IDENTIFICATION AND PHYLOGENETIC ANALYSIS OF COMMON PUMPKIN VIRUSES IN SUDAN

Size: px
Start display at page:

Download "IDENTIFICATION AND PHYLOGENETIC ANALYSIS OF COMMON PUMPKIN VIRUSES IN SUDAN"

Transcription

1 Journal of Plant Pathology (2014), 96 (1), Edizioni ETS Pisa, 2014 Mohammed et al. 77 IDENTIFICATION AND PHYLOGENETIC ANALYSIS OF COMMON PUMPKIN VIRUSES IN SUDAN H.S. Mohammed 1, S. Zicca 2, A. Manglli 2,3, M.E. Mohamed 4, M.A. El Siddig 1, L. Tomassoli 2 and A.A. El Hussein 1 1 Department of Botany, Faculty of Science, University of Khartoum, P.O. Box 321, Khartoum, Sudan 2 Consiglio per la Ricerca e la Sperimentazione in Agricoltura, Plant Pathology Research Centre, Via C.G. Bertero 22, Roma, Italy 3 Dipartimento di gestione dei sistemi agricoli e forestali, Mediterranea University of Reggio Calabria, Reggio Calabria, Italy 4 Agricultural Research Corporation, Shambat Agricultural Research Station, Khartoum North, Sudan SUMMARY The objective of this study was to identify viral species infecting pumpkin in the Khartoum and Gezira states of Sudan, and to evaluate the genetic variability among members of the same viral species. A total of 60 symptomatic pumpkin leaf samples were collected from three different locations throughout the Khartoum state, and examined for viral incidence. Symptoms observed varied from mosaic, malformation, blistering of the leaves and stunting. Degenerate genus-specific and species-specific primers were used for the detection of common cucurbit viruses. Results showed that the highest incidence (21.7%) was for Cucurbit chlorotic yellows virus (CCYV) and Cucurbit yellow stunting disorder virus (CYSDV), followed by (18.3%) Zucchini yellow mosaic virus (ZYMV), and (15%) Watermelon chlorotic stunt virus (WmCSV). Single and multiple infections with more than one virus were detected. The partial nucleotide sequences of the regions encoding CI and CP, CP, HSP70h, and AV2 proteins of ZYMV, CYSDV, CCYV and WmCSV, respectively, have been deposited in NCBI GenBank. Phylogenetic analysis based on nucleotide sequences showed no or little variation among the studied viral isolates since each of them grouped well with its corresponding reference species. Key words: pumpkin, cucurbit viruses, RT-PCR, phylogenetic analysis, Sudan. INTRODUCTION Viral diseases are the main problem in the production of cucurbit plants compared to diseases caused by other agents. Viruses causing significant yield losses to cucurbits worldwide are found within several families including Geminiviridae, Closteroviridae, Bromoviridae, Luteoviridae and Potyviridae (Lecoq et al., 2003). At least 59 viral species within different genera are globally characterized and reported on cucurbits (Lecoq et al., 2003; King et al., 2011). Corresponding author: H.S. Mohammed Fax: Pumpkin (Cucurbita maxima Duchesne, family Cucurbitaceae) is an important vegetable crop in Sudan where it is grown in an area of around 2,000 ha with an average annual yield of 24 tonnes/ha (Mirghani and Mohammed, 1997). Several viruses are known, that cause mosaic symptoms in cucurbits [melon, snake cucumber, tibish (Cucumis melo var. agrestis), squash and watermelon], the most common of which are the potyviruses Zucchini yellow mosaic virus (ZYMV) (Ahmed et al., 1996; Mahgoub et al., 1997) and Moroccan watermelon mosaic virus (MWMV), the begomovirus Watermelon chlorotic stunt virus (WmCSV), the polerovirus Cucurbit aphid-borne yellows virus (CABYV), the comovirus Squash mosaic virus (SqMV) (Lecoq et al., 2003, 2011) and the crinivirus Cucurbit chlorotic yellow virus (CCYV) (Hamed et al., 2011). Pumpkin is affected by many viruses, responsible for most of the occurring damage worldwide, but its sanitary status in Sudan has not been investigated except for a recent short note reporting the occurrence of Papaya ringspot virus (PRSV) (Mohammed et al., 2012). The aim of this study was to identify viral species infecting pumpkin grown in the Khartoum and Gezira states and to evaluate the genetic variability. MATERIALS AND METHODS Samples collection and RNA extraction. A total of 60 symptomatic pumpkin leaf samples were collected from three different locations in Sudan, i.e. Wad-Ramly and Shambat areas (Khartoum), the former is one of the most important areas for pumpkin production, and Elnuba (Gezira). For viral detection 100 mg leaf tissue were ground in 1.0 ml of phosphate buffer (ph 7.2). Total RNA was extracted from 100 µl of this suspension using a RNeasy plant mini kit (Qiagen, Germany) according to the manufacturer s protocol. RT-PCR amplification and sequencing. Based on the type of cucurbit viruses usually reported from tropical Africa, eight primer sets (Table 1) were selected for detection and identification of the corresponding virus. One-step

2 78 Phylogenetic analysis of pumpkin viruses in Sudan Journal of Plant Pathology (2014), 96 (1), Table 1. Designed and published primers sets used for detection of viral species. Primer Sequence (5-3 ) Target gene Product size (bp) Annealing Temperature ( C) Target virus Reference CP9502/ CPUP GemA/ GemB MWMV-183/ MWMV-423 ZYMV-1246/ ZYMV-1689 WCPd/ WCPr Crini-s2/ Crini-as2 410L/410U CMV5CP/ 3CP TGAGGATCCTGGTGYATHGARAAYGG GCGGATCCTTTTTTTTTTTTTTTTT TAATATTACCKGWKGVCCSC TGGACYTTRCAWGGBCCTTCACA CAGGGTTCCAAAGGTCAAAA ATTTCAATGCACCACACCA CTTCCAGTCACCACACATGG TAATGCTGCTGGATCAGTGC GACCTAGTGAYGGKTGCTGTGAATCAG GCACTAGTCGACCCGAAATGCTAACTG CATTCCTACCTGTTTAGCCA TGCACTTATAATCTGCTGGTAC TTGGGCATGTGACAT AGAGACGGTAAGTAT CTCGAATTCGGATCCGCTTCTCCGCGAG GGCGAATTCGAGCTCGCCGTTAAGCTGGATGGAC Variable 53 potyviruses AV2-AV begomoviruses Cylindrical inclusion gene (CI) Heat shock protein gene (HSP70h) Van der Vlugt et al. (1999) Deng et al. (1994) MWMV This study ZYMV This study WMV This study CCYV CYSDV CMV Hamed et al. (2011) Célix et al. (1996) Anonymous (1998) Table 2. Number of pumpkin samples infected with each of the detected viral species. Location Potyvirus ZYMV Virus present Begomovirus Crinivirus WmCSV CCYV CYSDV Wad-Ramly 5/20 5/20 6/20 6/20 Elnuba 2/15 0/15 3/15 3/15 Shambat 4/25 4/25 4/25 2/25 Total (infected samples) Table 3. Accession numbers of partial nucleotide sequences of different genomic regions of pumpkin viruses. Isolate code ZYMV-Sud.C.20 CYSDV-Sud.C.22 CYSDV-Sud.C.32 CCYV-Sud.C.35 CCYV-Sud.C.37 WmCSV-Sud.C.23 WmCSV-Sud.C.37 Virus identified ZYMV CYSDV CCYV WmCSV Genomic region CP CI GenBank accession Nos. KC KC KC KC KC KC KC KC RT-PCR protocol was performed in a total volume of 25 µl containing 2 µl of total RNA extract, 5 PCR buffer (Promega, USA), 2.5 mm of each dntp, 4 µm of each primer, 1.2 U of AMV RT (Promega, USA), 0.75 U of Go-Taq polymerase (Promega, USA), 20 U of RNase-OUT (Invitrogen, USA). Amplification was done according to the following conditions: reverse transcription at 46 C for 30 min, followed by denaturation at 95 C for 7 min, and by 35 cycles of the following steps: 1 min at 94 C, 1 min at CP HSP70h AV2-AV1 specific annealing temperature (Table 1) and 1 min at 72 C with final extension for 10 min at 72 C. PCR products were visualized under UV after electrophoresis in 1.2% agarose gel and staining with 0.02% ethidium bromide. The amplified DNA fragments were purified using Amicon Ultra-0.5 Centrifugal Filter Devices (Millipore, USA). Purified products were bi-directionally sequenced (Bio- Fab Research, Italy). Sequence analysis. Nucleotide sequences, were assembled and analyzed using the MEGA 5.05 program, and subjected to sequence similarity searches against GenBank database using the BLAST program. Deduced amino acid sequences were obtained using an online translation tool ( Phylogenetic trees were constructed after multiple sequence alignments using ClustalW embedded in the MEGA 5.05 program and Neighbor-joining method with 1000 bootstrap replicates (Tamura et al., 2011). RESULTS Notable differences were observed in the symptoms shown by leaf samples collected from different locations. Yellow mosaic was dominant in plants from Shambat whereas malformation, blistering and/or stunting associated with yellow mosaic were frequently observed in plants from Wad-Ramly and Elnuba. RT-PCR based detection of pumpkin viruses. Four viral species belonging to three viral genera namely Potyvirus, Crinivirus and Begomovirus were detected in 25% of the collected samples by RT-PCR. When genus-specific and/or species-specific primers were used, the highest

