is altered in diabetic muscle. Proc Natl Acad Sci U. S. A. 2004, 101, [24] Buler, M., Aatsinki, S. M., Izzi, V., Hakkola, J., Metformin Reduces Hepatic Expression of SIRT3, the Mitochondrial Deacetylase Controlling Energy Metabolism. Plos One 2012, 7.

116 103 [25] Dickinson, B. C., Chang, C. J., A targetable fluorescent probe for imaging hydrogen peroxide in the mitochondria of living cells. J Am Chem Soc 2008, 130, [26] Matsuda, N., Sato, S., Shiba, K., Okatsu, K., et al., PINK1 stabilized by mitochondrial depolarization recruits Parkin to damaged mitochondria and activates latent Parkin for mitophagy. J Cell Biol 2010, 189, [27] Lee, M. J., Prabhu, S., Meng, X., Li, C., Yang, C. S., An improved method for the determination of green and black tea polyphenols in biomatrices by highperformance liquid chromatography with coulometric array detection. Anal Biochem 2000, 279, [28] Satoh, M., Takemura, Y., Hamada, H., Sekido, Y., Kubota, S., EGCG induces human mesothelioma cell death by inducing reactive oxygen species and autophagy. Cancer Cell Int 2013, 13, 19.

117 104 Chapter 4 The role of metallothioneins in the differential pro-oxidant effects of (-)- epigallocatechin-3-gallate in oral cells 4.1 Abstract Previously, I have identified that SIRT3 plays an important role in EGCG-mediated differential pro-oxidant effects in oral cells. Interestingly, when I knocked down the mrna expression of SIRT3 in cancer cells (SCC-25), the cells developed resistance to EGCG-induced growth inhibition. EGCG did not induce ROS but caused a significant reduction of ROS in si-sirt3 cells. These suggested a potential alternative antioxidant signaling when SIRT3 is malfunctioning in cancer cells. A further qpcr analysis identified that EGCG significantly up-regulated MT genes as well as the MT transcription factor, MTF1 in si-sirt3 cells, indicating that MT may be an alternative regulator in response to EGCG-mediated effects. To further investigate the role of MT in EGCGinduced differential pro-oxidant effects, I measured the mrna expression of MTs in oral cancer and normal cells. EGCG (100 μm, 0-24 h) down-regulated most MT isoforms in oral squamous carcinoma cells (SCC-25) including MT1E (-60%, 24 h), MT1F (-40%, 12 h), MT1G (-46%, 24 h), MT1X (-65%, 24 h) and MT2A (-50%, 24 h), while up-regulating several MTs in normal gingival fibroblasts (HGF-1), particularly MT1G (+20,900%, 12 h) and MT1X (+350%, 12 h). To further determine the role of MTs, I knocked down MTF1 This study was published in Mol Nutr Food Res, 2015, 59 (2):

118 105 in SCC-25 cells and found that mrna expression of MTs, SIRT3, NFE2L1 and NFE2L2 was significantly decreased in si-mtf1 cells. This indicates that MTF1 may be an upstream regulator of SIRT3. Additionally, EGCG inhibited the transcriptional activity of MTF1 in cancer cells (P<0.05, 12 h; P=0.06, 24 h) but increased the activity of MTF1 in normal cells (P=0.08, 24 h). In conclusion, the current study identified a novel regulation of MT by EGCG, which may be an additional pathway modulating the antioxidant signaling in oral cells.

119 4.2 Introduction 106 Oral cancer is the eighth most common cancer worldwide 1. Tobacco use and excessive alcohol consumption are considered as major risk factors. Oral cancer can be dangerous because at early stages when it does not produce pain or symptoms and is often neglected by patients until the cancer has metastasized ( Oral cancer treatment leaves survivors with severe facial disfigurement and dysfunction 2. Therefore, early detection and intervention could significantly reduce oral cancer deaths. EGCG is the most abundant polyphenol in green tea and has shown cancer chemopreventive and chemotherapeutic effects both in vitro and in vivo 3-6. Recently, there is increasing evidence supporting the pro-oxidant effects of EGCG in cancer prevention 7, 8. For example, I have reported that EGCG initially triggers reactive oxygen species in mitochondria of oral cancer cells in culture, resulting in mitochondrial dysfunction and apoptosis 9. In lung tumor xenograft-bearing nu/nu mice, orally-administered EGCG (0.1, 0.3 or 0.5% in the diet) induced dose-dependent oxidative stress, DNA damage, and apoptosis in tumor tissue 10. Human volunteers holding green tea solution ( %) generated salivary H2O2 (Cmax= mm). Chewing 2 g green tea leaves produced higher levels of H2O2 (Cmax=31.2 mm) 11. These results suggest that in specific tissues (i.e. oral cavity or lung) where there is relatively high oxygen partial pressure, EGCG is likely to be oxidized and generate ROS in cells. It is not certain, however, if EGCG still has prooxidant activity in other types of tissue (i.e. liver, colon, etc.). Additionally, EGCG has been shown to induce differential redox effects and cytotoxicity in cancer and normal tissues/cells. In vitro, EGCG selectively induced oxidative stress in oral cancer cells but not normal cells 9, 12. In vivo, the cytotoxic and pro-

120 oxidant effects of EGCG observed in lung cancer xenografts were confined to tumor 107 tissue 10. P57, a cyclin-dependent kinase inhibitor was up-regulated by EGCG in oral carcinoma cells but not in normal keratinocytes and may be associated with the selectivity of EGCG 13, 14. Recently, we also reported that EGCG differentially modulated SIRT3 in oral cancer and normal cells 15. EGCG suppressed the expression and activity of SIRT3 in oral cancer cells. This was associated with EGCG-induced ROS and growth inhibition in cancer cells. By contrast, in normal cells, EGCG activated SIRT3 and up-regulated SIRT3-associated downstream gene expressions. Nevertheless, the mechanism under which EGCG selectively induced toxicity in cancer cells remains unclear. MTs are a family of intracellular, low molecular weight, cysteine-rich proteins 16. There are four main isoforms expressed in mammals: MT1 (subtypes A, B, E, F, G, H, L, M, X), MT2, MT3, MT4. MT1 and MT2 are the most widely expressed isoforms 17. The currently the known functions of MTs involve two main aspects: 1) binding of metals such as zinc, cadmium or copper; 2) antioxidant activities. The role of MTs in cancer is complicated. A meta-analysis of total 77 studies found a significantly positive association between MT staining and tumors (vs. healthy tissues) in head and neck as well as ovarian cancer, whereas a negative association was identified in liver cancer 18. From this perspective, MTs may be tumor promoter or suppressor depending on the specific demand of redox environment in tumors. Specifically, the role of MT in EGCG-induced pro-oxidant effects in oral cells has not been reported. MT mrna expression can be regulated by metal-regulatory transcription factor 1 (MTF1) 19. MTF1 is evolutionarily conserved from insects to mammals 20. So far, it has been characterized in human 21, mouse 22, 23, fish 24, 25 and Drosophila 26, where it is typically

121 108 present as a single copy gene. MTF1 can be activated directly by zinc or indirectly by 20, 27, release of zinc from metallothioneins upon cadmium load or oxidative stress (H2O2) 28. When activated, like most transcription factors, MTF1 translocates into nucleus and regulates the transcription of many antioxidant-related genes including MTs, thioredoxin reductase 2, selenoprotein W/H, etc. However, the effects of EGCG on MTF1 in oral cells remain unclear. In the present study, I examined the role of MT in the differential pro-oxidant effects of EGCG in oral cells.

122 4.3 Materials and Methods Chemicals and reagents EGCG (93% pure) was purchased from Taiyo Green Power (Wuxi, Jiangsu, China). All the other chemicals and reagents were of the highest grade commercially-available and were purchased from Sigma Chemical Co. (St. Louis, MO, USA), unless otherwise specified Cell culture Human oral squamous cell carcinoma cells (SCC-25 and SCC-9) and human gingival fibroblast cells (HGF-1) were purchased from the American Type Culture Collection (Rockville, MD, USA). Human premalignant leukoplakia cells (MSK-Leuk1) were obtained from the Monoclonal Antibody Core Facility at Memorial Sloan-Kettering Cancer Center (New York, NY, USA). SCC-25 and -9 cells were cultured in Dulbecco's Modified Eagle Medium (DMEM): nutrient mixture F-12 (1:1) supplemented with 10% fetal bovine serum, 1% penicillin-streptomycin (Mediatech, Inc., Manassas, VA, USA) and 400 ng/ml hydrocortisone at 37 C under a 5% CO2 atmosphere. HGF-1 cells were cultured in DMEM supplemented with 10% fetal bovine serum and 1% penicillinstreptomycin. MSK-Leuk1 cells were cultured in Defined Keratinocyte-SFM medium (Life Technologies, Carlsbad, CA, USA) supplemented with 5 μg/ml gentamicin. During treatments, all cell lines were incubated in DMEM: nutrient mixture F-12 (1:1)

