Supplementary Figure 1: Postive and negative control cell lines wers used as positive and negative controls for HPV16 (A,B) and HPV18 (C,D) PCR.

Transcription

1 Supplementary Figure 1: Postive and negative control cell lines wers used as positive and negative controls for HPV16 (A,B) and HPV18 (C,D) PCR. (A) (C) (B) (D)

2 Supplementary Figure 2: Representative image for p16 immunohistochemical staining (IHC) in ve OSCC +ve OSCC and cervical cancer (+ve control) samples. -ve OSCC +ve OSCC +ve control

3 Supplementary Figure 3: Efficient amplification of serially diluted HPV16/18 cloned plasmids. L 1K 1K 1 1 N L 1K 1K 1 1 N HPV16E6 primer HPV18L1 primer HPV18L1 primer HPV16E6 primer With HPV16 cloned plasmid With HPV18 cloned plasmid

4 Supplementary Figure 4: PCR with OSCC tumor DNA. P1 P2 P3 N1 N2 P1-positive control cervical DNA sample1 P2-positive control cervical DNA sample2 P3-UMSCC47 DNA (HPV16 positive cell line) N1-UPCI:SCC29B DNA (3ng) N2-No Template Control

5 Supplementary Figure 4, contd.: PCR with OSCC tumor DNA HPV18L1 PCR for oral tumors (using cell lines as p-ve & +ve controls) Tumors

6 Supplementary Figure 4, contd.: PCR with OSCC tumor DNA

7 9 May 215 Supplementary Figure 4, contd.: PCR with OSCC tumor DNA Tumors HPV-Cp1-2 PCR oral tumors & using cell lines (posigve control) Tumors HPV16L1 PCR oral tumors & using cell lines (posigve control)

8 Supplementary Figure 5: Inhibition of amplification reactions at high concentration of tumor genomic DNA with positive cell line spike-in experiment. UMSCC-47 DNA Tumor DNA.3ng - 3ng 3ng 3ng 3ng ng 3ng ng ng 12ng x PGMY9-11 PCR using tumor DNA spiked with HPV positive UMSCC-47 DNA

9 Supplementary Figure 6: An increase in amplification cycles did not yield better results.

10 Supplementary Figure 7: HPV E2PCR to test viral integration into host genomes. HPVE2 PCR using w1-w2 primer (Sengupta et al, 26)

11 Supplementary Figure 8: KM survival analysis with tumor attributes. With tumor differentiation (A), stage (B-D), habits (E-H), age (I), and nodal status (J). A Survival of OS_Grade Poor,moderate and well scc WDSCC(n=36) p=.32 MDSCC(n=61) PDSCC(n=15) E Survival of OS_any habit pos vs habit neg:survival proportions p=.6363 any habit pos(n=84) habit negative(n=31) I Survival of OS_age>4 vs<4:survival proportions p=.4528 Below 4(n=35) Above 4(n=84) OS B Survival of OS_clinical stage T1VsT2 Vs T3VsT4 12 p=.3 T1 (n=23) T2 (n=38) T3 (n=2) T4(n=39) F Survival of OS_chewers pos vs no habit:survival proportions p=.52 Chewers pos(n=36) habit negative(n=31) J OS_nodal status p=.2378 N(n=48) N1N2(n=72) C Survival of OS_clinical stage T1T2 Vs T3T4 1 p=.55 T1T2 (n=61) T3T4 (n=59) G Survival of OS_alcohol & chewers pos vs no habit:survival proportions p=.58 Alcohol& chewers pos(n=12) habit negative(n=31) D Survival of OS_StageI,II Vs Stage III,IV p=.733 Stage I,II (n=33) Stage III,IV(n=87) H Survival of OS_alcohol & smokers pos vs no habit 1 p=.1193 Alcohol & Smolking pos(n=11) habit negative(n=31)

