NSilico Life Science Introductory Bioinformatics Course

Size: px
Start display at page:

Download "NSilico Life Science Introductory Bioinformatics Course"

Transcription

1 NSilico Life Science Introductory Bioinformatics Course

2 INTRODUCTORY BIOINFORMATICS COURSE A public course delivered over three days on the fundamentals of bioinformatics and illustrated with lectures, hands-on software workshops and case studies on prokaryotes, microbial pathogens, eukaryotes, and infection and cancer studies. This NSilico Life Science certified bioinformatics professional course will allow delegates to rapidly enter this burgeoning field. Audience: Biologists and computer scientists wishing to extend their expertise to the domain of bioinformatics. COURSE OVERVIEW An introduction to bioinformatics and the use of online resources in modern molecular biology and also working with workflows in NSilico s bioinformatics pipeline software called Simplicity and with the statistical programming package R. The student will cover methods for gene sequencing (Illumina nextgeneration and others), reads quality control, adapter trimming and cleaning, assembly, assembly quality assessment, gene prediction, codon and amino acid usage tables, similarity searching with BLAST, Gene Ontology database and GO terms, protein structure and family classification, multiple sequence alignment, phylogenetic analysis for evolutionary relatedness. Simplicity is an easy-to-use, cloud-based high performance system for the automatic annotation, analysis and visualisation of prokaryote genetic data. It is aimed at researchers who lack an in-depth knowledge of bioinformatics and enables the generation of comprehensive reports from raw data with just a few mouse clicks. 2

3 LEARNING OUTCOMES 1. Interpret information from a range of sources and apply strategies for the analysis and management of next generation sequence data. 2. Critically evaluate the strengths and weaknesses of the bioinformatics tools available for genome analysis. 3. Configure bioinformatics tools to aid in the evaluation of hypotheses and explain the significance of the results. 4. Synthesise multiple sequence alignments and highlight the significant features of the alignment using an alignment editor. 5. Design appropriate work flows for annotation of large amounts of sequence data. 6. Design and implement pipelines for gene expression analysis. 7. Demonstrate an ability to interpret complex sequence analysis data and report the findings in publishable format. 3

4 WHY ATTEND THIS COURSE? Bioinformatics is a rapidly moving field with numerous practical applications in different areas of biology, drug discovery, medicine and more. This course seeks to equip the participants with a clear methodology and practical tools and techniques designed to make bioinformatics easy to handle. During the seminar, participants will undertake numerous exercises in small groups giving them the opportunities to apply the theory blocks and reinforce the learning. THIS HIGHLY INTERACTIVE HANDS-ON COURSE REQUIRES USE OF A PERSONAL LAPTOP. COURSE IS HELD IN HOUSE OR IN OUR TRAINING CENTRE WITH SOCIAL EVENTS IN HISTORIC DUBLIN. 4

5 COURSE CONTENT DAY 1 INTRODUCTION TO COMPUTATIONAL BIOLOGY Overview, cell biology, genes, genomes, environment and epigenetics, history of genomics, biology for computer scientists, computer science for biologists, research strategies, algorithms, sequencing technology, file formats, FastQ files, file orientation, encoding type, depth of coverage, paired end, mate pair, unpaired, bioinformatics databases, software tools, online services. Hands on Workshop: Online bioinformatics tools. READS QUALITY CONTROL Sequence data and quality issues, finding how many reads are in the file, percentage GC of the entire dataset, sequence length of the reads, finding the top over-represented sequence, per-base sequence quality, per sequence quality, per base sequence content, per-base GC content, persequence GC content, per-base N content, sequence length distribution, duplicate sequences, over-represented sequences, over-represented k-mers. Hands on Workshop: Reads quality. 5

