El papel de la anatomía patológica en oncología: presente y futuro. The role of pathological anatomy in oncology: present and future
|
|
|
- Geraldine Bond
- 7 years ago
- Views:
Transcription
1 El papel de la anatomía patológica en oncología: presente y futuro The role of pathological anatomy in oncology: present and future Federico Rojo Fundación Jiménez Díaz, Madrid
2 All patients with same diagnosis: Potential role for biomarker-based diagnostics
3 The genetic basis for cancer treatment decisions Garraway, LA. J Clin Oncol 2012
4 Evolution of NSCLC subtyping Li, T et al. J Clin Oncol 2013
5 Sparing cost for the health insurance Example of gefitinib treatment in lung cancer 1.7M EGFR testing for lung cancer patients (gefinitib treatment: 8 weeks DFS; Mok 2009) patients patients + (gefinitib treatment: 38 weeks DFS; Mok 2009) 69M 35M Spared cost of gefitinib treatment Cost of gefitinib treatment
6 Sources of variability in molecular testing Allred, DC. Mod Pathol 2010
7 Delay to formalin fixation (cold ischemia) modifies DNA quality The longer duration of fixation adversely affects the quality of tissue DNA The size of DNA extracted from FFPE decreases with increasing fixation time Tissues fixed in buffered formalin for 3 to 6 hours yield greater amounts of high-molecular weight DNA 1h 2h 6h 12h 24h A B C A B C A B C A B C A B C Sample
8 Preservation of DNA in FFPE archieved tissue samples Buffered 4% Formaldehyde / 10% Formalin minimal prefixation time lag, 2 hours duration of fixation (3 to 6 hours) absolutely avoid low ph No Bouin, No Acid Formaline, No B5, No AZF, No decalcified samples (bone biopsies) Lab A Lab B Lab C Lab E Lab D Rojo, F. SPMM 2011
9 DNA sequence alterations due to formalin fixation in archival specimens FFPE tissues exhibit a high frequency of nonreproducible sequence alteration because of cross-linking cytosine nucleotides on DNA strands. Taq-DNA polymerase fails to recognize the cytosine and incorporates an adenine in the place of a guanosine, creating an artificial C-T or G-A mutation. Error rate is ~12%. Williams, C et al. Am J Pathol 1999 Hofreiter, M et al. Nucleic Acids Res 2001 Akbari, M et al. J Mol Diag 2005 Lamy, A et al. Mod Pathol 2011
10 Recommendations for mutation testing Su, KY. Et al. J Clin Oncol 2012 Querings, S. et al. PLOS One 2011
11 RAS mutations by pyrosequencing KRAS WT Codon 12 Codon 13 NRAS WT Codon 12 Codon 13 (GG T) (GG T) (GG T) (GG T) KRAS MUT (GG T) (GA T) NRAS MUT (G A T) (G A T) KRAS WT Codon 146 (G C A) KRAS MUT (G C T) NRAS MUT 34 ( T G T)
12 Importance of selection of tissue sample for molecular diagnosis Adenocarcinoma Normal tissue Liver Necrosis
13 Heterogeneidad en cáncer: distinta enfermedad en distintos pacientes, en distintas localizaciones y variabilidad intratumoral
14 Heterogeneidad en cáncer de mama: distinta enfermedad en distintas mujeres
15 Heterogeneidad en cáncer de mama: distinta enfermedad en distintas mujeres Reis-Filho, JS. AACR 2012 Weigelt, B. et al. Breast Can Res 2010 Lee, JK. et al. Clin Cancer Res 2010
16 Heterogeneidad en cáncer de mama: distinta enfermedad en distintas localizaciones Falk, AK Metástasis ganglionar Luminal A (%) Tumor primario Luminal B (%) HER2 (%) TN (%) Luminal A Luminal B HER TN Martinez de Dueñas, E (ConvertHER) Metástasis visceral (lab. central) Luminal 74 (90) 21 (0) 22 (18) HER2 16 (3) 76 (100) 7 (6) TN 10 (7) 3 (0) 71 (76) Falck, AK et al. BMC Cancer 2013 Martinez de Dueñas, E et al. Breast Cancer Res Treat 2013
17 Heterogeneidad en cáncer de mama: distinta enfermedad en distintas localizaciones Niikura, N. et al. J Clin Oncol 2012
18 Heterogeneity of mutations in colorectal cancer Baldus, SE. et al. Clin Cancer Res 2010 Voutsina, A et al. Mod Pathol 2013 WT in both samples MUT in both samples WT in primary, MUT in mx MUT in primary, WT in mx
19 Intratumor heterogeneity: impact on biomarker detection Gerlinger, M. et al. NEJM 2012
20 Heterogeneity of mutations in cancer: Clonal dynamics and resistance
21 Heterogeneidad en cáncer de mama: variabilidad intratumoral
22 Heterogeneidad en cáncer de mama: variabilidad intratumoral Navin, N et al. Genome Res 2010