12 Supplementary Figure 9: KM survival analysis with p16 expression (A,B), HPV DNA as measured by PCR (C,D), qpcr (E-H), ddpcr(i,j), positive in 3/3 DNA-based method (K,L), and E6/E7 mrna (M,N). A 1 p=.529 p16 - (n=21) p16 + (n=26) E OS_qPCR any pos vs neg p=.299 HPV negative (n=72) HPV positive (n=7) I DDPCR pos vs neg:survival proportions p=.34 HPV negative (n=65) HPV positive (n=4) M 12 OS_E6E7 RNA p=.7524 Negative(n=32) Positive(n=7) OS 2 4 OS B 1 P=. p16 Negative(n=21) p16 Positive(n=24) F 1 DFS_qPCR pos vs neg p=.172 HPV negative (n=) HPV positive (n=22) J DFS_DDPCR P=.1286 DDPCR Negative(n=65) DDPCR Positive(n=39) N Survival of DFS_HPVE6E7 mrna:survival proportions 1 p=.392 HPV RNA negative (n=33) HPV RNA positive (n=7) 2 4 DFS in months 2 4 DFS 2 4 DFS in months DFS C OS_PCR pos vs neg p=.7195 HPV negative (n=36) HPV positive (n=19) G DFS_HPV16 qpcr 1 p=.21 HPV16 Neg(n=59) HPV16 Pos(n=21) K OS_DNA Triple Nvs Triple P p=.248 Triple Negative(n=1) Triple Positive(n=1) 2 4 OS 2 4 DFS in months 2 4 D H L DFS_PCR 1 P=.48 PCR Negative(n=34) PCR Positive(n=19) 12 DFS_hpv18 qpcr P=.9619 HPV18 Negative(n=72) HPV18 Positive(n=7) Survival of DFS_Triple pos vs triple neg:survival proportions 12 p=.479 HPV negative (n=1) HPV positive (n=1) 2 4 DFS in months DFS in months DFS

13 Supplementary Figure 1: KM survival analysis of tumors in various somatic mutational background (A-F). A 1 P=.23 HIGH HPV DNA+TP53 WT HPV DNA NEG+ TP53 MUT E P=.187 HPV Neg+TP53/RASA/CASP8 WT HPV Neg+TP53/RASA/CASP8 Mut B 1 P=.129 HIGH HPV DNA+TP53 WT HPV DNA NEG ONLY F 1 P=.841 HIGH HPV DNA+TP53/RASA/Casp Wt HIGH HPV DNA+TP53/RASA/Casp Mu C P=.131 HIGH HPV DNA+TP53 WT HIGH HPV DNA+TP53 Mut 2 4 D P=.131 HPV Neg +TP53 WT HPV Neg +TP53 Mut 2 4

14 Supplementary Table 1: Patients (n = 153) used in the study. Characteristics Primary site Gender Age Risk habbits Tumor clasification/stage Differentiation Number Buccal mucosa 41 Oral tongue 112 Male 114 Female 39 >4 112 <=4 4 NA 1 Alcohol 4 Chewing 43 smoking 6 Alcohol+ chewing 14 smoking + alcohol 16 smoking + chewing 9 smoking + alcohol+ chewing 1 No habbits 44 NA 7 I+II 43 III+IV 19 NA 1 Well 48 Moderate 73 Poor 2 NA 12 Abbreviations: NA = Not Available

15 Supplementary Table 2: Primer and probe sequences along with amolicon size and the conditions of amplification reactions used for nucleic acid based detection. Parameter Assay Primer Sequence Domain Region (bp) Amplicon Size (bp) PCR Conditions Reference if any 94 C : 3 min 94 C : sec HPV16L1 5 TGC TAG TGC TTA TGC AGC AA 3 55 C : sec 3 ATT TAC TGC AAC ATT GGT AC 5 L C : sec 4 cycles 72 C : 2 min & 4 C hold 94 C : 5 min 94 C : sec GP5+/6+ 5 TTT GTT ACT GTG GTA GAT AC C : sec 3 GAA AAA TAA ACT GTA AAT CA 5 L C : 3 sec 4 cycles 72 C : 7 min & 4 C hold 94 C : 5 min 94 C : sec MY9/11 3 GCM CAG GGW CAT AAY AAT GG C : sec 5 CGT CCM ARR GGA WAC TGA TC 3 L C : sec 4 cycles Pool of 11F & 9 R primers form Gravitt et al., J Clin Microbiol, 2 72 C : 7 min & 4 C hold 94 C : 5 min PCR 94 C : sec CP I/II 5 TTA TCW TAT GCC CAY TGT ACC AT C:sec 3 ATG TTA ATW SAG CCW CCA AAA TT 5 E C : 3 sec 4 cycles 72 C : 7 min & 4 C hold 94 C : 5 min 94 C : sec PGMY9/11 Pool of 11F & 9 R primers form Gravitt et al., J Clin Microbiol, 2 L C : sec 72 C : sec