3 Journal of Plant Pathology (2014), 96 (1), Mohammed et al. 79 A) JN USA JN USA 64 JN USA 65 JN USA JN USA 99 JN USA 58 JQ USA JN Iran ZYMV-Sud.C EF Israel DQ Slovakia AB Japan: Kyoto 100 AJ South Korea:Seoul AJ China:Zhejiang: Hangzhou - Banshan 100 AJ China:Zhejiang: Hangzhou - Banshan 61 AB South Korea AM Taiwan:Taichung AJ China:Zhejiang: Hangzhou - Banshan AJ China:Zhejiang: Hangzhou - Banshan NC Taiwan: Tainan 99 AF Taiwan: Tainan L29569 Reunion Island NC MWMV Tunisia I II B A B) 0.05 AJ Austria AJ Austria AJ Austria AJ Hungary 50 DQ Slovakia JN Serbia JN Serbia 70 JN Serbia AJ Hungary 14 AJ Hungary AJ Slovenia JX Venezuela AB Pakistan JX Venezuela EF Israel EF Israel JX Venezuela ZYMV-Sud.C.20 HM Sudan JF Turkey FJ Iran 0 EU Jordan EU Syria FJ Iran 46 FJ Iran 6 AJ Germany 89 JF Australia JF Australia 68 HQ India 164 GQ India 40 AB Syria A AB Syria JQ Saudi Arabia JQ Saudi Arabia 96 JQ Saudi Arabia JF Turkey JX Brazil JX Brazil 14 HM Cote d Ivoire 5 12 JN France 27 HM France AJ China AY China AB Japan JX USA AJ Italy HM Mali HM Mali 93 NC Taiwan D13914 Florida DQ Viet Nam L29569 Reunion Island AF Singapore AY China DQ Viet Nam AJ China B C NC MWMV Tunisia 0.05 Fig. 1. A. Phylogenetic tree constructed by the NJ method based on partial CI gene nucleotide sequences of 21 isolates of ZYMV from GenBank and the isolate ZYMV-Sud.C.20. MWMV was used as an out-group. Bootstrap values along the branches are supported by 1000 replicates. B. Phylogenetic tree constructed by the NJ method based on partial CP gene nucleotide sequences of 55 isolates of ZYMV from GenBank and the isolate ZYMV-Sud.C.20. MWMV was used as an out-group. Bootstrap values along the branches are supported by 1000 replicates.

4 80 Phylogenetic analysis of pumpkin viruses in Sudan Journal of Plant Pathology (2014), 96 (1), AB Japan:Kumamoto JF Sudan GU China: Shanghai GU China: Ningbo GU China: Ningbo GU China: Ningbo GU China: Shouguang 33 HM China: Ningbo HQ China JN Taiwan: Yunlin Erlun JN Taiwan: Yilan 15 JF Taiwan: Yunlin JQ China: Beijing CCYV-Sud.C AB Japan:Kumamoto JX Lebanon 99 GU China: Shouguang GU China: Shouguang CCYV-Sud.C.37 FJ LCV USA AY CYSDV Spain NC BPYV USA: Maryland 0.05 Fig. 2. Phylogenetic tree constructed by the NJ method based on the partial HSP70h gene nucleotide sequences of CCYV isolates from GenBank and the two Sudanese isolates CCYV (CCYV-Sud.C.35 and CCYV-Sud.C.37). CYSDV, Lettuce chlorosis virus (LCV) and Beet pseudo-yellows virus (BPYV) were used as out-groups. Bootstrap values along the branches are supported by 1000 replicates. incidence (21.7%) was recorded for CCYV and CYSDV, followed by ZYMV (18.3%), and WmCSV (15%) (Table 2). Multiple infections with four, three or two of these viruses were detected in one, nine and five of the studied samples, respectively. Watermelon mosaic virus (WMV) or MWMV and Cucumber mosaic virus (CMV) were not detected in any of the examined samples. Sequence analysis. The partial nucleotide sequences of the regions encoding CI and CP, CP, HSP70h, and AV2 proteins of ZYMV, CYSDV, CCYV and WmCSV, respectively were deposited in the GenBank (Table 3). ZYMV. The studied ZYMV isolate (ZYMV-Sud.C.20) shared high nucleotide and amino acid identities (98%) in both CI and CP regions with ZYMV isolates from Israel (EF062583) and Iran (JN183062) belonging to group A (Desbiez et al., 2002). In fact, phylogenetic analysis based on CI sequences available in GenBank revealed two groups, A and B, which are similar to those based on CP sequence analysis (Fig. 1A). Within group A, the Sudanese ZYMV-Sud.C.20 grouped in sub-cluster IA, together with ZYMV isolates from different countries, while the majority of the isolates from the Asiatic region were in sub-cluster IIA. However, a virus isolate from Réunion Island (L29569) stands alone in group B. Phylogenetic analysis of CP sequences revealed three significant groups (A, B and C), as reported by Lecoq and Desbiez (2012). ZYMV-Sud.C.20 and another Sudanese isolate JF Egypt 59 AF Turkey AF Turkey AF Turkey AF Lebanon AF Jordan AF USA: Texas AF Mexico: Tamaulipas AF Lebanon 37 FJ USA EF USA DQ Jordan 64 EF Guatemala EF Guatemala 27 DQ Jordan DQ Jordan DQ Jordan EF USA 31 DQ Jordan 51 AF Lebanon AY Spain AJ Spain:Almeria AJ Spain:Almeria 39 DQ Jordan 28 DQ Jordan 91 AF Spain: Almeria AF Spain: Almeria 99 AF Spain: Almeria EF Tunisia 64 CYSDV-Sud.C CYSDV-Sud.C32 AY Iran: Boushehr 99 JN Saudi Arabia AF Saudi Arabia 99 AF Saudi Arabia 99 AF Saudi Arabia AF Saudi Arabia JQ CCYV China: Beijing Fig. 3. Phylogenetic tree constructed by the NJ method based on partial CP gene nucleotide sequences of 35 isolates of CYSDV from GenBank and the two Sudanese isolates CYS- DV (CYSDV-Sud.C.22 and CYSDV-Sud.C.32). CCYV was used as an out-group. Bootstrap values along the branches are supported by 1000 replicates. (HM641799) previously identified in C. melo (Mahgoub et al., 1997) were in group A together with 48 other ZYMV isolates from different countries (Fig. 1B). CCYV. Partial nucleotide sequences of the HSP70h gene of two Sudanese pumpkin CCYV isolates (CCYV-Sud.C.35 and CCYV-Sud.C.37) showed high nucleotide and amino acid identities in the range % with all CCYV sequences available in the GenBank including a Sudanese CCYV isolate (JF807055) previously identified in C. melo and C. sativus (Hamed et al., 2011). In fact, phylogenetic analysis based on the HSP70h sequences revealed very low variation within CCYV population (Fig. 2). CYSDV. Sequence comparison in the CP region (RNA- 2) of the two Sudanese pumpkin CYSDV isolates (CYSDV- Sud.C.32 and CYSDV-Sud.C.22) showed 99% nt identity with a CYSDV isolate from Iran (AY730779) and 88.2% and 90.8% aa identity with the same Iranian isolate. Phylogenetic analysis based on the alignment of CP nt sequences showed two main groups as previously reported by Rubio et al. (2001) and Yakoubi et al. (2007). The two studied Sudanese isolates clustered with isolates from Iran and Saudi Arabia (Fig. 3).