123 110 supplemented with 10% fetal bovine serum, 1% penicillin-streptomycin and 400 ng/ml hydrocortisone Determination of total intracellular ROS Visualization of total intracellular ROS was accomplished by staining with 6- carboxy-2',7'-dichlorodihydrofluorescein diacetate, di(acetoxymethyl Ester) (H2DCFDA) (Life Technologies, Carlsbad, CA, USA) in combination with fluorescent microscopy 29. Cells were grown on glass coverslips overnight and treated with 100 µm EGCG. Following treatment, cells were incubated with 10 µm H2DCFDA for 30 min at 37 C, rinsed twice with PBS, coverslips were placed on microscope slides and examined by microscope (λex= 480 nm; λem= 520 nm). Fluorescence was quantified using Image J software (National Institutes of Health, Bethesda, MD, USA). The corrected total cell fluorescence (CTCF) was calculated by the formula below: CTCF = Integrated density (Area Mean fluorescence of background) Knocking down the expression of SIRT3 and MTF1 sirnas for SIRT3 and MTF1 were purchased from Sigma Chemical Co. (St. Louis, MO, USA). Control sirna was from both Santa Cruz Biotechnology, Inc. (USA) and Sigma Chemical Co. (USA). The protocol was generously provided by Dr. Shannon L. Kelleher s lab. Briefly, cells were growing in antibiotic-free growth medium one day before transfection with Lipofectamine 2000 reagent (Invitrogen, Carlsbag, CA). 50 nm

124 sirna was transfected for 5 h. After that, cells were grown in antibiotic-free growth 111 medium for 24 h before qpcr analysis Gene expression studies Cells were treated with 100 µm EGCG for 0-24 h. RNA was isolated by RNeasy Mini kit (QIAGEN Inc., Valencia, CA, USA) followed by reverse transcription (RT²HT First Strand Kit, QIAGEN Inc.). Real-time reverse-transcriptase PCR (qpcr) was performed using RT²SYBR Green ROX qpcr Mastermix (QIAGEN Inc.) and ABI-7300 real time PCR machine (Applied Biosystems, Foster City, CA, USA). The primers of SIRT3 and SOD1 are obtained from QIAGEN Inc. The other primers used for qpcr are from Genomics Core Facility at Pennsylvania State University with sequences shown in Table 4-1. GAPDH was used as an internal standard.

125 Table 4-1. Primer sequences used in qpcr. 112 Genes Primer sequence (5-3 ) hmt1a Forward CTCGAAATGGACCCCAACT Reverse ATATCTTCGAGCAGGGCTGTC hmt1b Forward GCTTGTCTTGGCTCCACA Reverse AGCAAACCGGTCAGGTAGTTA hmt1e Forward GCTTGTTCGTCTCACTGGTG Reverse CAGGTTGTGCAGGTTGTTCTA hmt1f Forward AGTCTCTCCTCGGCTTGC Reverse ACATCTGGGAGAAAGGTTGTC hmt1g Forward CTTCTCGCTTGGGAACTCTA Reverse AGGGGTCAAGATTGTAGCAAA hmt1h Forward CCTCTTCTCTTCTCGCTTGG Reverse GCAAATGAGTCGGAGTTGTAG hmt1m Forward TCCGGGTGGGCCTAGCAGTCG Reverse AATGCAGCAAATGGCTCAGTATCGTATTG hmt1x Forward TCTCCTTGCCTCGAAATGGAC Reverse GGGGCACACTTGGCACAGC hmt2a Forward CCGACTCTAGCCGCCTCTT Reverse GTGGAAGTCGCGTTCTTTACA hmt3 Forward CCGTTCACCGCCTCCAG Reverse CACCAGCCACACTTCACCACA hmt4 Forward CATGGACCCCAGGGAATGTGT Reverse GGGGTGGGCACGATGGA hmtf1 Forward GCGAGTGCACACGAAGGA Reverse CTGATGTGCTTTCAGCCTGTACA hnfe2l2 Forward GAGACAGGTGAATTTCTCCCAAT Reverse TTTGGGAATGTGGGCAAC hgapdh Forward TGGGTGTGAACCATGAGAAG Reverse GCTAAGCAGTTGGTGGTGC

126 Table 4-1. Cont. 113 mmt1 Forward GCTGTCCTCTAAGCGTCACC Reverse AGGAGCAGCAGCTCTTCTTG mmt2 Forward CAAACCGATCTCTCTCGTCGAT Reverse AGGAGCAGCAGCTTTTCTTG msod2 Forward CCGAGGAGAAGTACCACGAG Reverse GCTTGATAGCCTCCAGCAAC msirt3 Forward ATCCCGGACTTCAGATCCCC Reverse CAACATGAAAAAGGGCTTGGG mgapdh Forward TGAAGCAGGCATCTGAGGG Reverse CGAAGGTGGAAGAGTGGGAG

127 4.3.6 Statistical Analysis 114 GraphPad Prism was used for statistical analysis. One-way ANOVA with Tukey s or Dunnett s post-test was used to compare differences between control and treatments. Two-way ANOVA with Bonferroni post-test was used to compare the variations when there are more than one factor (i.e. time) between control and treatments. Time-dependent changes in antioxidant gene expression were analyzed by linear regression. Data were expressed as mean ± SD or mean ± SEM as indicated, and significance was reached at P<0.05 or P<0.01. All the experiments were repeated at least twice.

128 4.4 Results The knock-down of SIRT3 in SCC-25 cells Previously, I found that EGCG-induced differential pro-oxidant effects in oral cells were associated with SIRT3 signaling 15. In this study, I further examined the role of SIRT3 in cellular redox regulation and cell growth using sirna knockdown approaches. Figure 4-1A showed that SIRT3 were successfully silenced in SCC-25 cells. Unexpectedly, cells with reduced SIRT3 expression were resistant to EGCG-induced growth inhibition (Figure 4-1B). Moreover, EGCG treatment unexpectedly resulted in reduced ROS levels in si-sirt3 cells compared to control treatment (Figure 4-1C). Further qpcr analysis showed that several MTs were up-regulated in si-sirt3 cells. Accordingly, the mrna expression of MTF1, transcription factor of MT was also significantly up-regulated (Figure 4-2). These data suggest that MT pathway may interact with SIRT3. When SIRT3 is suppressed, MT expression is increased as a compensatory mechanism to protect cells from oxidative damage.

129 Figure 4-1. The knock-down of SIRT3 on SCC-25 cells. (A) SCC-25 cells were transfected with lipid reagent only (si-mock), control sirna (si-control), irna targeting SIRT3 (si-sirt3-1 and si-sirt3-2). SIRT3 expression was measured by qpcr. Since si-sirt3-1 and si-sirt3-2 achieved similarly high efficiency. si-sirt3-1 was used for the rest experiments. (B) 24 h after the transfection of si-control or si-sirt3-1, SCC-25 cells were treated with 0 or 100 µm EGCG for 24, 48 or 72 h. Cell viability was measured by MTT assay. (C) 24 h after the transfection of si-control or si-sirt3-1, SCC-25 cells were treated with 0 or 100 µm EGCG for 6 h. Intracellular ROS were detected by H2DCFDA staining and quantified by image J. Error bars in (C) represent standard error and other error bars represent standard deviation. * indicates p<0.05; ** indicates p < 0.01 compared to control. 116

130 117 Figure 4-2. The upregulation of MT genes in si-sirt3 cells. SCC-25 cells were transfected with Control (si-control) or SIRT3 (si-sirt3) sirna. 24 h after the transfection, the cells were harvested and gene expressions were measured by qpcr EGCG-induced differential changes of MTs mrna expression in oral cancer and normal cells To further understand if MT is likely to be an alternative target of EGCG to mediate differential pro-oxidant effects in oral cells, the mrna expression of different MT isoforms was measured by qpcr. EGCG treatment was found to differentially regulate the mrna expressions of several MT isoforms. Particularly, within 12 h, EGCG significantly up-regulated MT1G (209-fold) and MT1X (3.5-fold) in HGF-1 cells, but down-regulated them (46% and 65% decrease, respectively) in SCC-25 cells (Figure 4-3A). The mrna expressions of MT1F, MT1H, and MT1M also increased within 12 h after EGCG treatment in HGF-1 cells. By contrast, the expressions of these genes were decreased in SCC-25 cells within 12 h (Figure 4-3A). At 24 h, the changes of gene expressions tended to go toward the opposite directions, likely due to the adaptive

131 118 responses. EGCG did not exert differential effects on the mrna expressions of MT1A, MT1B, MT1E, MT2A, MT3 and MT4 (Figure 4-3A). The mrna expressions of MT1G and MT1X were also determined in SCC-9 and MSK-Leuk1 cells (Figure 4-3B). Similar to the gene expression pattern in SCC-25 cells, both MT1G and MT1X in SCC-9 and MSK-Leuk1 cells were significantly down-regulated by EGCG. MSK-Leuk1 cells showed a more dose-dependent response than SCC-9 cells to EGCG treatment.