16 4 cycles 72 C : 7 min & 4 C hold 94 C : 3 min 94 C : 3 sec HPV16E6 PCR primer 5 CAG GAG CGA CCC AGA AAG TT C : 3 sec E CAG CTG GGT TTC TCT ACG TGT 5 72 C : 3 sec DNA 4 cycles 72 C : 2 min & 4 C hold 94 C : 3 min Newly designed HPV18L1 PCR primer 94 C : 4 sec 5 TCG CGT CCT TTA TCA CAG GGC GA 3 55 C : 4 sec 3 TGC CCA GGT ACA GGA GAC TGT G 5 L C : 3 sec 4 cycles 72 C : 2 min & 4 C hold HPV16E6 cloning primer 5 CAG GAG CGA CCC AGA AAG TT 3 3 CAG CTG GGT TTC TCT ACG TGT 5 E as described above 95 C : 3 min qpcr HPV16E6 qpcr 5 GCA CAG AGC TGC AAA CAA CT 3 95 C : 3 sec 3 GCA TAA ATC CCG AAA AGC AA 5 E C : 3 sec probe-attagaatgtgtgtactgcaagca-fam-bhq 72 C : 3 sec 4 cycles followed with dissociation curve HPV18L1 cloning primer 5 TCG CGT CCT TTA TCA CAG GGC GA 3 3 TGC CCA GGT ACA GGA GAC TGT G 5 L as described above

17 ddpcr E6 HPV18L1 qpcr HPV16E6 DD- PCR HPV16_E6_RTPC R using SYBR chemistry HPV18_E6_RTPC R using SYBR chemistry 95 C : 3 mints 5 TGA CAC TGT GCC TCA ATC CT 3 95 C : 3 sec 3 AGA GCC ACT TGG AGA GGG AG 5 L C : 3 sec Probe-TGCCTGCTTCACCTGGCAGC-VIC-BHQ 72 C : 3 sec 4 cycles followed with dissociation curve 95 C : 1 min 5 ACT GTC AAA AGC CAC TGT GT 3 95 C : 15 sec 3 GCT GGG TTT CTC TAC GTG TT 5 E C : 2 sec Probe-AGGGGTCGGTGGACCGGTCGATGT-FAM-BHQ 4 cycles 95 C : 1 min 95 C : 3 mints GCACCAAAAGAGAACTGCAATGTT C : 3 sec AGTCATATACCTCACGTCGCAGTA C : 3 sec 4 cycles followed with dissociation curve CTATAGAGGCCAGTGCCATTCG TTATACTTGTGTTTCTCTGCGTCG Same as above Catani et al, 29; doi: /JCM Catani et al, 29; doi: /JCM RNA HPV16_E7_RTPC R using SYBR chemistry CAAGTGTGACTCTACGCTTCGG GTGGCCCATTAACAGGTCTTCCAA Same as above Catani et al, 29; doi: /JCM E7 HPV18_E7_RTPC R using SYBR chemistry TAATCATCAACATTTACCAGCCCG Same as above CGTCTGCTGAGCTTTCTACTACTA Catani et al, 29; doi: /JCM GAPDH GAPDH CTGCACCACCAACTGCTTAG 15 Same as above TTCTGGGTGGCAGTGATG Szostek et al, 214; doi:1.349/fb62_1.73 E6 PCR Integration Assay W1-W2 region HPV16E6 E2 PCR AAGGGCGTAACCGAAATCGGT 29 as described earlier CATATACCTCACGTCGCAG ATGAAAATGATAGTACAGAC as described earlier CCAGTAGACACTGTAATAG Gallo et al, Clin Pathol 23;56: Sengupta et al, Gynecologic Oncology (26) & Gallo et al, Clin Pathol 23;56:

18 Supplementary Table 3: p-values from unpaired t-tests measuring significance in differences between differential methylation in 9 HPV associated genes between HPV +ve and HPV -ve group. Group 1: when high-copy and/or HPV E6/E7 RNA is taken into consideration to define HPV positivity, and Group 2: when HPV DNA only, irrespective of copy number, is taken into consideration to define HPV positivity. Genes Group 1 HPV +ve vs HPV -ve Group 2 HPV +ve vs HPV -ve FERMT3 < GIT2 < HK3 < PRKCZ <.1.52 ZCCHC8 <.1.4 IRF5 <.1.83 IFFO1 <.1.8 ARID3A < HOXA