5 Journal of Plant Pathology (2014), 96 (1), Mohammed et al. 81 A) JN Oman 66 JN Oman 98 JN Oman JN Oman JN Oman AJ Sudan WmCSV-Sud.C WmCSV-Sud.C.37 HM Lebanon EF Israel JX Jordan 4 45 JX Jordan JX Iran AJ Iran JX Iran JX Iran 14 JX Iran JX Iran JX Iran AY TYLCV Morocco: Agadir 0.02 B) JX Iran JX Iran JX Iran JX Iran JX Iran JX Iran 42 AJ Iran JX Jordan 47 JX Jordan 50 HM Lebanon 38 EF Israel 78 AJ Sudan JN Oman JN Oman JN Oman 64 JN Oman JN Oman WmCSV-Sud.C.37 WmCSV-Sud.C.23 AY TYLCV Morocco: Agadir 0.02 Fig. 4. Phylogenetic tree constructed by the NJ method based on nucleotide sequences of AV2 region (A) and partial CP region (B) of 17 WmCSV isolates from GenBank and the two Sudanese isolates WmCSV (WmCSV-Sud.C.23 and WmCSV-Sud.C.37). Tomato yellow leaf curl virus (TYLCV) was used as an out-group. Bootstrap values along the branches are supported by 1000 replicates. WmCSV. The nucleotide sequence of AV2/AV1 genes of the two Sudanese pumpkin isolates (WmCSV-Sud.C.23 and WmCSV-Sud.C.37) shared 97% nt identity with a watermelon isolate of WmCSV previously identified in Sudan (AJ245650). Comparison of deduced aa sequences in the complete AV2 and partial AV1 regions of WmCSV-Sud.C.23 showed 98% and 97% identity with the WmCSV Sudanese isolate (AJ245650), respectively. WmCSV-Sud.C.37 shared 97% identity in both regions with the same reference isolate. The phylogenetic tree based on both AV2 and CP showed that the two pumpkin WmCSV isolates reported here grouped in the same cluster together with the previously reported watermelon isolates from Sudan and Oman (Fig. 4A and B). DISCUSSION The present investigation showed that pumpkin fields in Sudan are severely infected with viruses such as CCYV, CYSDV, ZYMV and WmCSV. CCYV is a newly characterized crinivirus (Gyoutoku et al., 2009) reported as the most cucurbit-damaging virus (Kubota et al., 2011). It threatens cucurbit production in many Asiatic countries

6 82 Phylogenetic analysis of pumpkin viruses in Sudan Journal of Plant Pathology (2014), 96 (1), (Huang et al., 2010; Okuda et al., 2010; Abrahamian et al., 2012; Okuda et al., 2013) causing, for example, losses estimated at 10-20% in China (Gu et al., 2011). CCYV has recently been reported in Sudan from muskmelon and cucumber (Hamed et al., 2011). In this study, it was detected in 21.7% of the pumpkin samples showing yellowing symptoms. All the surveyed locations were affected and CCYV was found alone or in mixed infection with the other identified viruses. CYSDV is distributed throughout the Mediterranean (Papayiannis et al., 2005; Yakoubi et al., 2007; Lecoq and Desbiez, 2012), the Arab Emirates (Hassan and Duffus, 1991) and North America (CABI/EPPO, 2004). Its occurrence aggravates the phytosanitary status of the crop in Sudan as the virus was reported to affect cucurbit crops seriously in many production areas (Abou-Jawdah et al., 2000; Yakoubi et al., 2007). CYSDV was found in all regions investigated in the present study and with the same incidence level as CCYV. Both CCYV and CYSDV produce symptoms, such as interveinal chlorosis, yellowing and brittleness of lower leaves, which resemble those produced by nutritional deficiencies, a condition which usually leads to underrating disease incidence in the field. WmCSV was first identified in 1988 in Yemen (Jones et al., 1988) and rapidly spread across North Africa, Middle East (Iran, Jordan, Lebanon, Palestine, Oman) and Sudan (Kheyr-Pour et al., 2000; Al-Musa et al., 2011; Samsatly et al., 2012; Ali-Shtayeh et al., 2012; Khan et al., 2012), where it causes very severe damage to different cucurbits, especially in protected crops. Although, WmCSV was not detected in the Elnuba area, the prevalence of large populations of the vector (whiteflies) may cause disaster should the virus be introduced in this area. Consequently, the adoption of strict integrated control measures is needed to prevent possible future epidemics. Concerning aphid-borne viruses, the examined pumpkin samples were infected by PRSV (Mohammed et al., 2012) and ZYMV, both of which cause severe damage to pumpkins (Wakman et al., 2002) leading to yield reduction in many countries (Krstic et al., 2002; Zhao et al., 2003; Jossey and Babadoost, 2008; Pachner et al., 2011). In Sudan, ZYMV is considered as one of the major components of the viral pathosystem that dramatically decreases cucurbit production in many parts of the country (Mahgoub et al., 1997, 1998). In this study, phylogenetic analysis based on sequence comparison of the amplified genomic region for each identified virus was performed. No relevant differences were detected when Sudanese CCYV isolates were compared with each other and with CCYV sequences from GenBank, which supports Lin et al. (2012) conclusion that HSP70h is a conserved gene in criniviruses. The CP coding region has been used to study the variability of CYSDV populations by many authors who reported high genetic uniformity between isolates from different parts of the world (Rubio et al., 2001; Marco and Aranda, 2005; Sweiss et al., 2007; Yakoubi et al., 2007). Although all CYSDV isolates previously reported from Africa grouped with a Western subpopulation of the virus (Rubio et al., 2001), Sudanese isolates grouped with the Eastern subpopulation suggesting a common origin with isolates from Iran and Saudi Arabia. This could possibly be attributed to the wider trade links and air traffic between Sudan and other countries in this region. Phylogenetic analysis performed with Sudanese WmCSV isolates revealed some particularities when the two DNA-A genomic regions coding for AV2 protein (complete) and CP protein (partial), were separately analyzed. In fact, AV2 sequences of WmCSV isolates from GenBank grouped in two main clusters similar to those reported for the complete DNA-A component (Khan et al., 2012), and the Sudanese isolates WmCSV-Sud C.23 and WmCSV-Sud C37 were in the same cluster with a previously identified Sudanese isolate of this virus. Upon analysis of the two Sudanese isolates in the highly conserved CP region (Wyatt and Brown, 1996), the same evolutionary linkage with reference isolates including the previously identified WmCSV Sudanese isolate was evident. In addition, the sequences identity comparison indicated that there is a close relation among WmCSV isolates from different cucurbits including pumpkin, watermelon, melon and squash. This could be attributed to the endemic populations of the whitefly (Bemisia tabaci) vector in the region and indicates that this vector has a similar epidemiological behaviour regardless of the host (Kheyr-Pour et al., 2000). Two genomic regions (CI and CP) have been studied for ZYMV and the phylogenetic analysis did not reveal evidence of any evolutionary differences between the Sudanese isolate reported here and the one previously characterized (Mahgoub et al., 1997) indicating a high degree of stability in these genes through the years. This investigation provides basic information on pumpkin viruses present in three areas important for cucurbit production within Sudan. The high incidence of both aphid- and whitefly-transmitted viruses may be due to the large population of these vectors usually observed in cucurbits and other field crops in the country. Efficient measures such as the use of plastic mulches, floating covers, vector-targeting insecticides and resistant pumpkin cultivars are required to control virus spread in field crops. ACKNOWLEDGEMENTS The authors would like to acknowledge the Ministry of Higher Education and Scientific Research, Sudan for their financial support under the grant No. 95/2011.