6 ADAPTER TRIMMING Dealing with contamination, phred quality scores, forward and reverse adapters, handling mismatch error rate (%), quality cut off (%), synchronised paired files. Choosing trimming tools and configuring parameters. Hands on Workshop: Adapter trimming. ASSEMBLING NEXT GENERATION SEQUENCES De novo, mapping to reference genome, De Bruijn graphs, k-mers, contigs, scaffolds, mismatch error correction, coverage, file orientation, unsorted contigs and gaps. Hands on Workshop: De novo assembly. DAY 2 ASSEMBLY ASSESSMENT GC% content, no. of contigs, largest contig length, total length of all contigs, total length of contigs 1000 bp, N50 score, N75 score, L50 score, L75 score, SNPs, INDELs and variant calling. Hands on Workshop: Assembly assessment with cases studies on SNPs and variants. GENE PREDICTION, CODON AND AMINO ACID USAGE Gene finding, open reading frames, exon, codon tables, hidden markov models, interpolated markov model, empirical methods, ab initio methods, codon and amino usage tables, codon frequency, amino acid frequency, organism codon preferences, GC content. Hands on Workshop: Gene predication assessment. 6

7 GENE EXPRESSION AND VISUALISATION Gene expression analysis, representing output, descriptive statistics, charting, gene map, circular map, linear map, heat maps. Hands on Workshop: Visualising genomic data. Basic LOCAL ALIGNMENT SEARCH TOOL (BLAST) BLASTn, BLASTp, BLASTx, tblastn, tblastx, hit, heuristic algorithms, % identity, homologues, infer functional and evolutionary relationships between sequences, BLOSUM/PAM matrixes (proteins), match/ mismatch(dna), gap open, gap extend, e-value, scores, evidence/confidence. Hands on Workshop: Basic local alignment. DAY 3 GENE ONTOLOGIES GC% content, number of contigs, largest contig length, total length of all contigsgo terms, MySQL database, integrated into EBI QuickGo, universal standard terminology for biology, gene product properties, protein domains or structural features, protein-protein interactions, cellular components, molecular functions, biological processes. Hands on Workshop: Gene Ontology. PROTEIN CLASSIFICATION Class, Architecture, Topology, Homology, Protein Data Bank, domains, protein structures are classified using a combination of automated and manual procedures, homologous super families, fold groups, CATH code, similarity search with BLASTp, pattern databases, profile databases, motifs, protein domains and families, hidden Markov model, similarity search with BLASTp. Hands on Workshop: Protein classification with case study in antibiotics resistance and virulence. 7

8 MULTIPLE SEQUENCE ALIGNMENT Pairwise alignment, dot plot, local alignment, global alignment, dynamic programming, progressive alignment, dealign input sequences, Clustal format, PHYLIP format, MSF format, max guide tree iterations, max HMM iterations. Hands on Workshop: Multiple alignment. PHYLOGENETIC ANALYSIS Tree construction, phylogenies, phylogenetic inference, root, node, outgroup, branch length, leaf, progressive alignment, Newick format, orthologous genes, paralogous genes, distance and character based methods, NJ, UPGMA, maximum parsimony, maximum likelihood, bootstrap analysis. Hands on Workshop: Phylogenetic analysis. WRAP UP Final assessment and research project mentoring. Course Director Dr Paul Walsh is chief technology officer at NSilico with over 20 years experience in high performance computing, medical applications and bioinformatics. He has led National and EU Framework projects for major projects in bioinformatics, microbial biomarker detection and cancer genomics. He has an extensive list of publications in both computer science, biology and management. He is a certified project manager and has over 20 years experience in the training sector. 8

9 BOOKING FORM PRICING GROUP DISCOUNTS 1,650 per delegate 6 or more delegates 20% discount 12 or more delegates 25% discount Phone: info@nsilico.com Web: DELEGATE DETAILS Name: Job title: Tel: Fax: Mob: Name: Job title: Tel: Fax: Mob: COMPANY DETAILS Company: Post code: Address: Country: Tel: Fax: I have read and agreed to the following terms and conditions Signature: 1. Please Invoice my Company Visa Master Card 2. Please change my Credit Card Card Number : CVS/CCV Number: Exp Date : / / Name on card : Signature : 9

10 NSilico Lifescience Ltd. Grange Erin Lodge, Grange Road, Douglas, Cork Ireland +353 (021)

Pairwise Sequence Alignment

Pairwise Sequence Alignment Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

Bioinformatics Grid - Enabled Tools For Biologists.