23 Heterogeneidad en cáncer de mama: variabilidad intratumoral Mosoyan, G et al. PLOS One 2013
24 Heterogeneidad en cáncer de mama: variabilidad intratumoral Mosoyan, G et al. PLOS One 2013
25 Heterogeneidad en cáncer de mama: variabilidad intratumoral Heterogeneous distribution of PIK3CA mutations in breast primary vs metastasis in 0-30% Jensen, JD et al. Clin Can Res 2011 Gonzalez-Angulo, AM et al. Mol Cancer Ther 2011
26 Cancer genome: Routine diagnostic in next years
27 Cancer genome: Routine diagnostic in next years
28 Cancer genome: Dynamic modulation of genetic background
29 Cancer genome: Dynamic modulation of genetic background
30 Mensajes finales Estandarización en los procesos de laboratorio: fase preanalítica y ensayos Elección del ensayo más apropiado a las características de nuestro centro Inversión en tecnología y formación específica y continua de los especialistas Alta complejidad de la enfermedad
Breast and Lung Cancer Biomarker Research at ASCO: Changing Treatment Patterns
July 2013 Edition Vol. 7, Issue 7 Breast and Lung Cancer Biomarker Research at ASCO: Changing Treatment Patterns By Julie Katz, MPH, MPhil Biomarkers played a prominent role in the research presented in
Targeted Therapy What the Surgeon Needs to Know
Targeted Therapy What the Surgeon Needs to Know AATS Focus in Thoracic Surgery 2014 David R. Jones, M.D. Professor & Chief, Thoracic Surgery Memorial Sloan Kettering Cancer Center I have no disclosures
ALCHEMIST (Adjuvant Lung Cancer Enrichment Marker Identification and Sequencing Trials)
ALCHEMIST (Adjuvant Lung Cancer Enrichment Marker Identification and Sequencing Trials) 3 Integrated Trials Testing Targeted Therapy in Early Stage Lung Cancer Part of NCI s Precision Medicine Effort in
Applications of comprehensive clinical genomic analysis in solid tumors: obstacles and opportunities
Applications of comprehensive clinical genomic analysis in solid tumors: obstacles and opportunities Vincent A. Miller, M.D. Foundation Medicine, Inc. AACR Annual Meeting 2012 Current Concepts session
Oncology Insights Enabled by Knowledge Base-Guided Panel Design and the Seamless Workflow of the GeneReader NGS System
White Paper Oncology Insights Enabled by Knowledge Base-Guided Panel Design and the Seamless Workflow of the GeneReader NGS System Abstract: This paper describes QIAGEN s philosophy and process for developing
The RNA strategy. RNA as a tool and target in human disease diagnosis and therapy.
The RNA strategy RNA as a tool and target in human disease diagnosis and therapy. The Laboratory of RNA Biology and Biotechnology at the Centre for Integrative Biology (CIBIO) of the University of Trento,
Pharmacogenomic Approaches. Luis Paz-Ares Hospital Universitario Virgen del Rocio Seville, Spain
Pharmacogenomic Approaches Luis Paz-Ares Hospital Universitario Virgen del Rocio Seville, Spain Pharmacogenetics & Pharmacogenomics Medicine tailored to the individual Genetic information, including the
WHITE PAPER SEPT 2015
WHITE PAPER SEPT 2015 LIQUID BIOPSY FOR THE DETECTION AND MONITORING OF CANCER: ANALYSIS OF 96 HOTSPOT MUTATIONS VIA PLASMA DERIVED CIRCULATING TUMOR DNA PATHWAY GENOMICS CANCER AND SOMATIC MUTATIONS The
Rilevanza dell innovazione tecnologica per la
Rilevanza dell innovazione tecnologica per la ricerca traslazionale e la terapia in oncologia Ruggero De Maria Dipartimento di Ematologia Oncologia e Medicina Molecolare, Istituto Superiore di Sanità Translational
Formalin fixation at low temperature better preserves nucleic acid integrity. Gianni Bussolati. University of Turin
Formalin fixation at low temperature better preserves nucleic acid integrity Gianni Bussolati University of Turin Disclosure of interests: G.B. was originally responsible for the invention of the Cold
Targeted Therapies in Lung Cancer
Targeted Therapies in Lung Cancer I Edited by: Simona Carnio Thoracic Oncology Division - St Luigi Hospital Orbassano (TO) - Italy Silvia Novello Department of Oncology - University of Torino - Italy Why
How To Make Cancer A Clinical Sequencing
10 this time, it s Personal In what is an exciting era in the evolution of oncology treatment, this special feature by Deborah J. Ausman explores how Next-Generation Sequencing and Convergent Informatics