7 Journal of Plant Pathology (2014), 96 (1), Mohammed et al. 83 REFERENCES Abou-Jawdah Y., Sobh H., Fayad A., Lecoq H., Delecolle B., Trad-Ferre J., Cucurbit yellow stunting disorder virus a new threat to cucurbits in Lebanon. Journal of Plant Pathology 82: Abrahamian P.E., Sobh H., Abou-Jawdah Y., First report of Cucurbit chlorotic yellows virus on cucumber in Lebanon. Plant Disease 96: Ahmed E.A., El Jack A.E., Salama A.M., Dafalla G.A., Resistance to three isolates of Zuchini yellow mosaic virus (ZYMV) in squash (Cucurbita pepo L.). Cucurbit Genetics Cooperative Report 19: Al-Musa A., Anfoka G., Al-Abdulat A., Misbeh S., Haj Ahmed F., Otri I., Watermelon chlorotic stunt virus (WmCSV): a serious disease threatening watermelon production in Jordan. Virus Genes 43: Ali-Shtayeh M.S., Jamous R.M., Hussein E.Y., Mallah O.B., Abu-Zaitoun S.Y., First report of Watermelon chlorotic stunt virus in watermelon in the Palestinian Authority. Plant Disease 96: 149. Anonymous, Detection and biodiversity of Cucumber mosaic cucumovirus. Conclusions from a ringtest of European Union COST 823 (New Technologies to Improve Phytodiagnosis). Journal of Plant Pathology 80: CABI/EPPO, Cucurbit yellow stunting disorder virus. Distribution Maps of Plant Diseases No CAB International, Wallingford, UK. Célix A., López-Sesé A., Almarza N., Gómes-Guillamón M.L., Rodríguez-Cerezo E., Characterization of Cucurbit yellow stunting disorder virus, a Bemisia tabaci-transmitted closterovirus. Phytophathology 86: Deng D., McGrath P.F., Robinson D.J., Harrison B.D., Detection and differentiation of whitefly- transmitted geminiviruses in plants and vector insects by the polymerase chain reaction with degenerate primers. Annual Applied Biology 125: Desbiez C., Wipf-Scheibel C., Lecoq H., Biological and serological variability, evolution and molecular epidemiology of Zucchini yellow mosaic virus (ZYMV, Potyvirus) with special reference to Caribbean islands. Virus Research 85: Gu Q.S., Liu Y.H., Wang Y.H., Huangfu W.G., Gu H.F., Xu L., Song F.M., Brown J.K., First report of Cucurbit chlorotic yellows virus in cucumber, melon and watermelon in China. Plant Disease 95: 73. Gyoutoku Y., Okazaki S., Furuta A., Etoh T., Mizobe M., Kuno K., Hayashida S., Okuda M., Chlorotic yellows disease of melon caused by Cucurbit chlorotic yellows virus, a new crinivirus. Japanese Journal of Phytopathology 75: Hamed K., Menzel W., Dafalla G., Gadelseed A.M.A., Winter S., First report of Cucurbit chlorotic yellows virus infecting muskmelon and cucumber in Sudan. Plant Disease 95: Hassan A.A., Duffus J.E., A review of a yellowing and stunting disorder of cucurbits in the United Arab Emirates. Emirates Journal of Agricultural Sciences 2: Huang L.H., Tseng H.H., Li J.T., Chen T.C., First report of Cucurbit chlorotic yellows virus infecting cucurbits in Taiwan. Plant Disease 94: Jones P., Sattar M.H.A., Al Kaff N., The incidence of virus disease in watermelon and sweetmelon crops in the People Democratic Republic of Yemen and its impact on cropping policy. Aspects of Applied Biology 17: Jossey S., Babadoost M., Occurrence and distribution of pumpkin and squash viruses in Illinois. Plant Disease 92: Khan A.J., Akhtar S., Briddon R.W., Ammara Um., Al-Matrooshi A.M., Mansoor S., Complete Nucleotide Sequence of Watermelon chlorotic stunt virus originating from Oman. Viruses 4: Kheyr-Pour A., Bananej K., Dafalla G., Caciagli P., Noris E., Ahoonmanesh A., Lecoq H., Gronenborn B., Watermelon chlorotic stunt virus from the Sudan and Iran: Sequence comparisons and identification of a whitefly-transmission determinant. Phytopathology 90: King A.M.Q., Adams M.J., Carstens E.B., Lefkowitz E.J., Virus Taxonomy. Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier/Academic Press, London, UK. Krstic B.B., Berenji J.B., Dukic N.D., Vico I.M., Katis N.I., Papavassiliou C.C., Identification of viruses infecting pumpkins (Cucurbita pepo L.) in Serbia. Proceedings for Natural Sciences, Matica Srpska 103: Kubota K., Usugi T., Tsuda S., Production of antiserum and immunodetection of Cucurbit chlorotic yellows virus, a novel whitefly-transmitted crinivirus. Journal of General Plant Pathology 77: Lecoq H., Dafalla G.A., Desbiez C., Wipf-Scheibel C., Kheyr- Pour A., A 10-year survey ( ) of cucurbit viruses in Sudan. Plant Diseases and Protection 110: Lecoq H., Dafalla G., Delécolle B., Wipf-Scheibel C., Desbiez C., Snake melon asteroid mosaic virus, a tentative new member of the genus Sobemovirus infecting cucurbits. Plant Disease 95: Lecoq, H., Desbiez, C., Viruses of cucurbits in the Mediterranean region: An ever-changing picture. Advances in Virus Research 84: Lin Y.T., Liao J.Y., Tsai C.H., Deng T.C., Complete nucleotide sequence of RNA2 of Cucurbit chlorotic yellows virus isolated from melons in Taiwan and its comparisons with currently existing isolates. Journal of Taiwan Agricultural Research 61: Mahgoub H.A., Desbiez C., Wip-Schelbel C., Dafalla G., Lecoq H., Characterization and occurrence of Zucchini yellow mosaic virus in Sudan. Plant Pathology 46: Mahgoub H.A., Desbiez C., Wip-Schelbel C., Dafalla G., Lecoq H., Biological and serological variability of Zucchini yellow mosaic virus in Sudan. Phytopathology 146: Marco C.F., Aranda M.A., Genetic diversity of a natural population of Cucurbit yellow stunting disorder virus. Journal of General Virology 86: Mirghani K.A., Mohammed T.I., Indigenous vegetables of Sudan: production, utilization and conservation. Proceedings of the IPGRI International Workshop on Genetic Resources of Traditional Vegetables in Africa. ICRAF-HQ, Nairobi, Kenya: 16. Mohammed H., Manglli A., Zicca S., El Hussein A., Mohamed M., Tomassoli L., First report of Papaya ringspot virus in pumpkin in Sudan. New Disease Reports 26: 26.

8 84 Phylogenetic analysis of pumpkin viruses in Sudan Journal of Plant Pathology (2014), 96 (1), Okuda M., Okazaki S., Yamasaki S., Okuda S., Sugiyama M., Host range and complete genome sequence of Cucurbit chlorotic yellows virus, a new member of the genus Crinivirus. Phytopathology 100: Okuda S., Okuda M., Sugiyama M., Sakata Y., Takeshita M., Iwai H., Resistance in melon to Cucurbit chlorotic yellows virus, a whitefly-transmitted crinivirus. European Journal of Plant Pathology 135: Pachner M., Paris H.S., Lelley T., Genes for resistance to Zucchini yellow mosaic in tropical pumpkin. Journal of Heredity 102: Papayiannis L.C., Ioannou N., Boubourakas I.N., Dovas C.I., Katis N.I., Falk B.W., Incidence of viruses infecting cucurbits in Cyprus. Journal of Phytopathology 153: Rubio L., Abou-Jawdah Y., Lin H.X., Falk B.W., Geographically distant isolates of the crinivirus Cucurbit yellow stunting disorder virus show very low genetic diversity in the coat protein gene. Journal of General Virology 82: Samsatly J., Sobh H., Jawhari M., Najjar C., Haidar A., Abou- Jawdah Y., First Report of Watermelon chlorotic stunt virus in Cucurbits in Lebanon. Plant Disease 96: Sweiss M., Anfoka G., Abou-Jawdah Y., Molecular characterization of Jordanian isolates of Cucurbit yellow stunting disorder virus. Journal of Phytopathology 155: Tamura K., Peterson D., Peterson N., Stecher G., Nei M., Kumar S., MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance and maximum parsimony methods. Molecular Biology and Evolution 28: Van Der Vlugt R.A.A., Steffens P., Cuperus C., Brag E., Lesemann D.E., Bos L., Vetten H.J., Further evidence that Shallot yellow stripe virus (SYSV) is a distinct potyvirus and reidentification of Welsh onion stripe virus as a SYSV strain. Phytopathology 89: Wakman W., Kontong M.S., Teakle D.S., Persley D.M., Watermelon mosaic virus of pumpkin (Cucurbita maxima) from Sulawesi: identification, transmission, and host range. Indonesian Journal of Agricultural Science 3: Wyatt S.D., Brown J.K., Detection of subgroup III geminivirus isolates in leaf extract by degenerate primers and polymerase chain reaction. Phytopathology 86: Yakoubi S., Desbiez C., Fakhfakh H., Wipf-Scheibel C., Marrakchi M., Lecoq H., Occurrence of Cucurbit yellow stunting disorder virus and Cucumber vein yellowing virus in Tunisia. Journal of Plant Pathology 89: Zhao M.F., Chen J., Zheng H.Y., Adams M.J., Chen J.P., Molecular analysis of Zucchini yellow mosaic virus isolates from Hangzhou, China. Journal of Phytopathology 151: Received April 9, 2013 Accepted July 28, 2013