Bioinformatics Grid - Enabled Tools For Biologists. Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis

More information

Guide for Bioinformatics Project Module 3

Guide for Bioinformatics Project Module 3 Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first

More information

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

Current Motif Discovery Tools and their Limitations

Current Motif Discovery Tools and their Limitations Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.

More information

Phylogenetic Trees Made Easy

Phylogenetic Trees Made Easy Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts

More information

Bio-Informatics Lectures. A Short Introduction

Bio-Informatics Lectures. A Short Introduction Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively

More information

Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6

Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 In the last lab, you learned how to perform basic multiple sequence alignments. While useful in themselves for determining conserved residues

More information

Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1

Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1 Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: Sonia.Casillas@uab.cat

More information

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:

More information

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

Genome Explorer For Comparative Genome Analysis

Genome Explorer For Comparative Genome Analysis Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence

More information

BLAST. Anders Gorm Pedersen & Rasmus Wernersson

BLAST. Anders Gorm Pedersen & Rasmus Wernersson BLAST Anders Gorm Pedersen & Rasmus Wernersson Database searching Using pairwise alignments to search databases for similar sequences Query sequence Database Database searching Most common use of pairwise

More information

Introduction to NGS data analysis

Introduction to NGS data analysis Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High

More information

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249

More information

Molecular Databases and Tools

Molecular Databases and Tools NWeHealth, The University of Manchester Molecular Databases and Tools Afternoon Session: NCBI/EBI resources, pairwise alignment, BLAST, multiple sequence alignment and primer finding. Dr. Georgina Moulton

More information

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,

More information

Bayesian Phylogeny and Measures of Branch Support

Bayesian Phylogeny and Measures of Branch Support Bayesian Phylogeny and Measures of Branch Support Bayesian Statistics Imagine we have a bag containing 100 dice of which we know that 90 are fair and 10 are biased. The

More information

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each

More information

A Tutorial in Genetic Sequence Classification Tools and Techniques

A Tutorial in Genetic Sequence Classification Tools and Techniques A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University jakemdrew@gmail.com www.jakemdrew.com Sequence Characters IUPAC nucleotide

More information

Final Project Report

Final Project Report CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes

More information

SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD

SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper

More information

Welcome to the Plant Breeding and Genomics Webinar Series

Welcome to the Plant Breeding and Genomics Webinar Series Welcome to the Plant Breeding and Genomics Webinar Series Today s Presenter: Dr. Candice Hansey Presentation: http://www.extension.org/pages/ 60428 Host: Heather Merk Technical Production: John McQueen

More information

Version 5.0 Release Notes

Version 5.0 Release Notes Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com

More information

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis By the end of this lab students should be able to: Describe the uses for each line of the DNA subway program (Red/Yellow/Blue/Green) Describe

More information

Vector NTI Advance 11 Quick Start Guide

Vector NTI Advance 11 Quick Start Guide Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.

More information

Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006

Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006 Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

UGENE Quick Start Guide

UGENE Quick Start Guide Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.

More information

Bioinformatics and its applications

Bioinformatics and its applications Bioinformatics and its applications Alla L Lapidus, Ph.D. SPbAU, SPbSU, St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as

More information

Network Protocol Analysis using Bioinformatics Algorithms

Network Protocol Analysis using Bioinformatics Algorithms Network Protocol Analysis using Bioinformatics Algorithms Marshall A. Beddoe Marshall_Beddoe@McAfee.com ABSTRACT Network protocol analysis is currently performed by hand using only intuition and a protocol

More information

Visualization of Phylogenetic Trees and Metadata

Visualization of Phylogenetic Trees and Metadata Visualization of Phylogenetic Trees and Metadata November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com