132 Figure 4-3. EGCG-induced changes of MTs mrna expression in SCC-25 and HGF-1 cells. SCC-25 and HGF-1 cells were treated with 100 µm EGCG for 0, 6, 12, or 24 h. mrna levels of different MTs were measured by qpcr. * indicates p<0.05; ** indicates p <0.01 compared to each control. 119

133 4.4.3 The knocked-down of MTF1 in SCC-25 cells 120 To further understand the roles of MTs in EGCG-mediated differential pro-oxidant effects. The transcription factor of MTs, MTF1, was knocked down in SCC-25 cells. As expected, knocking down MTF1 decreased mrna expressions of MT1G, MT1H and MT1X (Figure 4-4B). Interestingly, knocking down MTF1 also significantly decreased the mrna expressions of SIRT3 indicating MTF1 as an upstream regulator of SIRT3 (Figure 4-4B). Interestingly, knocking down MTF1 also significantly decreased the mrna expressions of SIRT3, NFE2L1 and NFE2L2, indicating that MTF1 plays an important role in the regulation of SIRT3 and other antioxidant pathways (Figure 4-4C).

134 Figure 4-4. The knock-down of MTF1 on SCC-25 cells. (A) SCC-25 cells were transfected with lipid reagent only (si-mock), control sirna (si-control), sirna targeting SIRT3 (si-mtf1-1 and si-mtf1-2). SIRT3 mrna expression was measured by qpcr. Since si-mtf1-1 and si-mtf1-2 achieved similar high efficiency. si-mtf1-1 was used for the rest experiments. (B) SCC-25 cells were transfected with si-control or si-mtf1-1, 24 h after the transfection, the cells were harvested and gene expressions were measured by qpcr. Error bars represent standard deviation. * indicates p<0.05; ** indicates p <0.01 compared to control. 121

135 The effect of EGCG on mrna expression as well as transcriptional activity of MTF1 in SCC-25 cells To identify the modulation of MTF1 by EGCG, first the mrna expression of MTF1 was measured in oral cancer and normal cells after 12 h control or EGCG treatment (Figure 4-5A). EGCG significantly decreased the mrna level of MTF1 in MSK-Leuk1 cells, whereas increasing the mrna level in HGF-1 cells. Interestingly, EGCG significantly up-regulated the mrna expression of MTF1 in SCC-25 and SCC-9 cells. As MTF1 is a transcription factor, EGCG may modulate its transcriptional activity. Thus, we measured the nuclear to cytosol ratio of MTF1 in oral cancer and normal cells to indicate its transcriptional activity. EGCG significantly reduced the nuclear to cytosol ratio of MTF1 in SCC-25 cells, suggesting a suppression of MTF1 transcription activity in SCC-9 cells (Figure 4-5B). By contrast, EGCG increased that ratio in HGF-1 cells, although the data did not reach significance at P=0.05 (Figure 4-5B).

136 123 Figure 4-5. The regulation of MTF1 by EGCG. (A) SCC-25, SCC-9, MSK-Leuk1 and HGF-1 cells were treated with 0 or100 µm EGCG for 12 h. MTF1 mrna expression were measured by qpcr. (B) The nuclear and cytosol MTF1 from SCC-25 and HGF-1 cells were determined by western blot as an indicator of transcriptional activity. Error bars represent standard deviation. * indicates p<0.05; ** indicates p<0.01 compared to control. 4.5 Discussion Previously, I found that EGCG suppressed SIRT3 gene and protein expression and activity in oral cancer cells 15. By contrast, EGCG increased SIRT3 activity in normal cells. Unexpectedly, when I knocked down SIRT3 in SCC-25 cells, I observed an increased cell resistance to EGCG-induced growth inhibition. Further I found the upregulation of several MTs, MTF1 (transcriptional factor of MTs) and NFE2L1 (potential transcriptional factor of MT1 isoforms 30 ). Both MT and NFE2L1 have been reported to involve in antioxidant signaling 16, The upregulation of antioxidant response genes were associated with significantly decreased intracellular ROS, which in part explained the cell resistance to EGCG-induced growth inhibition in si-sirt3 SCC-25 cells.

137 124 Here, I found that EGCG also differentially regulated several MTs in oral cancer versus normal cells. EGCG increased the mrna expressions of MT1F, MT1G, MT1H, MT1M and MT1X in SCC-25 cells, whereas decreasing their expressions in HGF-1 cells. This suggests MT as a potential novel target involved in EGCG s differential pro-oxidant effects in oral cells. EGCG (130 μm) has been reported to significantly decrease MT1E mrna expression after 24 h treatment in breast cancer cells 33. In this study, EGCG also significantly down-regulated MT1E after 24 h in oral cancer cells. However, I found that EGCG also down-regulated MT1E in normal cells. In contrast to silencing SIRT3, the knock-down of MTF1 significantly decreased mrna levels of SIRT3, NFE2L1 and NFE2L2, indicating MTF1 is an upstream modulator of these genes. To our knowledge, this is the first report of association of MTF1 with SIRT3, NFE2L1 and NFE2L2. Noticeably, EGCG only decreased mrna level of MTF1 in MSK-Leuk1 cells but increased MTF1 expression in SCC-25 and SCC- 9 cells. Because modulation of MTF1 mrna expression may not fully explain changes in the regulatory activity of a protein, I further identified the effect of EGCG on transcriptional activity of MTF1 through measuring the nuclear to cytosol ratio. EGCG decreased the transcriptional activity of MTF1 in cancer cells but slightly increased the activity in normal cells. In conclusion, our study showed that EGCG did not only target SIRT3 in mitochondria, but also targeted MT in cytosol through modulating the transcriptional activity of MTF1 and the downstream MT expressions to mediate the differential prooxidant effects of EGCG (Figure 4-6). This study provides additional biomarkers that can be used in future animal studies.

138 125 Figure 4-6. The scheme of EGCG s differential pro-oxidant effects through mediating MT signaling. In addition to SIRT3, MT signaling also plays a role in EGCG-mediated differential pro-oxidant effects. In cancer cells, EGCG reduced the transcriptional activity of MTF1 and MTF1-mediated MTs mrna expressions, resulting additional oxidative stress. By contrast, in normal cells, EGCG activated SIRT3 and increased the transcriptional activity of MTF1 and MTF1-mediated MTs gene expressions, leading to active antioxidant responses.

139 4.6 References 126 [1] Petersen, P. E., Strengthening the prevention of oral cancer: the WHO perspective. Community Dent Oral Epidemiol 2005, 33, [2] Pace-Balzan, A., Shaw, R. J., Butterworth, C., Oral rehabilitation following treatment for oral cancer. Periodontol , 57, [3] Graham, H. N., Green tea composition, consumption, and polyphenol chemistry. Prev Med 1992, 21, [4] Muto, S., Fujita, K., Yamazaki, Y., Kamataki, T., Inhibition by green tea catechins of metabolic activation of procarcinogens by human cytochrome P450. Mutat Res 2001, 479, [5] Chung S. Yang, J. D. L. a. S. S., Antioxidative and anti-carcinogenic activities of tea polyphenols. Arch. Toxicol. 2009, 83, [6] Kanwar, J., Taskeen, M., Mohammad, I., Huo, C., et al., Recent advances on tea polyphenols. Front Biosci 2012, 4, [7] Forester, S. C., Lambert, J. D., The role of antioxidant versus pro-oxidant effects of green tea polyphenols in cancer prevention. Mol Nut Food Res 2011, 55, [8] Lambert, J. D., Elias, R. J., The antioxidant and pro-oxidant activities of green tea polyphenols: a role in cancer prevention. Arch Biochem Biophys 2010, 501, [9] Tao, L., Forester, S. C., Lambert, J. D., The role of the mitochondrial oxidative stress in the cytotoxic effects of the green tea catechin, (-)-epigallocatechin-3-gallate, in oral cells. Mol Nutr Food Res 2014, 58,

140 127 [10] Li, G.-X., Chen, Y.-K., Hou, Z., Xiao, H., et al., Pro-oxidative activities and dose-response relationship of (-)-epigallocatechin-3-gallate in the inhibition of lung cancer cell growth: a comparative study in vivo and in vitro. Carcinogenesis 2010, 31, [11] Lambert, J. D., Kwon, S. J., Hong, J., Yang, C. S., Salivary hydrogen peroxide produced by holding or chewing green tea in the oral cavity. Free Radic Res 2007, 41, [12] Yamamoto, T., Hsu, S., Lewis, J., Wataha, J., et al., Green Tea Polyphenol Causes Differential Oxidative Environments in Tumor versus Normal Epithelial Cells. Pharmacology 2003, 307, [13] Hsu, S. D., Singh, B. B., Lewis, J. B., Borke, J. L., et al., Chemoprevention of oral cancer by green tea. Gen Dent 2002, 50, [14] Hsu, S., Lewis, J. B., Borke, J. L., Singh, B., et al., Chemopreventive effects of green tea polyphenols correlate with reversible induction of p57 expression. Anticancer Res 2001, 21, [15] Tao, L., Park, J. Y., Lambert, J. D., The differential pro-oxidative effects of the green tea polyphenol, (-)-epigallocatechin-3-gallate, in normal and oral cancer cells are related to differences in sirtuin 3 signaling. Mol Nutr Food Res 2015, 59, [16] Coyle, P., Philcox, J., Carey, L., Rofe, A., Metallothionein: the multipurpose protein. Cell Mol Life Sci 2002, 59, [17] Thirumoorthy, N., Sunder, A. S., Kumar, K. T. M., Kumar, M. S., et al., A Review of Metallothionein Isoforms and their Role in Pathophysiology. World J Surg Oncol 2011, 9.