Médecine de précision médecine personnalisée en Oncologie. Fabien Calvo, Directeur Recherche et Innovation, INCa, Directeur ITMO Cancer, AVIESAN
Médecine de précision médecine personnalisée en Oncologie Fabien Calvo, Directeur Recherche et Innovation, INCa, Directeur ITMO Cancer, AVIESAN Successful targeted drug development Rapid identification
The following information is only meant for people who have been diagnosed with advanced non-small cell
Important information for people with advanced non-small cell lung cancer The following information is only meant for people who have been diagnosed with advanced non-small cell lung cancer (NSCLC). NSCLC
Guideline Development The American Society of Clinical Oncology
Assessing Genomic Sequencing Information for Health Care Decision Making Decision Making Once Evidence is Assessed/Graded Evaluated Guideline Development The American Society of Clinical Oncology Gary
targeted therapy a guide for the patient
targeted therapy FOR LUNG CANCER a guide for the patient TABLE OF CONTENTS lung cancer basics... 2-3 Gene changes... 4-5 Testing... 7-8 Targeted therapy... 9-11 Drugs Targeting EGFR... 12 Drugs Targeting
Future Directions in Clinical Research. Karen Kelly, MD Associate Director for Clinical Research UC Davis Cancer Center
Future Directions in Clinical Research Karen Kelly, MD Associate Director for Clinical Research UC Davis Cancer Center Outline 1. Status of Cancer Treatment 2. Overview of Clinical Research at UCDCC 3.
Nuevas tecnologías basadas en biomarcadores para oncología
Nuevas tecnologías basadas en biomarcadores para oncología Simposio ASEBIO 14 de marzo 2013, PCB Jose Jimeno, MD, PhD Co-Founder / Vice Chairman Pangaea Biotech SL Barcelona, Spain PANGAEA BIOTECH BUSINESS
Clinical Use of Molecular Diagnos@cs in the Treatment of Lung Cancer
Clinical Use of Molecular Diagnos@cs in the Treatment of Lung Cancer Tianhong Tina Li, MD, PhD (thli@ucdavis.edu) Associate Professor of Clinical Medicine, School of Medicine Disclosures Grants/Research
Next Generation Sequencing in Early-Phase Clinical Trials in Cancer Filip Janku
11 th International Congress on Targeted Anticancer Therapies Paris March 4-6, 2013 Next Generation Sequencing in Early-Phase Clinical Trials in Cancer Filip Janku Investigational Cancer Therapeutics (Phase
Genomic Medicine The Future of Cancer Care. Shayma Master Kazmi, M.D. Medical Oncology/Hematology Cancer Treatment Centers of America
Genomic Medicine The Future of Cancer Care Shayma Master Kazmi, M.D. Medical Oncology/Hematology Cancer Treatment Centers of America Personalized Medicine Personalized health care is a broad term for interventions
Molecular Stratification of Cancer in the
Molecular Stratification of Cancer in the Clinical Setting David Gonzalez de Castro Molecular Diagnostics NHS FT and The Institute of Cancer Research, London, UK 1 2 The complexity of human cancer genomes
Lung Carcinomas New 2015 WHO Classification. Spasenija Savic Pathology
Lung Carcinomas New 2015 WHO Classification Spasenija Savic Pathology ***EXPECTED SPRING 2015*** This authoritative, concise reference book provides an international standard for oncologists and pathologists
Craig Hallum Conference Investor Presentation
Craig Hallum Conference Investor Presentation Improving cancer outcomes with groundbreaking precision in molecular testing Paul Kinnon President and CEO Sept 2015 1 Forward-Looking Statements Certain statements
Molekylært målrettet medicinsk kræftbehandling for klinikere principper og metoder
Molekylært målrettet medicinsk kræftbehandling for klinikere principper og metoder Professor Claus Lindbjerg Andersen Department of Molecular Medicine (MOMA) Aarhus University hospital Outline The central
Gebruik van predictieve markers voor targeted therapy in de algemene praktijk
Gebruik van predictieve markers voor targeted therapy in de algemene praktijk Gerrit A. Meijer, MD, PhD Professor of Pathology Chair of the Department of Pathology VU Universtiy Medical Center Amsterdam
Prognostic and Predictive Factors in Oncology. Mustafa Benekli, M.D.