Sulfuric Acid 2013 World Market Outlook and Forecast up to 2017

Sulfuric Acid 2013 World Market Outlook and Forecast up to 2017 Brochure More information from http://www.researchandmarkets.com/reports/2547547/ Sulfuric Acid 2013 World Market Outlook and Forecast up to 2017 Description: Sulfuric Acid 2013 World Market Outlook and

More information

Global Education Office University of New Mexico MSC06 3850, Mesa Vista Hall, Rm. 2120 Tel. 505 277 4032, Fax 505 277 1867, geo@unm.

Global Education Office University of New Mexico MSC06 3850, Mesa Vista Hall, Rm. 2120 Tel. 505 277 4032, Fax 505 277 1867, geo@unm. Global Education Office University of New Mexico MSC06 3850, Mesa Vista Hall, Rm. 220 Tel. 505 277 4032, Fax 505 277 867, geo@unm.edu Report on International Students, Scholars and Study Abroad Programs

More information

Contact Centers Worldwide

Contact Centers Worldwide A Contact Centers Worldwide Country Tel.no. Supported lang. Contact Center Albania Algeria 852 665 00 +46 10 71 66160 Angola 89900 +34 91 339 2121 (Port) and Portuguese +34 913394044 +34 913394023 (Por)

More information

Detection of PepMV and ringtest results

Detection of PepMV and ringtest results Detection of PepMV and ringtest results HJ (Joe) Vetten (on behalf of the PEPEIRA consortium) JKI, Institute for Epidemiology and Pathogen Diagnostics, Braunschweig, Germany www.jki.bund.de Outline Ringtest

More information

Global Education Office MSC06 3850, 1 University of New Mexico Albuquerque, NM 87131-0001 Phone: (505) 277-4032, FAX: (505) 277-1867

Global Education Office MSC06 3850, 1 University of New Mexico Albuquerque, NM 87131-0001 Phone: (505) 277-4032, FAX: (505) 277-1867 Global Education Office MSC06 3850, 1 University of New Mexico Albuquerque, NM 87131-0001 Phone: (505) 277-4032, FAX: (505) 277-1867 NEW INTERNATIONAL STUDENT ENROLLMENT FALL 2014 The following charts

More information

FDI performance and potential rankings. Astrit Sulstarova Division on Investment and Enterprise UNCTAD

FDI performance and potential rankings. Astrit Sulstarova Division on Investment and Enterprise UNCTAD FDI performance and potential rankings Astrit Sulstarova Division on Investment and Enterprise UNCTAD FDI perfomance index The Inward FDI Performance Index ranks countries by the FDI they receive relative

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Triple-play subscriptions to rocket to 400 mil.

Triple-play subscriptions to rocket to 400 mil. Triple-play criptions to rocket to 400 mil. Global triple-play criptions will reach 400 million by 2017; up by nearly 300 million on the end-2011 total and up by 380 million on the 2007 total, according

More information

Global AML Resource Map Over 2000 AML professionals

Global AML Resource Map Over 2000 AML professionals www.pwc.co.uk Global AML Resource Map Over 2000 AML professionals January 2016 Global AML Resources: Europe France Italy Jersey / Guernsey 8 Ireland 1 Portugal 7 Luxembourg 5 United Kingdom 1 50 11 Spain

More information

List of tables. I. World Trade Developments

List of tables. I. World Trade Developments List of tables I. World Trade Developments 1. Overview Table I.1 Growth in the volume of world merchandise exports and production, 2010-2014 39 Table I.2 Growth in the volume of world merchandise trade

More information

Logix5000 Clock Update Tool V2.00.36. 12/13/2005 Copyright 2005 Rockwell Automation Inc., All Rights Reserved. 1

Logix5000 Clock Update Tool V2.00.36. 12/13/2005 Copyright 2005 Rockwell Automation Inc., All Rights Reserved. 1 Logix5000 Clock Update Tool V2.00.36. 1 Overview Logix5000 Clock Update Tool 1. 1. What is is it? it? 2. 2. How will it it help me? 3. 3. How do do I I use it? it? 4. 4. When can I I get get it? it? 2

More information

Appendix 1: Full Country Rankings

Appendix 1: Full Country Rankings Appendix 1: Full Country Rankings Below please find the complete rankings of all 75 markets considered in the analysis. Rankings are broken into overall rankings and subsector rankings. Overall Renewable

More information

Accuracy counts! SENSORS WITH ANALOG OUTPUT

Accuracy counts! SENSORS WITH ANALOG OUTPUT Accuracy counts! SENSORS WITH ANALOG OUTPUT OTHER APPLICATIONS: KEY ADVANTAGES: Distance measurement Positioning Profile detection Deformation monitoring Vibration monitoring Process monitoring Detection

More information

Host-free period for Tomato yellow leaf curl virus control. Robert L. Gilbertson Department of Plant Pathology University of California-Davis

Host-free period for Tomato yellow leaf curl virus control. Robert L. Gilbertson Department of Plant Pathology University of California-Davis Host-free period for Tomato yellow leaf curl virus control Robert L. Gilbertson Department of Plant Pathology University of California-Davis Integrated Pest Management (IPM) of Insect-Transmitted Plant

More information

ab185916 Hi-Fi cdna Synthesis Kit

ab185916 Hi-Fi cdna Synthesis Kit ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1

More information

Global Effective Tax Rates

Global Effective Tax Rates www.pwc.com/us/nes Global s Global s April 14, 2011 This document has been prepared pursuant to an engagement between PwC and its Client. As to all other parties, it is for general information purposes

More information

Consolidated International Banking Statistics in Japan

Consolidated International Banking Statistics in Japan Total (Transfer Consolidated cross-border claims in all currencies and local claims in non-local currencies Up to and including one year Maturities Over one year up to two years Over two years Public Sector

More information

The big pay turnaround: Eurozone recovering, emerging markets falter in 2015

The big pay turnaround: Eurozone recovering, emerging markets falter in 2015 The big pay turnaround: Eurozone recovering, emerging markets falter in 2015 Global salary rises up compared to last year But workers in key emerging markets will experience real wage cuts Increase in

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

Cisco Global Cloud Index Supplement: Cloud Readiness Regional Details

Cisco Global Cloud Index Supplement: Cloud Readiness Regional Details White Paper Cisco Global Cloud Index Supplement: Cloud Readiness Regional Details What You Will Learn The Cisco Global Cloud Index is an ongoing effort to forecast the growth of global data center and

More information

World Consumer Income and Expenditure Patterns

World Consumer Income and Expenditure Patterns World Consumer Income and Expenditure Patterns 2014 14th edi tion Euromonitor International Ltd. 60-61 Britton Street, EC1M 5UX TableTypeID: 30010; ITtableID: 22914 Income Algeria Income Algeria Income