141 [18] Gumulec, J., Raudenska, M., Adam, V., Kizek, R., Masarik, M., 128 Metallothionein - Immunohistochemical Cancer Biomarker: A Meta-Analysis. Plos One 2014, 9. [19] Saydam, N., Adams, T. K., Steiner, F., Schaffner, W., Freedman, J. H., Regulation of metallothionein transcription by the metal-responsive transcription factor MTF-1: identification of signal transduction cascades that control metal-inducible transcription. J Biol Chem 2002, 277, [20] Gunther, V., Lindert, U., Schaffner, W., The taste of heavy metals: gene regulation by MTF-1. Biochim Biophys Acta 2012, 1823, [21] Brugnera, E., Georgiev, O., Radtke, F., Heuchel, R., et al., Cloning, chromosomal mapping and characterization of the human metal-regulatory transcription factor MTF-1. Nucleic Acids Res 1994, 22, [22] Radtke, F., Heuchel, R., Georgiev, O., Hergersberg, M., et al., Cloned transcription factor MTF-1 activates the mouse metallothionein I promoter. EMBO J 1993, 12, [23] Lindert, U., Leuzinger, L., Steiner, K., Georgiev, O., Schaffner, W., Characterization of metal-responsive transcription factor (MTF-1) from the giant rodent capybara reveals features in common with human as well as with small rodents (mouse, rat). Short communication. Chem Biodivers 2008, 5, [24] Dalton, T. P., Solis, W. A., Nebert, D. W., Carvan, M. J., 3rd, Characterization of the MTF-1 transcription factor from zebrafish and trout cells. Comp Biochem Physiol B Biochem Mol Biol 2000, 126,

142 129 [25] Chen, W. Y., John, J. A., Lin, C. H., Chang, C. Y., Molecular cloning and developmental expression of zinc finger transcription factor MTF-1 gene in zebrafish, Danio rerio. Biochem Biophys Res Commun 2002, 291, [26] Zhang, B., Egli, D., Georgiev, O., Schaffner, W., The Drosophila homolog of mammalian zinc finger factor MTF-1 activates transcription in response to heavy metals. Mol Cell Biol 2001, 21, [27] Stitt, M. S., Wasserloos, K. J., Tang, X., Liu, X., et al., Nitric oxide-induced nuclear translocation of the metal responsive transcription factor, MTF-1 is mediated by zinc release from metallothionein. Vascul Pharmacol 2006, 44, [28] Zhang, B., Georgiev, O., Hagmann, M., Gunes, C., et al., Activity of metalresponsive transcription factor 1 by toxic heavy metals and H2O2 in vitro is modulated by metallothionein. Mol Cell Biol 2003, 23, [29] Negre-Salvayre, A., Auge, N., Duval, C., Robbesyn, F., et al., Detection of intracellular reactive oxygen species in cultured cells using fluorescent probes. Meth Enzymol 2002, 352, [30] Ohtsuji, M., Katsuoka, F., Kobayashi, A., Aburatani, H., et al., Nrf1 and Nrf2 play distinct roles in activation of antioxidant response element-dependent genes. J Biol Chem 2008, 283, [31] Vallee, B., The function of metallothionein. Neurochem Int 1995, 27, [32] Hussain, S., Slikker, W., Ali, S. F., Role of metallothionein and other antioxidants in scavenging superoxide radicals and their possible role in neuroprotection. Neurochem Int 1996, 29,

143 [33] Guo, S., Yang, S., Taylor, C., Sonenshein, G. E., Green tea polyphenol 130 epigallocatechin-3 gallate (EGCG) affects gene expression of breast cancer cells transformed by the carcinogen 7,12-dimethylbenz[a]anthracene. J Nutr 2005, 135, 2978S- 2986S.

144 131 Chapter 5 Conclusions and Recommendations for Future Work 5.1 Conclusions In the thesis study, as shown in Figure 5-1, I first identified that EGCG selectively inhibited the cancer cell growth. The inhibitory effect was associated with an initial increase of mitochondrial oxidative stress, which resulted in mitochondrial dysfunction such as the opening of mptp, immediate loss of Δψ. The mitochondrial dysfunction was further found to be related to the systemic ROS burst and ultimate apoptosis in cancer cells. In normal cells, however, EGCG did not induce significant increase of mitochondrial oxidative stress nor did it induce cellular apoptosis. Then, I found out that SIRT3, a mitochondrial redox regulator, may play an important role in EGCG s differential pro-oxidant effects in cancer versus normal cells. EGCG suppressed the gene and protein expression as well as the activity of SIRT3 in cancer cells. By comparison, EGCG increased SIRT3 activity, although it did not significantly alter the gene and protein levels of SIRT3. Moreover, EGCG was found to modulate SIRT3 transcription through ERRα, a transcription factor of SIRT3. Last but not least, MT, a cytosolic antioxidant protein family, was identified to involve in EGCG s selective pro-oxidant effects in addition to SIRT3. EGCG downregulated the mrna expression of several MTs (particularly MT1G and MT1X) in cancer whereas it up-regulated several MTs in normal cells. sirna-mediated knockdown of SIRT3 unexpectedly resulted in the cancer cell resistance to EGCG-induced growth

145 inhibition. This is in part due to increased MTs expressions as cellular self-protection 132 from oxidative stress. Interestingly, knocking down MTF1, a transcriptional factor of MTs, blunted the expression of SIRT3. These data suggest a crosstalk between MT and SIRT3 signaling which may be mediated by MTF1. Figure 5-1.EGCG-mediated differential pro-oxidant effects through mediating MT and SIRT3 signaling. In cancer cells, EGCG induced early production of mtros and mitochondrial dysfunction, followed by the systemic ROS burst and ultimate cell death. Further, in cancer cells, on one hand, EGCG suppressed SIRT3 signaling, leading to cellular oxidative stress. On the other hand, EGCG reduced the transcriptional activity of MTF1 and MTF1-mediated MTs mrna expressions, resulting additional oxidative stress. By contrast, in normal cells, EGCG did not induce significant production of mtros, not it induce oxidative stress and cell apoptosis. Instead, EGCG activated SIRT3 and increased the transcriptional activity of MTF1 and MTF1-mediated MTs gene expressions, leading to active antioxidant responses.

Glutathione and Oxidative Stress - Part I

Glutathione and Oxidative Stress - Part I Glutathione and Oxidative Stress - Part I By: James L. Holly, MD Oxidative Stress refers to effects from endogenous (produced in the body) toxins (free radicals) produced in the body by normal metabolism

More information

Mutations: 2 general ways to alter DNA. Mutations. What is a mutation? Mutations are rare. Changes in a single DNA base. Change a single DNA base

Mutations: 2 general ways to alter DNA. Mutations. What is a mutation? Mutations are rare. Changes in a single DNA base. Change a single DNA base Mutations Mutations: 2 general ways to alter DNA Change a single DNA base Or entire sections of DNA can move from one place to another What is a mutation? Any change in the nucleotide sequence of DNA Here

More information

Genetics BRCA1 and BRCA2 are gene mutations which give 5 percent genetic risk of breast and ovary cancers. Worse if they drink alcohol.

Genetics BRCA1 and BRCA2 are gene mutations which give 5 percent genetic risk of breast and ovary cancers. Worse if they drink alcohol. Cancer seminar Ginseng & Dang Gui 10 Chinese formula to help cancer patients with energy. Cell Protect Green tea and turmeric increases efficacy as it helps cancer drugs to stay in cell i.e. reduce drug

More information

Mechanism of short-term ERK activation by electromagnetic fields at mobile phone frequencies. Biochemistry Journal. August 1, 2007 405, pp.