More information

Protein Sequence Analysis - Overview -

Protein Sequence Analysis - Overview - Protein Sequence Analysis - Overview - UDEL Workshop Raja Mazumder Research Associate Professor, Department of Biochemistry and Molecular Biology Georgetown University Medical Center Topics Why do protein

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

Evolutionary Bioinformatics. EvoPipes.net: Bioinformatic Tools for Ecological and Evolutionary Genomics

Evolutionary Bioinformatics. EvoPipes.net: Bioinformatic Tools for Ecological and Evolutionary Genomics Evolutionary Bioinformatics Short Report Open Access Full open access to this and thousands of other papers at http://www.la-press.com. EvoPipes.net: Bioinformatic Tools for Ecological and Evolutionary

More information

Linear Sequence Analysis. 3-D Structure Analysis

Linear Sequence Analysis. 3-D Structure Analysis Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

Introduction to Phylogenetic Analysis

Introduction to Phylogenetic Analysis Subjects of this lecture Introduction to Phylogenetic nalysis Irit Orr 1 Introducing some of the terminology of phylogenetics. 2 Introducing some of the most commonly used methods for phylogenetic analysis.

More information

Core Bioinformatics. Titulació Tipus Curs Semestre. 4313473 Bioinformàtica/Bioinformatics OB 0 1

Core Bioinformatics. Titulació Tipus Curs Semestre. 4313473 Bioinformàtica/Bioinformatics OB 0 1 Core Bioinformatics 2014/2015 Codi: 42397 Crèdits: 12 Titulació Tipus Curs Semestre 4313473 Bioinformàtica/Bioinformatics OB 0 1 Professor de contacte Nom: Sònia Casillas Viladerrams Correu electrònic:

More information

Protein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004

Protein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004 Protein & DNA Sequence Analysis Bobbie-Jo Webb-Robertson May 3, 2004 Sequence Analysis Anything connected to identifying higher biological meaning out of raw sequence data. 2 Genomic & Proteomic Data Sequence

More information

The Galaxy workflow. George Magklaras PhD RHCE

The Galaxy workflow. George Magklaras PhD RHCE The Galaxy workflow George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org

More information

How Sequencing Experiments Fail

How Sequencing Experiments Fail How Sequencing Experiments Fail v1.0 Simon Andrews simon.andrews@babraham.ac.uk Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine

More information

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16 Course Director: Dr. Barry Grant (DCM&B, bjgrant@med.umich.edu) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems

More information

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

Challenges associated with analysis and storage of NGS data

Challenges associated with analysis and storage of NGS data Challenges associated with analysis and storage of NGS data Gabriella Rustici Research and training coordinator Functional Genomics Group gabry@ebi.ac.uk Next-generation sequencing Next-generation sequencing

More information

Module 1. Sequence Formats and Retrieval. Charles Steward

Module 1. Sequence Formats and Retrieval. Charles Steward The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.

More information

T cell Epitope Prediction

T cell Epitope Prediction Institute for Immunology and Informatics T cell Epitope Prediction EpiMatrix Eric Gustafson January 6, 2011 Overview Gathering raw data Popular sources Data Management Conservation Analysis Multiple Alignments

More information

Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives

Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives Dirk.Repsilber@oru.se 2015-05-21 Functional Bioinformatics, Örebro University Vad är bioinformatik och varför

More information

Biological Databases and Protein Sequence Analysis

Biological Databases and Protein Sequence Analysis Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to

More information

Delivering the power of the world s most successful genomics platform

Delivering the power of the world s most successful genomics platform Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE

More information

Bioinformatics: course introduction

Bioinformatics: course introduction Bioinformatics: course introduction Filip Železný Czech Technical University in Prague Faculty of Electrical Engineering Department of Cybernetics Intelligent Data Analysis lab http://ida.felk.cvut.cz

More information

An example of bioinformatics application on plant breeding projects in Rijk Zwaan

An example of bioinformatics application on plant breeding projects in Rijk Zwaan An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on