More information

BT Premium Event Call and Web Rate Card

BT Premium Event Call and Web Rate Card BT Managed Event and BT Self-Managed Event (also referred to as Express, Plus and Premium) Conference Bridge and Call for Booked Audio Conferencing Services will comprise the following for each phone-conference:

More information

Introducing GlobalStar Travel Management

Introducing GlobalStar Travel Management Introducing GlobalStar Travel Management GlobalStar is a worldwide travel management company owned and managed by local entrepreneurs. In total over 80 market leading enterprises, representing over US$13

More information

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 21-47 High Street, Feltham, Middlesex, TW13 4UN, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 21-47 High Street, Feltham, Middlesex, TW13 4UN, UK Schedule of United Kingdom Service 21-47 High Street, Feltham, Middlesex, TW13 4UN, UK ISO/IEC 17021:2011 to provide environmental management systems certification Kitemark Court Davy Avenue Knowlhill

More information

Make the invisible visible! SENSORS WITH EXCELLENT BACKGROUND SUPPRESSION

Make the invisible visible! SENSORS WITH EXCELLENT BACKGROUND SUPPRESSION Make the invisible visible! SENSORS WITH EXCELLENT BACKGROUND SUPPRESSION photoelectric sensors Thanks to its vision for innovation and technological enhancement, Contrinex keeps on setting new standards

More information

Global Influenza Surveillance Network (GISN) Activities in the Eastern Mediterranean Region

Global Influenza Surveillance Network (GISN) Activities in the Eastern Mediterranean Region Global Influenza Surveillance Network (GISN) Activities in the Eastern Mediterranean Region Dr Hassan El Bushra Regional Adviser, Emerging Diseases, Communicable Diseases Surveillance, Forecasting and

More information

89% 96% 94% 100% 54% Williams 93% financial aid at Williams. completion statistics $44,753 76% class of 2013 average four-year debt: $12,749

89% 96% 94% 100% 54% Williams 93% financial aid at Williams. completion statistics $44,753 76% class of 2013 average four-year debt: $12,749 financial aid at Average - $, financial aid is comprehensive, covering books, health insurance, study abroad costs, travel, and personal expenses % % % % cost met by average % of with demonstrated need

More information

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S. A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT

More information

Proforma Cost for international UN Volunteers for UN Partner Agencies for 2016. International UN Volunteers (12 months)

Proforma Cost for international UN Volunteers for UN Partner Agencies for 2016. International UN Volunteers (12 months) Proforma Cost for international UN Volunteers for UN Partner Agencies for 2016 Country Of Assignment International UN Volunteers (12 months) International UN Youth Volunteers (12 months) University Volunteers

More information

Bangladesh Visa fees for foreign nationals

Bangladesh Visa fees for foreign nationals Bangladesh Visa fees for foreign nationals No. All fees in US $ 1. Afghanistan 5.00 5.00 10.00 2. Albania 2.00 2.00 3.00 3. Algeria 1.00 1.00 2.00 4. Angola 11.00 11.00 22.00 5. Argentina 21.00 21.00 42.00

More information

Chapter 4A: World Opinion on Terrorism

Chapter 4A: World Opinion on Terrorism 1 Pew Global Attitudes Project, Spring 2007 Now I m going to read you a list of things that may be problems in our country. As I read each one, please tell me if you think it is a very big problem, a moderately

More information

I. World trade developments

I. World trade developments I. World trade developments The value of world merchandise exports increased by 20 per cent in 2011 while exports of commercial services grew by 11 per cent. Key developments in 2011: a snapshot Trade

More information

www.ode.it THE COMPLETE SOLUTION for COFFEE MACHINES SOLENOID VALVES & PUMPS

www.ode.it THE COMPLETE SOLUTION for COFFEE MACHINES SOLENOID VALVES & PUMPS www.ode.it THE COMPLETE SOLUTION for COFFEE MACHINES SOLENOID VALVES & PUMPS THE CONCEPT OF QUALITY HAS ALWAYS BEEN PART OF ODE CULTURE AND MISSION. ODE is a leading company since 1960 in designing and

More information

THE WORLD S LEADING CAR DESIGN MAGAZINE

THE WORLD S LEADING CAR DESIGN MAGAZINE THE WORLD S LEADING CAR DESIGN MAGAZINE DISTRIBUITED IN MORE THAN 60 COUNTRIES EUROPE: Austria, Belgium, Cyprus, Denmark, Finland, France, Germany, United Kingdom, Greece, Ireland, Iceland, Italy, Latvia,

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Digital TV Research. http://www.marketresearch.com/digital-tv- Research-v3873/ Publisher Sample

Digital TV Research. http://www.marketresearch.com/digital-tv- Research-v3873/ Publisher Sample Digital TV Research http://www.marketresearch.com/digital-tv- Research-v3873/ Publisher Sample Phone: 800.298.5699 (US) or +1.240.747.3093 or +1.240.747.3093 (Int'l) Hours: Monday - Thursday: 5:30am -

More information

Excerpt Sudan Fixed Telecommunications: Low Penetration Rates Get a Boost from Broadband Internet and VoIP Services

Excerpt Sudan Fixed Telecommunications: Low Penetration Rates Get a Boost from Broadband Internet and VoIP Services Excerpt Sudan Fixed Telecommunications: Low Penetration Rates Get a Boost from Broadband Internet and VoIP Services This report is part of Pyramid Research s series of Africa & Middle East Country Intelligence

More information

YTD 2015-27 CS AWARDS IN AMERICAS

YTD 2015-27 CS AWARDS IN AMERICAS YTD 2015-27 CS AWARDS IN AMERICAS Argentina Bolivia Brazil Frontline Customer Service Team of the Year, All Industries (Bronze) Customer Service Department of the Year, Airlines, Distribution & Transportation

More information

Composition of Premium in Life and Non-life Insurance Segments

Composition of Premium in Life and Non-life Insurance Segments 2012 2nd International Conference on Computer and Software Modeling (ICCSM 2012) IPCSIT vol. 54 (2012) (2012) IACSIT Press, Singapore DOI: 10.7763/IPCSIT.2012.V54.16 Composition of Premium in Life and

More information

A Region by Any Other Name...

A Region by Any Other Name... A Region by Any Other Name.... Janet Hall Bethany Public Schools, Bethany, Oklahoma jhall@bps.k12.ok.us OVERVIEW: It is often true that a place may be categorized as belonging to more than one region,

More information

PrimeSTAR HS DNA Polymerase

PrimeSTAR HS DNA Polymerase Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction

More information

CMMI for SCAMPI SM Class A Appraisal Results 2011 End-Year Update

CMMI for SCAMPI SM Class A Appraisal Results 2011 End-Year Update CMMI for SCAMPI SM Class A 2011 End-Year Update Software Engineering Institute Carnegie Mellon University Pittsburgh, PA 15213 1 Outline Introduction Current Status Community Trends Organizational Trends

More information

Senate Committee: Education and Employment. QUESTION ON NOTICE Budget Estimates 2015-2016

Senate Committee: Education and Employment. QUESTION ON NOTICE Budget Estimates 2015-2016 Senate Committee: Education and Employment QUESTION ON NOTICE Budget Estimates 2015-2016 Outcome: Higher Education Research and International Department of Education and Training Question No. SQ15-000549

More information

INTERNATIONAL OVERVIEW John Wilkinson SVP Sales & Products

INTERNATIONAL OVERVIEW John Wilkinson SVP Sales & Products INTERNATIONAL OVERVIEW John Wilkinson SVP Sales & Products DE- C I X N G N L A U N C H E V E N T 2 Introduction XConnect provides secure, managed ENUM Registries and SIP based peering services to enable

More information

Brandeis University. International Student & Scholar Statistics

Brandeis University. International Student & Scholar Statistics 1 Brandeis University International Student & Scholar Statistics 2014 2 TABLE OF CONTENTS OVERVIEW OF INTERNATIONAL STUDENT & SCHOLAR POPULATION 3 DETAILED INFORMATION ON INTERNATIONAL STUDENT POPULATION

More information

Fall 2015 International Student Enrollment

Fall 2015 International Student Enrollment Fall 2015 International Student Enrollment Prepared by The Office of International Affairs Nova Southeastern University Nova Southeastern University International Student Statistics Fall 2015 International