Mechanism of short-term ERK activation by electromagnetic fields at mobile phone frequencies. Biochemistry Journal. August 1, 2007 405, pp. Mechanism of short-term ERK activation by electromagnetic fields at mobile phone frequencies 1 Biochemistry Journal August 1, 2007 405, pp. 559 568 Joseph Friedman, Sarah Kraus, Yirmi Hauptman, Yoni Schiff

More information

WHEY PROTEIN IMPORTANCE. Dan Phillips

WHEY PROTEIN IMPORTANCE. Dan Phillips WHEY PROTEIN IMPORTANCE Dan Phillips Studies on whey demonstrate it's an even better protein supplement than previously thought. Although whey protein's health benefits have only recently been elucidated,

More information

MICRONUTRIENTS IN CANCER

MICRONUTRIENTS IN CANCER MICRONUTRIENTS IN CANCER Dr. Bilwa Bhanap, MD Scope of the problem 2000 1500 Heart Disease 12 million people worldwide are diagnosed with cancer every year. This is expected to rise to 27 million by 2030.

More information

POTENTIAL HEALTH BENEFITS OF WATERCRESS

POTENTIAL HEALTH BENEFITS OF WATERCRESS POTENTIAL HEALTH BENEFITS OF WATERCRESS Hippocrates was one of the first to recognize the potential health benefits of watercress. Today, good intakes of nutrient and phytochemicals-dense green leafy and/or

More information

NATIONAL INSTITUTE OF ENVIRONMENTAL HEALTH SCIENCES Division of Extramural Research and Training

NATIONAL INSTITUTE OF ENVIRONMENTAL HEALTH SCIENCES Division of Extramural Research and Training NATIONAL INSTITUTE OF ENVIRONMENTAL HEALTH SCIENCES Division of Extramural Research and Training NATIONAL ADVISORY ENVIRONMENTAL HEALTH SCIENCES COUNCIL May 12-13, 2010 Concept Clearance Small Business

More information

Free radicals - Enemies of health, beauty and youth

Free radicals - Enemies of health, beauty and youth Free radicals - Enemies of health, beauty and youth Free radicals (FR) are natural molecules produced in the body following biochemical reactions related to the behaviour of singlet oxygen. The human body

More information

The Impact of Polyphenolic Compounds on Apoptosis in Epithelial Cells

The Impact of Polyphenolic Compounds on Apoptosis in Epithelial Cells The Impact of Polyphenolic Compounds on Apoptosis in Epithelial Cells Mayson Husband, 12 th grade, Latta High School Abstract The purpose of this investigation was to determine whether polyphenolic compounds

More information

Antioxidant Products. A comprehensive range of. Antioxidants

Antioxidant Products. A comprehensive range of. Antioxidants Antioxidant Products A comprehensive range of ALB BIL FERR GR Ransel Ransod antioxidant TAS testing TIBC kits TF BIL FERR GR Ransel Ransod TAS TIBC TF UA A FERR GR Ransel Ransod TAS TIBC TF UA ALB GR Ransel

More information

Defending the Rest Basics on Lung Cancer, Other Cancers and Asbestosis: Review of the B-Read and Pulmonary Function Testing

Defending the Rest Basics on Lung Cancer, Other Cancers and Asbestosis: Review of the B-Read and Pulmonary Function Testing Defending the Rest Basics on Lung Cancer, Other Cancers and Asbestosis: Review of the B-Read and Pulmonary Function Testing OTHER CANCERS November 2013 Bruce T. Bishop Nancy E. Leary Willcox & Savage 440

More information

The Physiology of Hyperbaric Oxygen Therapy. Free Radicals and Reactive Oxygen Species. I. Introduction Definition, Source, function and Purpose

The Physiology of Hyperbaric Oxygen Therapy. Free Radicals and Reactive Oxygen Species. I. Introduction Definition, Source, function and Purpose The Physiology of Hyperbaric Oxygen Therapy Free Radicals and Reactive Oxygen Species I. Introduction Definition, Source, function and Purpose A. Definition of free radicals and reactive oxygen species

More information

Summary and conclusion 2013

Summary and conclusion 2013 The work presented in the thesis is focused on the problems related to the prostate gland. Benign prostatic hyperplasia (BPH) and prostate cancer (PCa) are the two major problems associated with prostate.

More information

Smaller Waistlines, Sharper Minds, Stronger Bones and Healthier Hearts?

Smaller Waistlines, Sharper Minds, Stronger Bones and Healthier Hearts? Telephone: (212) 986-9415 Fax: (212) 697-8658 www.teausa.org 362 5th AVENUE, SUITE 801, NEW YORK, NY 10001 Smaller Waistlines, Sharper Minds, Stronger Bones and Healthier Hearts? New Findings Released

More information

Chapter 8. Summary and Perspectives

Chapter 8. Summary and Perspectives Chapter 8 Summary and Perspectives 131 Chapter 8 Summary Overexpression of the multidrug resistance protein MRP1 confer multidrug resistance (MDR) to cancer cells. The contents of this thesis describe

More information

Comparative Studies of the Chemical Constituents of Green Tea

Comparative Studies of the Chemical Constituents of Green Tea Comparative Studies of the Chemical Constituents of Green Tea A Thesis Submitted in Partial Fulfillment of the Requirements for the Master Degree of Science in Chemistry (Analytical Chemistry) By Tharwat

More information

25-hydroxyvitamin D: from bone and mineral to general health marker

25-hydroxyvitamin D: from bone and mineral to general health marker DIABETES 25 OH Vitamin D TOTAL Assay 25-hydroxyvitamin D: from bone and mineral to general health marker FOR OUTSIDE THE US AND CANADA ONLY Vitamin D Receptors Brain Heart Breast Colon Pancreas Prostate

More information

Is Exercise the Best Antioxidant Supplement? Len Kravitz, Ph.D.

Is Exercise the Best Antioxidant Supplement? Len Kravitz, Ph.D. Is Exercise the Best Antioxidant Supplement? Len Kravitz, Ph.D. As an unexpected consequence of the metabolic steps that convert food into energy, the body produces molecules commonly called free radicals.

More information

SINPE trial, Ann Surg 2009. Overall morbidity. Minor Major. Infectious Non infectious. Post-hoc analysis WL < %5 (n=379) WL between 5-10% (n=49)

SINPE trial, Ann Surg 2009. Overall morbidity. Minor Major. Infectious Non infectious. Post-hoc analysis WL < %5 (n=379) WL between 5-10% (n=49) Chinese International Symposium on Nutritional Oncology Changchun, June 20-21 2014 IMMUNONUTRITION IN CANCER PATIENTS IMMUNONUTRITION IN SURGERY OBJECTIVE To get the patient undergoing major surgery for

More information

VITAMIN C AND INFECTIOUS DISEASE: A REVIEW OF THE LITERATURE AND THE RESULTS OF A RANDOMIZED, DOUBLE-BLIND, PROSPECTIVE STUDY OVER 8 YEARS

VITAMIN C AND INFECTIOUS DISEASE: A REVIEW OF THE LITERATURE AND THE RESULTS OF A RANDOMIZED, DOUBLE-BLIND, PROSPECTIVE STUDY OVER 8 YEARS 39 Chapter 3 VITAMIN C AND INFECTIOUS DISEASE: A REVIEW OF THE LITERATURE AND THE RESULTS OF A RANDOMIZED, DOUBLE-BLIND, PROSPECTIVE STUDY OVER 8 YEARS Maxine Briggs TABLE OF CONTENTS I. Review of the

More information

Introduction. Pathogenesis of type 2 diabetes

Introduction. Pathogenesis of type 2 diabetes Introduction Type 2 diabetes mellitus (t2dm) is the most prevalent form of diabetes worldwide. It is characterised by high fasting and high postprandial blood glucose concentrations (hyperglycemia). Chronic

More information

21.8 The Citric Acid Cycle

21.8 The Citric Acid Cycle 21.8 The Citric Acid Cycle The carbon atoms from the first two stages of catabolism are carried into the third stage as acetyl groups bonded to coenzyme A. Like the phosphoryl groups in ATP molecules,

More information

Freiburg Study. The other 24 subjects had healthy markers closer to what would be considered ideal.

Freiburg Study. The other 24 subjects had healthy markers closer to what would be considered ideal. Freiburg Study The Freiburg Study was conducted with 48 healthy human subjects of various ages. None of the test subjects had been diagnosed with any disease prior to the study. None were taking any type

More information

Endocrine System: Practice Questions #1

Endocrine System: Practice Questions #1 Endocrine System: Practice Questions #1 1. Removing part of gland D would most likely result in A. a decrease in the secretions of other glands B. a decrease in the blood calcium level C. an increase in

More information

BIOMARKERS AND TOXICITY MECHANISMS 06 Mechanisms Metabolism & Detoxification. Luděk Bláha, PřF MU, RECETOX www.recetox.cz

BIOMARKERS AND TOXICITY MECHANISMS 06 Mechanisms Metabolism & Detoxification. Luděk Bláha, PřF MU, RECETOX www.recetox.cz BIOMARKERS AND TOXICITY MECHANISMS 06 Mechanisms Metabolism & Detoxification Luděk Bláha, PřF MU, RECETOX www.recetox.cz Metabolism and detoxification Chemicals enter body... mostly via food Pass directly

More information

Q&A on Monographs Volume 116: Coffee, maté, and very hot beverages

Q&A on Monographs Volume 116: Coffee, maté, and very hot beverages Questions about the Monographs 1. What does the IARC Monographs Programme do? The Monographs Programme identifies and evaluates causes of cancer in humans based on the publically available scientific evidence.

