10/1/2014 CLINICAL EXPERIENCE OF MICRODELETION AND EXPANDED TRISOMY DETECTION BY NONINVASIVE PRENATAL TESTING (NIPT) Disclosure.

Transcription

1 CLINICAL EXPERIENCE OF MICRODELETION AND EXPANDED TRISOMY DETECTION BY NONINVASIVE PRENATAL TESTING (NIPT) 2014 NSGC Jenna Wardrop, MS, CGC Sequenom Laboratories Disclosure The speaker is a full-time employee of Sequenom Laboratories 2 Introduction Noninvasive prenatal testing (NIPT) for fetal aneuploidies has become a component of the standard of care for high risk pregnancies A whole genome sequencing approach readily allows for identifying subchromosomal deletion/duplication events A novel algorithm to identify fetal microdeletion and microduplication events has been developed by Sequenom Laboratories 3 1

2 Delivering on the promise of massively parallel sequencing (MPS) MPS allows for genome-wide information that can expand as clinical need dictates TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14 chr14 chr X Y 4 Four key elements to evaluate microdeletions noninvasively The detection of subchromosomal microdeletions/duplications is limited by four main factors Size of the variation (biology dependent) Number of sequencing counts (can be influenced) Fetal fraction (sample dependent) Sequencing noise in that area (method and biology dependent) 5 The MaterniT21 PLUS test Enhanced Sequencing Series Validation Method validation Sensitivity 94.4% 95% CI (71-99%) 17 of 18 Specificity 99.4% 95% CI (95-99%) 156 of 157 Blinded plasma samples and genomic DNA with karyotypic anomalies were used for clinical validation The validation was not syndrome-specific due to low prevalence rates, but rather size specific for events ranging from 3Mb-40Mb Validation was genome wide 6 2

3 The MaterniT21 PLUS test Enhanced Sequencing Series performance Analytical performance based on size of abnormality** 85-90% >91% 60-85% 3-6 Mb deletion 7-11Mb deletion >12Mb deletion Trisomy 16/22 Analytical Sensitivity Analytical Specificity n = 48 ** Absence of an Additional Finding does not indicate a negative result ** Analytical performance modeled on genomic DNA with plasma mixtures ** Performance dependent on size of deletion, number of reads, fetal fraction, etc. ** Although deletions as small as 1.5Mb have been detected, sensitivity in this range is variable due to size of the deletion 7 The Enhanced Sequencing Series Name Location Deletion size Frequency of condition (# of births) DiGeorge/22q 22q 1.5-3Mb 1/4,000 Cri-du-chat 5p 5-40Mb 1/50,000 Angelman 15q 5-6Mb 1/20,000 Prader-Willi 15q 5-6Mb 1/20,000 1p36 1p Mb 1/10,000 Trisomy 16 Chromosome 16 NA 1/50,000 Trisomy 22 Chromosome 22 NA 1/40,000 8 Clinical laboratory review process Over- or under-representation of the chromosome region is flagged by bioinformatics pipeline The pipeline flag is pulled up in the classification report, and data around the flag is reviewed: Size Z-score Log Odds Ratio FF determined from the subchromosomal event 9 3

4 ESS laboratory metrics Total samples screened: 120,726 (October 2013 July 2014) Result Number Average fetal fraction (%) Size Range Average z-score 22q Mb Maternal= Fetal= p Mb p Mb q Mb T NA T NA Algorithm flag examples: 22q11 You may want to insert a normal Chromosome 22 cadet view and then compare with the abnormal, i.e. 22qel 11 Algorithm flag examples: 22q11 deletions Heart defect, short long bones, brain anomaly, confirmed by microarray 2.25 Mb Tetralogy Tetralogy of Tetralogy 0.85 Mb of Fallot 5.0 Mb Fallot noted on ultrasound Mb of Fallot, confirmed by FISH 12 4

5 Rates of positive calls compared to expected Total samples screened: 120,726 (October 2013 July 2014) Condition Incidence Expected Actual Trisomy 16 32/100, Trisomy /100, q11 deletion 1/ Cri-du-chat (5p-) 15q11 deletion (PW/AS) 1/15,000-1/50,000 3, /10,000-1/20,000 5, p36 deletion 1/10, Wolstenholme J. Prenat Diagn. 1996;16(6): Wilson DI, et al. Am J Hum Genet. 1994; 55:A Higurashi M, et al. Brain Dev. 1990; 12: Niebuhr E. Hum Genet. 1978; 44: doi: /BF Driscoll DJ, et al. Available from: 6. Clayton-Smith J, et al. J Med Genet. 1992;29: Slavotinek A, et al. Monosomy 1p36. J Med Genet. 1999; 36: Obtaining outcomes A laboratory genetic counselor contacts the provider when the report is released to review the result, gather relevant known clinical information, and discuss the need for follow up confirmatory testing Genetic counselor recontacts the provider in 1-2 weeks to inquire about follow-up testing If no diagnostic testing is performed, the case is flagged for postnatal follow-up at the estimated date of delivery Multiple attempts are made to gather follow-up information All ESS positive cases are tracked in a database and updated as more information becomes available 14 ESS Outcome Data Total samples screened: 120,726 (October 2013 July 2014) Condition Total Confirmed Strongly Suspected No Information False Positive T T q p q p Totals

6 Summary Automated bioinformatics flags are critically reviewed by the laboratory directors Rates of positive calls align with expected numbers Minimal incremental increase in false positive rate with addition of content to test Positive predictive value is overall high 16 Thank You! R&D team Clinical laboratory team Juan-Sebastian Saldivar Nilesh Dharajiya Tom Monroe Theresa Boomer Julie Jesiolowski Providers who contributed feedback Related posters Poster 152: Detection of maternal 22q deletions by noninvasive prenatal testing (NIPT) Poster 146: Clinical experience reporting trisomy 16 and 22 on noninvasive prenatal testing (NIPT): Test performance and implications for genetic counseling. Breakfast Symposia Noninvasive Prenatal Testing for Microdeletions: One Year Later Saturday 7:00 am- 7:45 am These laboratory-developed tests were developed and their performance characteristics determined by Sequenom Laboratories. They have not been cleared or approved by the U.S. Food and Drug Administration (FDA). Although laboratory-developed tests to date have not been subject to U.S. FDA regulation, certification of the laboratory is required under CLIA to ensure the quality and validity of the tests. This laboratory is accredited and certified to perform high complexity clinical laboratory testing. 17 6