More information

Molecular typing of VTEC: from PFGE to NGS-based phylogeny

Molecular typing of VTEC: from PFGE to NGS-based phylogeny Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing

More information

REGULATIONS FOR THE DEGREE OF BACHELOR OF SCIENCE IN BIOINFORMATICS (BSc[BioInf])

REGULATIONS FOR THE DEGREE OF BACHELOR OF SCIENCE IN BIOINFORMATICS (BSc[BioInf]) 820 REGULATIONS FOR THE DEGREE OF BACHELOR OF SCIENCE IN BIOINFORMATICS (BSc[BioInf]) (See also General Regulations) BMS1 Admission to the Degree To be eligible for admission to the degree of Bachelor

More information

Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data

Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless

More information

Computational localization of promoters and transcription start sites in mammalian genomes

Computational localization of promoters and transcription start sites in mammalian genomes Computational localization of promoters and transcription start sites in mammalian genomes Thomas Down This dissertation is submitted for the degree of Doctor of Philosophy Wellcome Trust Sanger Institute

More information

Master's projects at ITMO University. Daniil Chivilikhin PhD Student @ ITMO University

Master's projects at ITMO University. Daniil Chivilikhin PhD Student @ ITMO University Master's projects at ITMO University Daniil Chivilikhin PhD Student @ ITMO University General information Guidance from our lab's researchers Publishable results 2 Research areas Research at ITMO Evolutionary

More information

Tutorial for proteome data analysis using the Perseus software platform

Tutorial for proteome data analysis using the Perseus software platform Tutorial for proteome data analysis using the Perseus software platform Laboratory of Mass Spectrometry, LNBio, CNPEM Tutorial version 1.0, January 2014. Note: This tutorial was written based on the information

More information

Database searching with DNA and protein sequences: An introduction Clare Sansom Date received (in revised form): 12th November 1999

Database searching with DNA and protein sequences: An introduction Clare Sansom Date received (in revised form): 12th November 1999 Dr Clare Sansom works part time at Birkbeck College, London, and part time as a freelance computer consultant and science writer At Birkbeck she coordinates an innovative graduate-level Advanced Certificate

More information

Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools.

Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Empowering microbial genomics. Extensive methods. Expansive possibilities. In microbiome studies

More information

Cloud Computing Solutions for Genomics Across Geographic, Institutional and Economic Barriers

Cloud Computing Solutions for Genomics Across Geographic, Institutional and Economic Barriers Cloud Computing Solutions for Genomics Across Geographic, Institutional and Economic Barriers Ntinos Krampis Asst. Professor J. Craig Venter Institute kkrampis@jcvi.org http://www.jcvi.org/cms/about/bios/kkrampis/

More information

DnaSP, DNA polymorphism analyses by the coalescent and other methods.

DnaSP, DNA polymorphism analyses by the coalescent and other methods. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

BIOINFORMATICS TUTORIAL

BIOINFORMATICS TUTORIAL Bio 242 BIOINFORMATICS TUTORIAL Bio 242 α Amylase Lab Sequence Sequence Searches: BLAST Sequence Alignment: Clustal Omega 3d Structure & 3d Alignments DO NOT REMOVE FROM LAB. DO NOT WRITE IN THIS DOCUMENT.

More information

A leader in the development and application of information technology to prevent and treat disease.

A leader in the development and application of information technology to prevent and treat disease. A leader in the development and application of information technology to prevent and treat disease. About MOLECULAR HEALTH Molecular Health was founded in 2004 with the vision of changing healthcare. Today

More information

Core Bioinformatics. Degree Type Year Semester

Core Bioinformatics. Degree Type Year Semester Core Bioinformatics 2015/2016 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: Sonia.Casillas@uab.cat Teachers Use of

More information

University of Glasgow - Programme Structure Summary C1G5-5100 MSc Bioinformatics, Polyomics and Systems Biology