More information

Cell Injury, Adaptation and Death

Cell Injury, Adaptation and Death Harvard-MIT Division of Health Sciences and Technology HST.035: Principle and Practice of Human Pathology Dr. Badizadegan Cell Injury, Adaptation and Death HST.035 Spring 2003 Overview of Cell Injury Cells

More information

Chem 306 Chapter 21 Bioenergetics Lecture Outline III

Chem 306 Chapter 21 Bioenergetics Lecture Outline III Chem 306 Chapter 21 Bioenergetics Lecture Outline III I. HOW IS ATP GENERATED IN THE FINAL STAGE CATABOLISM? A. OVERVIEW 1. At the end of the citric acid cycle, all six carbons of glucose have been oxidized

More information

D. Vitamin D. 1. Two main forms; vitamin D2 and D3

D. Vitamin D. 1. Two main forms; vitamin D2 and D3 D. Vitamin D. Two main forms; vitamin D2 and D3 H H D3 - Cholecalciferol D2 - Ergocalciferol Technically, vitamin D is not a vitamin. It is the name given to a group of fat-soluble prohormones (substances

More information

Nutrition and Parkinson s Disease: Can food have an impact? Sarah Zangerle, RD, CD Registered Dietitian Froedtert Memorial Lutheran Hospital

Nutrition and Parkinson s Disease: Can food have an impact? Sarah Zangerle, RD, CD Registered Dietitian Froedtert Memorial Lutheran Hospital Nutrition and Parkinson s Disease: Can food have an impact? Sarah Zangerle, RD, CD Registered Dietitian Froedtert Memorial Lutheran Hospital Importance of Nutrition & Parkinson s Disease Good nutrition

More information

CONTRACTING ORGANIZATION: University of Alabama at Birmingham Birmingham, AL 35294

CONTRACTING ORGANIZATION: University of Alabama at Birmingham Birmingham, AL 35294 AD Award Number: W81XWH-08-1-0030 TITLE: Regulation of Prostate Cancer Bone Metastasis by DKK1 PRINCIPAL INVESTIGATOR: Gregory A. Clines, M.D., Ph.D. CONTRACTING ORGANIZATION: University of Alabama at

More information

Methyl groups, like vitamins, are

Methyl groups, like vitamins, are Methyl groups are essential for the body to function properly and must be obtained from the diet The need for methyl groups increases under stress Chapter 11 Betaine a new B vitamin Methyl groups reduce

More information

Bottlenecks in Clinical Source Material Acquisition. Aby J. Mathew, PhD May 5, 2009 ISCT Annual Meeting San Diego, CA amathew@biolifesolutions.

Bottlenecks in Clinical Source Material Acquisition. Aby J. Mathew, PhD May 5, 2009 ISCT Annual Meeting San Diego, CA amathew@biolifesolutions. Bottlenecks in Clinical Source Material Acquisition Aby J. Mathew, PhD May 5, 2009 ISCT Annual Meeting San Diego, CA amathew@biolifesolutions.com Biopreservation What s the issue? Biopreservation considerations

More information

Basic Overview of Preclinical Toxicology Animal Models

Basic Overview of Preclinical Toxicology Animal Models Basic Overview of Preclinical Toxicology Animal Models Charles D. Hebert, Ph.D., D.A.B.T. December 5, 2013 Outline Background In Vitro Toxicology In Vivo Toxicology Animal Models What is Toxicology? Background

More information

Antioxidant response in patients with chronic hepatitis B or C.

Antioxidant response in patients with chronic hepatitis B or C. Antioxidant response in patients with chronic hepatitis B or C. Kamila Wójcik, Anna Piekarska, Elżbieta Jabłonowska Department of Infectious Diseases and Hepatology, Medical University of Lodz, Poland

More information

Overview. Nutritional Aspects of Primary Biliary Cirrhosis. How does the liver affect nutritional status?

Overview. Nutritional Aspects of Primary Biliary Cirrhosis. How does the liver affect nutritional status? Overview Nutritional Aspects of Primary Biliary Cirrhosis Tracy Burch, RD, CNSD Kovler Organ Transplant Center Northwestern Memorial Hospital Importance of nutrition therapy in PBC Incidence and pertinence

More information

Skin Cancer: The Facts. Slide content provided by Loraine Marrett, Senior Epidemiologist, Division of Preventive Oncology, Cancer Care Ontario.

Skin Cancer: The Facts. Slide content provided by Loraine Marrett, Senior Epidemiologist, Division of Preventive Oncology, Cancer Care Ontario. Skin Cancer: The Facts Slide content provided by Loraine Marrett, Senior Epidemiologist, Division of Preventive Oncology, Cancer Care Ontario. Types of skin Cancer Basal cell carcinoma (BCC) most common

More information

PROTANDIM SEVEN PEER-REVIEWED SCIENTIFIC JOURNAL ABSTRACTS SINCE 2006. A Fundamentally New Approach to Antioxidant Therapy

PROTANDIM SEVEN PEER-REVIEWED SCIENTIFIC JOURNAL ABSTRACTS SINCE 2006. A Fundamentally New Approach to Antioxidant Therapy PROTANDIM SEVEN PEER-REVIEWED SCIENTIFIC JOURNAL ABSTRACTS SINCE 2006 A Fundamentally New Approach to Antioxidant Therapy Free Radical Biology & Medicine 40 (2006) 341 347 Original Contribution The induction

More information

William Shaw, Ph.D. The Great Plains Laboratory, Inc., Lenexa, Kansas, USA

William Shaw, Ph.D. The Great Plains Laboratory, Inc., Lenexa, Kansas, USA Inhibition of dopamine conversion to norepinephrine by Clostridia metabolites appears to be a (the) major cause of autism, schizophrenia, and other neuropsychiatric disorders. All these factors can now

More information

Artemisinin in Cancer Treatment. Dr. Narendra P. Singh Department of Bioengineering University of Washington Seattle

Artemisinin in Cancer Treatment. Dr. Narendra P. Singh Department of Bioengineering University of Washington Seattle Artemisinin in Cancer Treatment Dr. Narendra P. Singh Department of Bioengineering University of Washington Seattle What is Artemisinin? Artemisinin is a sesquiterpene lactone isolated from the plant Artemesia

More information

Targeting Specific Cell Signaling Pathways for the Treatment of Malignant Peritoneal Mesothelioma

Targeting Specific Cell Signaling Pathways for the Treatment of Malignant Peritoneal Mesothelioma The Use of Kinase Inhibitors: Translational Lab Results Targeting Specific Cell Signaling Pathways for the Treatment of Malignant Peritoneal Mesothelioma Sheelu Varghese, Ph.D. H. Richard Alexander, M.D.

More information

Nutrient Reference Values for Australia and New Zealand

Nutrient Reference Values for Australia and New Zealand Nutrient Reference Values for Australia and New Zealand Questions and Answers 1. What are Nutrient Reference Values? The Nutrient Reference Values outline the levels of intake of essential nutrients considered,

More information

Learning about Mouth Cancer

Learning about Mouth Cancer Learning about Mouth Cancer Creation of this material was made possible in part by a pioneering grant from CBCC-USA. Distributed by India Cancer Initiative What is mouth cancer? Our bodies are made up

More information

Reactive oxygen species in leaves and how to catch these

Reactive oxygen species in leaves and how to catch these Reactive oxygen species in leaves and how to catch these Éva Hideg Molecular Stress- & Photobiology Group, BRC Szeged EPPN Summer School 2013 Outline How to prove that ROS are involved? The central role

More information

Healthy life resources for the cancer community. Tonight: Healthy Eating with Diane B. Wilson, EdD, RD. January 18, 2012

Healthy life resources for the cancer community. Tonight: Healthy Eating with Diane B. Wilson, EdD, RD. January 18, 2012 Living Well after Cancer Healthy life resources for the cancer community Tonight: Healthy Eating with Diane B. Wilson, EdD, RD Yoga with Mary Shall, PhD, PT January 18, 2012 Optimizing i i the health

More information

The Victory Over Cancer Is At Hand

The Victory Over Cancer Is At Hand DR. MATTHIAS RATH S CELLULAR HEALTH SERIES: CANCER Matthias Rath, M.D. and His Breakthrough Cancer Research Dr. Matthias Rath is the world-renowned physician and research scientist who made the groundbreaking

More information

1. The diagram below represents a biological process

1. The diagram below represents a biological process 1. The diagram below represents a biological process 5. The chart below indicates the elements contained in four different molecules and the number of atoms of each element in those molecules. Which set

More information

Keystone Review Practice Test Module A Cells and Cell Processes. 1. Which characteristic is shared by all prokaryotes and eukaryotes?