More information

Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013)

Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) Protocols Internal transcribed spacer region (ITS) region Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) The nuclear ribosomal RNA (rrna) genes (small subunit, large subunit and 5.8S) are

More information

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing. User manual imegen Anchovies II ID kit Anchovies species (E. encrasicolus and E. japonicus) DNA detection by sequencing Reference: Made in Spain The information in this guide is subject to change without

More information

SuccessFactors Employee Central: Cloud Core HR Introduction, Overview, and Roadmap Update Joachim Foerderer, SAP AG

SuccessFactors Employee Central: Cloud Core HR Introduction, Overview, and Roadmap Update Joachim Foerderer, SAP AG Orange County Convention Center Orlando, Florida June 3-5, 2014 SuccessFactors Employee Central: Cloud Core HR Introduction, Overview, and Roadmap Update Joachim Foerderer, SAP AG SESSION CODE: 1812 Cloud

More information

European Research Council

European Research Council ERC Starting Grant Outcome: Indicative statistics Reproduction is authorised provided the source ERC is acknowledged ERCEA/JH. ERC Starting Grant: call Submitted and selected proposals by domain Submitted

More information

PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS GENOTYPES

PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS GENOTYPES Eötvös Lóránd University Biology Doctorate School Classical and molecular genetics program Project leader: Dr. László Orosz, corresponding member of HAS PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS

More information

Hepatitis B Virus Genemer Mix

Hepatitis B Virus Genemer Mix Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For

More information

EMEA BENEFITS BENCHMARKING OFFERING

EMEA BENEFITS BENCHMARKING OFFERING EMEA BENEFITS BENCHMARKING OFFERING COVERED COUNTRIES SWEDEN FINLAND NORWAY ESTONIA R U S S I A DENMARK LITHUANIA LATVIA IRELAND PORTUGAL U. K. NETHERLANDS POLAND BELARUS GERMANY BELGIUM CZECH REP. UKRAINE

More information

Shell Global Helpline - Telephone Numbers

Shell Global Helpline - Telephone Numbers Shell Global Helpline - Telephone Numbers The Shell Global Helpline allows reports to be submitted by either a web-based form at https://shell.alertline.eu or by utilising one of a number of telephone

More information

Supplementary Information - PCR amplification PCR amplification reactions for the partial mitochondrial cytochrome oxidase subunit I (COI), the

Supplementary Information - PCR amplification PCR amplification reactions for the partial mitochondrial cytochrome oxidase subunit I (COI), the Supplementary Information - PCR amplification PCR amplification reactions for the partial mitochondrial cytochrome oxidase subunit I (COI), the ribosomal 16S rdna gene and a fragment of the nuclear single

More information

AP Biology Essential Knowledge Student Diagnostic

AP Biology Essential Knowledge Student Diagnostic AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in

More information

Faster voice/data integration for global mergers and acquisitions

Faster voice/data integration for global mergers and acquisitions Global agility in technology solutions. sm Faster voice/data integration for global mergers and acquisitions >The InTech Group, Inc. Worldwide in-country technical resources for newly merged companies

More information

Carnegie Mellon University Office of International Education Admissions Statistics for Summer and Fall 2013

Carnegie Mellon University Office of International Education Admissions Statistics for Summer and Fall 2013 Carnegie Mellon University Admissions Statistics for and Fall 2013 New International Students and Fall 2012 Undergraduate 270 14.3% Master's 1301 68.7% Doctorate 192 10.1% Exchange 99 5.2% 31 1.6% Total

More information

International Higher Education in Facts and Figures. Autumn 2013

International Higher Education in Facts and Figures. Autumn 2013 International Higher Education in Facts and Figures Autumn 2013 UK Higher Education International Unit International higher education in facts and figures covers the majority of the UK higher education

More information

Region Country AT&T Direct Access Code(s) HelpLine Number. Telstra: 1 800 881 011 Optus: 1 800 551 155

Region Country AT&T Direct Access Code(s) HelpLine Number. Telstra: 1 800 881 011 Optus: 1 800 551 155 Mondelēz International HelpLine Numbers March 22, 2013 There are many ways to report a concern or suspected misconduct, including discussing it with your supervisor, your supervisor s supervisor, another

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

DOMESTIC AND FOREIGN DIRECT INVESTMENT REALIZATION IN QUARTER IV AND JANUARY DECEMBER 2014

DOMESTIC AND FOREIGN DIRECT INVESTMENT REALIZATION IN QUARTER IV AND JANUARY DECEMBER 2014 Invest in remarkable indonesia indonesia Invest in remarkable indonesia Invest in remarkable indonesia Invest in remarkable indonesia invest in Invest in Invest in Invest in indonesia Invest in remarkable

More information

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins

More information

Clinical Trials. Local Trial Requirements

Clinical Trials. Local Trial Requirements Clinical Trials Clinical trials insurance covers the legal liabilities of the insured in respect of clinical trials for bodily injury arising from the trial. The coverage provided by Newline is on the

More information

TUV HELLAS IS: COMPANY PROFILE PRESENTATION OF ACTIVITIES

TUV HELLAS IS: COMPANY PROFILE PRESENTATION OF ACTIVITIES COMPANY PROFILE PRESENTATION OF ACTIVITIES TUV HELLAS IS: Subsidiary wholly owned by TUV NORD Operating in Greece since 1987 One of the most reliable Inspection and Certification Organizations in the Country

More information

Know the Facts. Aon Hewitt Country Profiles can help: Support a decision to establish or not establish operations in a specific country.

Know the Facts. Aon Hewitt Country Profiles can help: Support a decision to establish or not establish operations in a specific country. Aon Hewitt Country Profiles Your eguide to employment requirements and practices Profiles for nearly 90 countries worldwide Risk. Reinsurance. Human Resources. Know the Facts Whether you are a newcomer

More information

International Marketing Data and Statistics

International Marketing Data and Statistics International Marketing Data and Statistics 2014 38th edi tion Euromonitor International Ltd, 60-61 Britton Street, London EC1M 5UX Euromonitor International Ltd 2013 www.euromonitor.com 3 Preliminaries

More information

Global Dynamism Index (GDI) 2013 summary report. Model developed by the Economist Intelligence Unit (EIU)

Global Dynamism Index (GDI) 2013 summary report. Model developed by the Economist Intelligence Unit (EIU) Global Dynamism Index (GDI) 2013 summary report Model developed by the Economist Intelligence Unit (EIU) What is the Global Dynamism Index (GDI)? the GDI assesses the dynamism of 60 of the world's largest

More information

amplification tech Optical Design of CFX96 Real-Time PCR Detection System Eliminates the Requirement of a Passive Reference Dye

amplification tech Optical Design of CFX96 Real-Time PCR Detection System Eliminates the Requirement of a Passive Reference Dye amplification tech note 6047 Optical Design of CFX96 Real-Time PCR Detection System Eliminates the Requirement of a Passive Reference Dye Liz Jordan and Richard Kurtz, Gene Expression Division, io-rad

More information

Business Phone. Product solutions. Key features

Business Phone. Product solutions. Key features Product solutions Enjoy free calls and significant savings on your business landline bills with from International. Set-up is simple and you don t need to change your existing telephone numbers, plus there

More information

SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis

SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis The STORE processing methods were shown to be fit-for purpose for DNA, RNA and protein extraction

More information

COST Presentation. COST Office Brussels, 2013. ESF provides the COST Office through a European Commission contract

COST Presentation. COST Office Brussels, 2013. ESF provides the COST Office through a European Commission contract COST Presentation COST Office Brussels, 2013 COST is supported by the EU Framework Programme ESF provides the COST Office through a European Commission contract What is COST? COST is the oldest and widest

More information

27 TH SEPTEMBER 2016 THE CONRAD HOTEL DUBAI, UAE

27 TH SEPTEMBER 2016 THE CONRAD HOTEL DUBAI, UAE 27th September 2016 The Conrad Hotel, Dubai, UAE 27 TH SEPTEMBER 2016 THE CONRAD HOTEL DUBAI, UAE TELECOMS WORLD AWARDS 2016 CATEGORIES BEST OPERATOR BEST BRAND BEST CUSTOMER EXPERIENCE BEST ENTERPRISE