University of Glasgow - Programme Structure Summary C1G5-5100 MSc Bioinformatics, Polyomics and Systems Biology University of Glasgow - Programme Structure Summary C1G5-5100 MSc Bioinformatics, Polyomics and Systems Biology Programme Structure - the MSc outcome will require 180 credits total (full-time only) - 60

More information

HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT

HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT Kimberly Bishop Lilly 1,2, Truong Luu 1,2, Regina Cer 1,2, and LT Vishwesh Mokashi 1 1 Naval Medical Research Center, NMRC Frederick, 8400 Research Plaza,

More information

Comparing Methods for Identifying Transcription Factor Target Genes

Comparing Methods for Identifying Transcription Factor Target Genes Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF

More information

Multiple Sequence Alignment. Hot Topic 5/24/06 Kim Walker

Multiple Sequence Alignment. Hot Topic 5/24/06 Kim Walker Multiple Sequence Alignment Hot Topic 5/24/06 Kim Walker Outline Why are Multiple Sequence Alignments useful? What Tools are Available? Brief Introduction to ClustalX Tools to Edit and Add Features to

More information

A data management framework for the Fungal Tree of Life

A data management framework for the Fungal Tree of Life Web Accessible Sequence Analysis for Biological Inference A data management framework for the Fungal Tree of Life Kauff F, Cox CJ, Lutzoni F. 2007. WASABI: An automated sequence processing system for multi-gene

More information

Simplifying Data Interpretation with Nexus Copy Number

Simplifying Data Interpretation with Nexus Copy Number Simplifying Data Interpretation with Nexus Copy Number A WHITE PAPER FROM BIODISCOVERY, INC. Rapid technological advancements, such as high-density acgh and SNP arrays as well as next-generation sequencing

More information

Searching Nucleotide Databases

Searching Nucleotide Databases Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames

More information

An introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle

An introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle An introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle Faculty of Science; Department of Marine Sciences The Swedish Royal

More information

Lecture 19: Proteins, Primary Struture

Lecture 19: Proteins, Primary Struture CPS260/BGT204.1 Algorithms in Computational Biology November 04, 2003 Lecture 19: Proteins, Primary Struture Lecturer: Pankaj K. Agarwal Scribe: Qiuhua Liu 19.1 The Building Blocks of Protein [1] Proteins

More information

UF EDGE brings the classroom to you with online, worldwide course delivery!

UF EDGE brings the classroom to you with online, worldwide course delivery! What is the University of Florida EDGE Program? EDGE enables engineering professional, military members, and students worldwide to participate in courses, certificates, and degree programs from the UF

More information

Typing in the NGS era: The way forward!

Typing in the NGS era: The way forward! Typing in the NGS era: The way forward! Valeria Michelacci NGS course, June 2015 Typing from sequence data NGS-derived conventional Multi Locus Sequence Typing (University of Warwick, 7 housekeeping genes)

More information

Three data delivery cases for EMBL- EBI s Embassy. Guy Cochrane www.ebi.ac.uk

Three data delivery cases for EMBL- EBI s Embassy. Guy Cochrane www.ebi.ac.uk Three data delivery cases for EMBL- EBI s Embassy Guy Cochrane www.ebi.ac.uk EMBL European Bioinformatics Institute Genes, genomes & variation European Nucleotide Archive 1000 Genomes Ensembl Ensembl Genomes

More information

Name Class Date. binomial nomenclature. MAIN IDEA: Linnaeus developed the scientific naming system still used today.