Keystone Review Practice Test Module A Cells and Cell Processes. 1. Which characteristic is shared by all prokaryotes and eukaryotes? Keystone Review Practice Test Module A Cells and Cell Processes 1. Which characteristic is shared by all prokaryotes and eukaryotes? a. Ability to store hereditary information b. Use of organelles to control

More information

16 Very Important THINGS YOU NEED TO KNOW About Cancer Cells

16 Very Important THINGS YOU NEED TO KNOW About Cancer Cells 16 Very Important THINGS YOU NEED TO KNOW About Cancer Cells By Ingo Logé and Fitness Forever 1. Every person has cancer cells in the body. These cancer cells do not show up in the standard tests until

More information

Delentigo The age spot solution

Delentigo The age spot solution The age spot solution The age spot solution Erasing Age Spots and Equalizing the Skin Tone Delentigo targets and lightens age spots by combining two active substances incorporated into separate liposomes:

More information

Focus on Preventing Disease. keeping an eye on a healthy bottom line. Cattle Industry

Focus on Preventing Disease. keeping an eye on a healthy bottom line. Cattle Industry Focus on Preventing Disease keeping an eye on a healthy bottom line Cattle Industry Multimin + VACCINES : University OF FLORIDA study data Study 1 Effect of injectable trace minerals on the humoral immune

More information

serum protein and A/ G ratio

serum protein and A/ G ratio serum protein and A/ G ratio Blood plasma contains at least 125 individual proteins. Serum ( as contrasted with plasma) is deficient in those coagulation protein which are consumed during the process of

More information

The Need for a PARP in vivo Pharmacodynamic Assay

The Need for a PARP in vivo Pharmacodynamic Assay The Need for a PARP in vivo Pharmacodynamic Assay Jay George, Ph.D., Chief Scientific Officer, Trevigen, Inc., Gaithersburg, MD For further infomation, please contact: William Booth, Ph.D. Tel: +44 (0)1235

More information

An Overview of Cells and Cell Research

An Overview of Cells and Cell Research An Overview of Cells and Cell Research 1 An Overview of Cells and Cell Research Chapter Outline Model Species and Cell types Cell components Tools of Cell Biology Model Species E. Coli: simplest organism

More information

THE IMMUNE SYSTEM AND BREAST CANCER

THE IMMUNE SYSTEM AND BREAST CANCER THE IMMUNE SYSTEM AND BREAST CANCER Moderator: Hope Nemiroff Panelists: David M. Brady, ND, DC, CCN, DACBN Elizabeth Boham, MD, MS, RD Examining the role of the immune system in breast cancer survival

More information

micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved

micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved microrna 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions of target mrnas Act as negative

More information

How To Treat A Cancer With Natural Remedies

How To Treat A Cancer With Natural Remedies Mesothelioma is a devastating form of cancer that is relatively rare when compared to the incidence rates of other cancers. The word mesothelioma is derived from the English word mesothelium, which is

More information

Sweet-taste receptors, glucose absorption and insulin release: Are LCS nutritionally active?

Sweet-taste receptors, glucose absorption and insulin release: Are LCS nutritionally active? Sweet-taste receptors, glucose absorption and insulin release: Are LCS nutritionally active? Samuel V. Molinary, Ph.D. Consultant, Scientific & Regulatory Affairs ILSI/NA April 6, 2011 Washington, DC Why

More information

I. ACID-BASE NEUTRALIZATION, TITRATION

I. ACID-BASE NEUTRALIZATION, TITRATION LABORATORY 3 I. ACID-BASE NEUTRALIZATION, TITRATION Acid-base neutralization is a process in which acid reacts with base to produce water and salt. The driving force of this reaction is formation of a

More information

Enzymes. A. a lipid B. a protein C. a carbohydrate D. a mineral

Enzymes. A. a lipid B. a protein C. a carbohydrate D. a mineral Enzymes 1. All cells in multicellular organisms contain thousands of different kinds of enzymes that are specialized to catalyze different chemical reactions. Given this information, which of the following

More information

Name Date Period. Keystone Review Enzymes

Name Date Period. Keystone Review Enzymes Name Date Period Keystone Review Enzymes 1. In order for cells to function properly, the enzymes that they contain must also function properly. What can be inferred using the above information? A. Cells

More information

Vitamin D Deficiency and Thyroid Disease. Theodore C. Friedman, M.D., Ph.D.

Vitamin D Deficiency and Thyroid Disease. Theodore C. Friedman, M.D., Ph.D. Vitamin D Deficiency and Thyroid Disease Theodore C. Friedman, M.D., Ph.D. Vitamin D deficiency and thyroid diseases Vitamin D is an important vitamin that not only regulates calcium, but also has many

More information

Lecture 4 Sunday 30/9/2012

Lecture 4 Sunday 30/9/2012 Inactivation and Detoxification of Xenobiotics and Metabolites in the Liver The liver is one of the most important organs in the body when it comes to detoxifying or getting rid of foreign substances or

More information

Green Tea - Healthy Choice for Preventive Health by James L. Holly, MD Your Life Your Health October 31, 2002

Green Tea - Healthy Choice for Preventive Health by James L. Holly, MD Your Life Your Health October 31, 2002 Green Tea - Healthy Choice for Preventive Health by James L. Holly, MD Your Life Your Health October 31, 2002 One of the most exciting health developments of the 1990s was the discovery of the extraordinary

More information

There is a word for you: chocoholic,

There is a word for you: chocoholic, There is a word for you: chocoholic, when you need chocolate. Nothing else will do. Just thinking about hot fudge drizzling over ice cream raises your spirits. You crave a truffle, a Kit-Kat, a mug of

More information

Diabetes and Insulin Signaling

Diabetes and Insulin Signaling Diabetes and Insulin Signaling NATIONAL CENTER FOR CASE STUDY TEACHING IN SCIENCE by Kristy J. Wilson School of Mathematics and Sciences Marian University, Indianapolis, IN Part I Research Orientation

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE S1A. Current Step 4 version

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE S1A. Current Step 4 version INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE GUIDELINE ON THE NEED FOR CARCINOGENICITY STUDIES

More information

AP BIOLOGY CHAPTER 7 Cellular Respiration Outline

AP BIOLOGY CHAPTER 7 Cellular Respiration Outline AP BIOLOGY CHAPTER 7 Cellular Respiration Outline I. How cells get energy. A. Cellular Respiration 1. Cellular respiration includes the various metabolic pathways that break down carbohydrates and other

More information

Summary of Metabolism. Mechanism of Enzyme Action

Summary of Metabolism. Mechanism of Enzyme Action Summary of Metabolism Mechanism of Enzyme Action 1. The substrate contacts the active site 2. The enzyme-substrate complex is formed. 3. The substrate molecule is altered (atoms are rearranged, or the

More information

This student paper was written as an assignment in the graduate course

This student paper was written as an assignment in the graduate course 77:222 Spring 2003 Free Radicals in Biology and Medicine Page 0 This student paper was written as an assignment in the graduate course Free Radicals in Biology and Medicine (77:222, Spring 2003) offered

More information

No Disclosures. Learning Objectives 10/25/13

No Disclosures. Learning Objectives 10/25/13 No Disclosures Gregory A. Brent, MD Departments of Medicine and Physiology David Geffen School of Medicine at UCLA VA Greater Los Angeles Healthcare System Learning Objectives Describe the pathways that

More information

Oxidative stress markers

Oxidative stress markers Oxidative stress markers Oxidative stress represents an imbalance between reactive oxygen species (ROS) and cellular mechanisms for detoxifying the reactive intermediates or for repairing the resulting

More information

Version 1 2015. Module guide. Preliminary document. International Master Program Cardiovascular Science University of Göttingen

Version 1 2015. Module guide. Preliminary document. International Master Program Cardiovascular Science University of Göttingen Version 1 2015 Module guide International Master Program Cardiovascular Science University of Göttingen Part 1 Theoretical modules Synopsis The Master program Cardiovascular Science contains four theoretical

More information

Potulaca (Portulaca oleracea) detergent and other formulations that disrupt the active anthraquinones by regulating the Nitric

Potulaca (Portulaca oleracea) detergent and other formulations that disrupt the active anthraquinones by regulating the Nitric Natural effective support for acne, oily and inflamed skin care At the heart of Frutarom's TopicRange for oily and acne skin problems, we focus Z-Care - a botanical blend based on traditions of Chinese

More information

AUSTRALIAN VIETNAM VETERANS Mortality and Cancer Incidence Studies. Overarching Executive Summary

AUSTRALIAN VIETNAM VETERANS Mortality and Cancer Incidence Studies. Overarching Executive Summary AUSTRALIAN VIETNAM VETERANS Mortality and Cancer Incidence Studies Overarching Executive Summary Study Study A u s t ra l i a n N a t i o n a l S e r v i c e V i e t n a m Ve t e ra n s : M o r t a l i