More information

PicoMaxx High Fidelity PCR System

PicoMaxx High Fidelity PCR System PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED

More information

World Solution Provider

World Solution Provider GE Consumer & Industrial World Solution Provider GE imagination at work GE Six businesses aligned with our customers needs, acting as one company. Harnessing the imaginations of more than 300,000 people

More information

Genomic DNA Extraction Kit INSTRUCTION MANUAL

Genomic DNA Extraction Kit INSTRUCTION MANUAL Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview

More information

DuchenneConnect. www.duchenneconnect.org

DuchenneConnect. www.duchenneconnect.org DuchenneConnect www.duchenneconnect.org 1 What is DuchenneConnect? Web based patient self report registry to link the resources and needs of the Duchenne/Becker muscular dystrophy community, including:

More information

Expression of Interest in Research Grant Applications

Expression of Interest in Research Grant Applications INTERNATIONAL CENTRE FOR GENETIC ENGINEERING AND BIOTECHNOLOGY THE ACADEMY OF SCIENCES FOR THE DEVELOPING WORLD UNITED NATIONS EDUCATIONAL, SCIENTIFIC AND CULTURAL ORGANIZATION ICGEB-TWAS-UNESCO/IBSP Joint

More information

The World Market for Medical, Surgical, or Laboratory Sterilizers: A 2013 Global Trade Perspective

The World Market for Medical, Surgical, or Laboratory Sterilizers: A 2013 Global Trade Perspective Brochure More information from http://www.researchandmarkets.com/reports/2389480/ The World Market for Medical, Surgical, or Laboratory Sterilizers: A 2013 Global Trade Perspective Description: This report

More information

Carnegie Mellon University Office of International Education Admissions Statistics for Summer and Fall 2010

Carnegie Mellon University Office of International Education Admissions Statistics for Summer and Fall 2010 Carnegie Mellon University Admissions Statistics for and Fall 2010 New International Students and Fall 2010 Undergraduate 208 16.1% Master's 799 61.7% Doctorate 177 13.7% Exchange 80 6.2% 31 2.4% Total

More information

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B

More information

(1) Hybrid Cucumber Seed Production. Samuel Contreras Departamento de Ciencias Vegetales Pontificia Universidad Católica de Chile Santiago, Chile

(1) Hybrid Cucumber Seed Production. Samuel Contreras Departamento de Ciencias Vegetales Pontificia Universidad Católica de Chile Santiago, Chile (1) Hybrid Cucumber Seed Production Samuel Contreras Departamento de Ciencias Vegetales Pontificia Universidad Católica de Chile Santiago, Chile (2) Introduction Cucurbitaceae family The Cucurbitaceae

More information

Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3

Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3 Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA

More information

Mir-X mirna First-Strand Synthesis Kit User Manual

Mir-X mirna First-Strand Synthesis Kit User Manual User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information

Wheat Import Projections Towards 2050. Chad Weigand Market Analyst

Wheat Import Projections Towards 2050. Chad Weigand Market Analyst Wheat Import Projections Towards 2050 Chad Weigand Market Analyst January 2011 Wheat Import Projections Towards 2050 Analysis Prepared by Chad Weigand, Market Analyst January 2011 Purpose The United Nations

More information

BS. Agricultural and Biological Sciences, Escuela Superior Politecnica del Litoral (ESPOL), Guayaquil-Ecuador

BS. Agricultural and Biological Sciences, Escuela Superior Politecnica del Litoral (ESPOL), Guayaquil-Ecuador 1 EDUCATION Robert A. Alvarez Quinto robertalexander16@gmail.com, robaalva@espol.edu.ec Plant Virology Program. Centro de Investigaciones Biotecnológicas del Ecuador (CIBE-ESPOL) Km 30.5 Vía Perimetral,

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

International Financial Reporting Standards

International Financial Reporting Standards International Financial Reporting Standards Of Growing Importance for U.S. Companies Assurance Services there is no longer a choice Three factors may influence your need to consider IFRS. First, many organizations

More information

41 T Korea, Rep. 52.3. 42 T Netherlands 51.4. 43 T Japan 51.1. 44 E Bulgaria 51.1. 45 T Argentina 50.8. 46 T Czech Republic 50.4. 47 T Greece 50.

41 T Korea, Rep. 52.3. 42 T Netherlands 51.4. 43 T Japan 51.1. 44 E Bulgaria 51.1. 45 T Argentina 50.8. 46 T Czech Republic 50.4. 47 T Greece 50. Overall Results Climate Change Performance Index 2012 Table 1 Rank Country Score** Partial Score Tendency Trend Level Policy 1* Rank Country Score** Partial Score Tendency Trend Level Policy 21 - Egypt***

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

GEORGIA. SUMMARY OF PLANT PROTECTION REGULATIONS Updated November, 2013

GEORGIA. SUMMARY OF PLANT PROTECTION REGULATIONS Updated November, 2013 GA - 1 of 6 GEORGIA SUMMARY OF PLANT PROTECTION REGULATIONS Updated November, 2013 Georgia Department of Agriculture 1109 Experiment Street Redding Building Griffin, Georgia 30223 www.agr.georgia.gov/plant-protection.aspx

More information

A) CURRICULUM VITEA Name: Gamal Abdalla Elbadri SUDAN Place and Date of Birth Sudan Marital status Nationality Ph.D M.Sc M.Sc B.Sc Thesis Ph.D M.

A) CURRICULUM VITEA Name: Gamal Abdalla Elbadri SUDAN Place and Date of Birth Sudan Marital status Nationality Ph.D M.Sc M.Sc B.Sc Thesis Ph.D M. A) CURRICULUM VITEA Name: Gamal Abdalla Elbadri E-mail Address: gamal_elbadri@yahoo.com Address: Agricultural Research Coporation Crop protection department Plant pathology section Wad Medani P.O. Box

More information

STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR)

STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR) STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR) jmvizcaino@vet.ucm.es Av/ Puerta de Hierro s/n. 28040 Madrid. Tel: (34) 913944082

More information

U.S. Trade Overview, 2013

U.S. Trade Overview, 2013 U.S. Trade Overview, 213 Stephanie Han & Natalie Soroka Trade and Economic Analysis Industry and Analysis Department of Commerce International Trade Administration October 214 Trade: A Vital Part of the

More information

MAUVE GROUP GLOBAL EMPLOYMENT SOLUTIONS PORTFOLIO

MAUVE GROUP GLOBAL EMPLOYMENT SOLUTIONS PORTFOLIO MAUVE GROUP GLOBAL SOLUTIONS PORTFOLIO At Mauve Group, we offer a variety of complete employee management services such as Global Employment Solutions (GES), Professional Employment Outsourcing (PEO),

More information

RevertAid Premium First Strand cdna Synthesis Kit

RevertAid Premium First Strand cdna Synthesis Kit RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent

More information

Chart 1: Zambia's Major Trading Partners (Exports + Imports) Q4 2008 - Q4 2009. Switzernd RSA Congo DR China UAE Kuwait UK Zimbabwe India Egypt Other

Chart 1: Zambia's Major Trading Partners (Exports + Imports) Q4 2008 - Q4 2009. Switzernd RSA Congo DR China UAE Kuwait UK Zimbabwe India Egypt Other Bank of Zambia us $ Million 1. INTRODUCTION This report shows Zambia s direction of merchandise trade for the fourth quarter of 2009 compared with the corresponding quarter in 2008. Revised 1 statistics,

More information

Strong in service. Worldwide. CHOOSE THE NUMBER ONE.

Strong in service. Worldwide. CHOOSE THE NUMBER ONE. Strong in service. Worldwide. CHOOSE THE NUMBER ONE. We are always there for you! Our most important asset is our commitment and our technical expertise. Peter Pauli, Head of After Sales (middle) Roland

More information

The Global Flight From Marriage : Has It Come to the Arabic World? A First Look at the Evidence

The Global Flight From Marriage : Has It Come to the Arabic World? A First Look at the Evidence The Global Flight From Marriage : Has It Come to the Arabic World? A First Look at the Evidence Nicholas Eberstadt, Ph.D. Henry Wendt Chair in Political Economy American Enterprise Institute

More information