Name Class Date. binomial nomenclature. MAIN IDEA: Linnaeus developed the scientific naming system still used today. Section 1: The Linnaean System of Classification 17.1 Reading Guide KEY CONCEPT Organisms can be classified based on physical similarities. VOCABULARY taxonomy taxon binomial nomenclature genus MAIN IDEA:

More information

Having a BLAST: Analyzing Gene Sequence Data with BlastQuest

Having a BLAST: Analyzing Gene Sequence Data with BlastQuest Having a BLAST: Analyzing Gene Sequence Data with BlastQuest William G. Farmerie 1, Joachim Hammer 2, Li Liu 1, and Markus Schneider 2 University of Florida Gainesville, FL 32611, U.S.A. Abstract An essential

More information

Syllabus of B.Sc. (Bioinformatics) Subject- Bioinformatics (as one subject) B.Sc. I Year Semester I Paper I: Basic of Bioinformatics 85 marks

Syllabus of B.Sc. (Bioinformatics) Subject- Bioinformatics (as one subject) B.Sc. I Year Semester I Paper I: Basic of Bioinformatics 85 marks Syllabus of B.Sc. (Bioinformatics) Subject- Bioinformatics (as one subject) B.Sc. I Year Semester I Paper I: Basic of Bioinformatics 85 marks Semester II Paper II: Mathematics I 85 marks B.Sc. II Year

More information

Leading Genomics. Diagnostic. Discove. Collab. harma. Shanghai Cambridge, MA Reykjavik

Leading Genomics. Diagnostic. Discove. Collab. harma. Shanghai Cambridge, MA Reykjavik Leading Genomics Diagnostic harma Discove Collab Shanghai Cambridge, MA Reykjavik Global leadership for using the genome to create better medicine WuXi NextCODE provides a uniquely proven and integrated

More information

PHYML Online: A Web Server for Fast Maximum Likelihood-Based Phylogenetic Inference

PHYML Online: A Web Server for Fast Maximum Likelihood-Based Phylogenetic Inference PHYML Online: A Web Server for Fast Maximum Likelihood-Based Phylogenetic Inference Stephane Guindon, F. Le Thiec, Patrice Duroux, Olivier Gascuel To cite this version: Stephane Guindon, F. Le Thiec, Patrice

More information

The Moroccan American Pharmaceutical Sciences & Education Network Group (PharMaSeng), University Hassan II MohammediaCasablanca & FST Mohammedia

The Moroccan American Pharmaceutical Sciences & Education Network Group (PharMaSeng), University Hassan II MohammediaCasablanca & FST Mohammedia The Moroccan American Pharmaceutical Sciences & Education Network Group (PharMaSeng), University Hassan II MohammediaCasablanca & FST Mohammedia Organize a Bioinformatic International Workshop October

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS

More information

Next generation sequencing (NGS)

Next generation sequencing (NGS) Next generation sequencing (NGS) Vijayachitra Modhukur BIIT modhukur@ut.ee 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known

More information

Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question. Name: Class: Date: Chapter 17 Practice Multiple Choice Identify the choice that best completes the statement or answers the question. 1. The correct order for the levels of Linnaeus's classification system,

More information

EMBL-EBI Web Services

EMBL-EBI Web Services EMBL-EBI Web Services Rodrigo Lopez Head of the External Services Team SME Workshop Piemonte 2011 EBI is an Outstation of the European Molecular Biology Laboratory. Summary Introduction The JDispatcher

More information

Software review. Analysis for free: Comparing programs for sequence analysis

Software review. Analysis for free: Comparing programs for sequence analysis Analysis for free: Comparing programs for sequence analysis Keywords: sequence comparison tools, alignment, annotation, freeware, sequence analysis Abstract Programs to import, manage and align sequences

More information

Arbres formels et Arbre(s) de la Vie

Arbres formels et Arbre(s) de la Vie Arbres formels et Arbre(s) de la Vie A bit of history and biology Definitions Numbers Topological distances Consensus Random models Algorithms to build trees Basic principles DATA sequence alignment distance

More information

Using MATLAB: Bioinformatics Toolbox for Life Sciences

Using MATLAB: Bioinformatics Toolbox for Life Sciences Using MATLAB: Bioinformatics Toolbox for Life Sciences MR. SARAWUT WONGPHAYAK BIOINFORMATICS PROGRAM, SCHOOL OF BIORESOURCES AND TECHNOLOGY, AND SCHOOL OF INFORMATION TECHNOLOGY, KING MONGKUT S UNIVERSITY

More information