More information

Human Clinical Study for Free Testosterone & Muscle Mass Boosting

Human Clinical Study for Free Testosterone & Muscle Mass Boosting Human Clinical Study for Free Testosterone & Muscle Mass Boosting GE Nutrients, Inc. 920 E. Orangethorpe Avenue, Suite B Anaheim, California 92801, USA Phone: +1-714-870-8723 Fax: +1-732-875-0306 Contact

More information

One out of every two men and one out of every three women will have some type of cancer at some point during their lifetime. 3

One out of every two men and one out of every three women will have some type of cancer at some point during their lifetime. 3 1. What is cancer? 2. What causes cancer?. What causes cancer? 3. Can cancer be prevented? The Facts One out of every two men and one out of every three women will have some type of cancer at some point

More information

Energy Production In A Cell (Chapter 25 Metabolism)

Energy Production In A Cell (Chapter 25 Metabolism) Energy Production In A Cell (Chapter 25 Metabolism) Large food molecules contain a lot of potential energy in the form of chemical bonds but it requires a lot of work to liberate the energy. Cells need

More information

Course Curriculum for Master Degree in Food Science and Technology/ Department of Nutrition and Food Technology

Course Curriculum for Master Degree in Food Science and Technology/ Department of Nutrition and Food Technology Course Curriculum for Master Degree in Food Science and Technology/ Department of Nutrition and Food Technology The Master Degree in Food Science and Technology / Department of Nutrition and Food Technology,

More information

Basics of Immunology

Basics of Immunology Basics of Immunology 2 Basics of Immunology What is the immune system? Biological mechanism for identifying and destroying pathogens within a larger organism. Pathogens: agents that cause disease Bacteria,

More information

ICH Topic S 1 A The Need for Carcinogenicity Studies of Pharmaceuticals. Step 5

ICH Topic S 1 A The Need for Carcinogenicity Studies of Pharmaceuticals. Step 5 European Medicines Agency July 1996 CPMP/ICH/140/95 ICH Topic S 1 A The Need for Carcinogenicity Studies of Pharmaceuticals Step 5 NOTE FOR GUIDANCE ON THE NEED FOR CARCINOGENICITY STUDIES OF PHARMACEUTICALS

More information

Oral Zinc Supplementation as an Adjunct Therapy in the Management of Hepatic Encephalopathy: A Randomized Controlled Trial

Oral Zinc Supplementation as an Adjunct Therapy in the Management of Hepatic Encephalopathy: A Randomized Controlled Trial Oral Zinc Supplementation as an Adjunct Therapy in the Management of Hepatic Encephalopathy: A Randomized Controlled Trial Marcus R. Pereira A. Study Purpose Hepatic encephalopathy is a common complication

More information

MEDCHEM 562 Fall 2013 Vitamin Problem Set 1: Deficiency

MEDCHEM 562 Fall 2013 Vitamin Problem Set 1: Deficiency 1) Complete the table: MEDCHEM 562 Fall 2013 Vitamin Problem Set 1: Vitamin Function / Uses Deficiency States Toxicities Daily Value Upper Limit A D E K 2) Complete the metabolic pathway shown below: Retinyl

More information

Η δίαιτα στην πρόληψη του αγγειακού εγκεφαλικού επεισοδίου

Η δίαιτα στην πρόληψη του αγγειακού εγκεφαλικού επεισοδίου ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ «Η ΔΙΑΤΡΟΦΗ ΣΤΗΝ ΥΓΕΙΑ ΚΑΙ ΣΤΗ ΝΟΣΟ» Η δίαιτα στην πρόληψη του αγγειακού εγκεφαλικού επεισοδίου Γεώργιος Ντάιος Παθολογική Κλινική Πανεπιστημίου Θεσσαλίας Stroke Statistics

More information

What is Cancer? Cancer is a genetic disease: Cancer typically involves a change in gene expression/function:

What is Cancer? Cancer is a genetic disease: Cancer typically involves a change in gene expression/function: Cancer is a genetic disease: Inherited cancer Sporadic cancer What is Cancer? Cancer typically involves a change in gene expression/function: Qualitative change Quantitative change Any cancer causing genetic

More information

Cancer chemopreventive activity and bioavailability of tea and tea polyphenols

Cancer chemopreventive activity and bioavailability of tea and tea polyphenols Mutation Research 523 524 (2003) 201 208 Review Cancer chemopreventive activity and bioavailability of tea and tea polyphenols Joshua D. Lambert, Chung S. Yang Department of Chemical Biology, Laboratory

More information

WHY IS THIS IMPORTANT?

WHY IS THIS IMPORTANT? CHAPTER 10 BACTERIAL GROWTH Eye of Science / Science Photo Library WHY IS THIS IMPORTANT? Increase in numbers is one of the requirements for infection. This increase is dependent upon bacterial growth.

More information

What affects an enzyme s activity? General environmental factors, such as temperature and ph. Chemicals that specifically influence the enzyme.

What affects an enzyme s activity? General environmental factors, such as temperature and ph. Chemicals that specifically influence the enzyme. CH s 8-9 Respiration & Metabolism Metabolism A catalyst is a chemical agent that speeds up a reaction without being consumed by the reaction. An enzyme is a catalytic protein. Hydrolysis of sucrose by

More information

Chemistry 20 Chapters 15 Enzymes

Chemistry 20 Chapters 15 Enzymes Chemistry 20 Chapters 15 Enzymes Enzymes: as a catalyst, an enzyme increases the rate of a reaction by changing the way a reaction takes place, but is itself not changed at the end of the reaction. An

More information

4 Week Body Contour / Lipo Light Program

4 Week Body Contour / Lipo Light Program Natural Health Solutions 14698 Galaxie Ave. Apple Valley, MN 55124 (952) 891-22225 4 Week Body Contour / Lipo Light Program Welcome and Congratulations! This is an important decision towards improving

More information

The correct answer is d C. Answer c is incorrect. Reliance on the energy produced by others is a characteristic of heterotrophs.

The correct answer is d C. Answer c is incorrect. Reliance on the energy produced by others is a characteristic of heterotrophs. 1. An autotroph is an organism that a. extracts energy from organic sources b. converts energy from sunlight into chemical energy c. relies on the energy produced by other organisms as an energy source

More information

Does Selenium protect against lung cancer? Do Selenium supplements reduce the incidence of lung cancer in healthy individuals?

Does Selenium protect against lung cancer? Do Selenium supplements reduce the incidence of lung cancer in healthy individuals? Does Selenium protect against lung cancer? Do Selenium supplements reduce the incidence of lung cancer in healthy individuals? Alexander Blakes and Eleanor Brunt October 2014 The question Mr Wilson s father

More information

Department of Food and Nutrition

Department of Food and Nutrition Department of Food and Nutrition Faculties Professors Lee-Kim, Yang Cha, Ph.D. (M.I.T., 1973) Nutritional biochemistry, Antioxidant vitamins, Fatty acid metabolism, Brain development, and Hyperlipidemia

More information

Nutritional Support of the Burn Patient

Nutritional Support of the Burn Patient Nutritional Support of the Burn Patient Objectives To understand the principles of normal nutrient utilization and the abnormalities caused by burn injury To be able to assess nutrient needs To be able

More information

Diet for Kidney Stone Prevention

Diet for Kidney Stone Prevention Diet for Kidney Stone Prevention National Kidney and Urologic Diseases Information Clearinghouse U.S. Department of Health and Human Services NATIONAL INSTITUTES OF HEALTH How does diet affect the risk

More information

Figure 5. Energy of activation with and without an enzyme.

Figure 5. Energy of activation with and without an enzyme. Biology 20 Laboratory ENZYMES & CELLULAR RESPIRATION OBJECTIVE To be able to list the general characteristics of enzymes. To study the effects of enzymes on the rate of chemical reactions. To demonstrate

More information

Tema 6. Curcuminoides. Estructura Similitud con otras biomoléculas naturales Biodisponibilidad Efectos moleculares Metabolismo

Tema 6. Curcuminoides. Estructura Similitud con otras biomoléculas naturales Biodisponibilidad Efectos moleculares Metabolismo Tema 6. Curcuminoides Estructura Similitud con otras biomoléculas naturales Biodisponibilidad Efectos moleculares Metabolismo O O H 3 CO OCH 3 HO curcumina OH Aggarwal BB. Cytokine Research Laboratory,

More information

CANCER EXPLAINED. Union for International Cancer Control Union Internationale Contre le Cancer

CANCER EXPLAINED. Union for International Cancer Control Union Internationale Contre le Cancer MEDIA FACTSHEET CANCER EXPLAINED What is cancer? Cancer is a disease which occurs when changes in a group of normal cells within the body lead to uncontrolled growth causing a lump called a tumour; this

More information

Cancer SBL101. James Gomes School of Biological Sciences Indian Institute of Technology Delhi

Cancer SBL101. James Gomes School of Biological Sciences Indian Institute of Technology Delhi Cancer SBL101 James Gomes School of Biological Sciences Indian Institute of Technology Delhi All Figures in this Lecture are taken from 1. Molecular biology of the cell / Bruce Alberts et al., 5th ed.

More information