Prognostic and Predictive Factors in Oncology Mustafa Benekli, M.D. NCI Definitions ESMO Course -Essentials of Medical Oncology -Istanbul 2 Prognostic factor: NCI Definition A situation or condition, or
Fecha: 04/12/2010. New standard treatment for breast cancer at early stages established
New standard treatment for breast cancer at early stages established London December 04, 2010 12:01:13 AM IST Spanish Oncology has established a new standard treatment for breast cancer at early stages,
Instruction manual for product # PNAC-2001. Version 1.2
PNAClamp BRAF Mutation Detection Kit For in vitro diagnostic use Instruction manual for product # PNAC-2001 Version 1.2 Store at -20 C. Instruction Version: Ver. 1.2 Date of Revision: 2012 February 1 /
Individualizing Your Lung Cancer Care: Informing Decisions Through Biomarker Testing
Individualizing Your Lung Cancer Care: Informing Decisions Through Biomarker Testing These Are Hopeful Times for Lung Cancer Survivors When people first learn they have cancer, they are often afraid. But
PNA BRAF Mutation Detection Kit
- PNA BRAF Mutation Detection Kit Catalog Number KA2102 50 tests/kit Version: 01 Intended for research use only www.abnova.com Introduction and Background Intended use The PNA BRAF Mutation Detection Kit
Genomic Analysis of Mature B-cell Malignancies
Genomic Analysis of Mature B-cell Malignancies Update and Lessons Learned Omar Abdel-Wahab, MD Memorial Sloan Kettering Cancer Center Human Oncology and Pathogenesis Program and Leukemia Service Disclaimer:
EGFR mutation testing: what is the best choice?
EGFR? EGFR mutation testing: what is the best choice? Dekairelle Anne-France, PhD Center for Applied Molecular Technologies Prof GALA Jean-Luc, MD, PhD In response to ligand binding, EGFR is activated
1. Le mutazioni di KRAS hanno tutte lo stesso significato clinico?
EGFR downstream pathways KRAS domande frequenti ed importanti. Luca Mazzucchelli Istituto cantonale di patologia Locarno )'"* )-# %& # +%,!"# '( "#$ Anti-EGFR monoclonal antibodies (MoAbs) Cetuximab and
Seminar N2 Targeted Therapies in Hospital Pharmacy One Problem, Two Views
Dr. Tilman Schöning Heidelberg University Hospital, Germany Seminar N2 Targeted Therapies in Hospital Pharmacy One Problem, Two Views Conflicts of interest Participation in Advisory Boards Amgen GmbH,
Corporate Medical Policy
Corporate Medical Policy Molecular Analysis for Targeted Therapy for Non-Small Cell Lung File Name: Origination: Last CAP Review: Next CAP Review: Last Review: molecular_analysis_for_targeted_therapy_for_non_small_cell_lung_cancer
Resolving Cancer Heterogeneity:
INTERNATIONAL SYMPOSIUM ON: Resolving Cancer Heterogeneity: The way to personalised medicine Palazzo della Gran Guardia Verona (Italy), June 30 th July 2 nd, 2016 PROGRAM Organized by: ARC-Net Centre for
REPORT PERSPECTIVES IN LUNG CANCER 2010 AMSTERDAM
REPORT PERSPECTIVES IN LUNG CANCER 2010 AMSTERDAM Valerie Van Damme, Isabelle Wauters, Johan Vansteenkiste Univ. Hospital Leuven and Leuven Lung Cancer Group Introduction Perspectives in Lung Cancer (PILC)
Innovation: Present Meets Future
Innovation: Present Meets Future SOCIAL INNOVATION Leading Innovation in the Cooperative Group Setting Craig Nichols, M.D. BEST OF SWOG Barlogie-Salmon Myeloma Committee Robert Z. Orlowski, M.D., Ph.D.
Case based applications part III
Case based applications part III Los Angeles Society Of Pathologists January 25, 2014 Sanja Dacic, MD, PhD University of Pittsburgh Medical Center 1 CASE 1 A 44-year-old woman with multiple lung nodules.
The last decade has witnessed the dramatic coming
Lung Cancer Pathology Changing paradigm and priorities Ming-Sound Tsao, MD, FRCPC Abstract The last decade has witnessed the dramatic coming of age of targeted therapy in lung cancer. Several new targeted
BRAF in the diagnostic evaluation of thyroid nodules
Symposium 13 Molecular markers in thyroid cancer: current role in clinical practice BRAF in the diagnostic evaluation of thyroid nodules Laura Fugazzola University of Milan, Italy Papillary carcinoma BRAF
White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger
White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger Sequencing 2 Evaluation of BRAF (V600E) Mutation by Immunohistochemical
Translating DNA repair pathways into therapeutic targets: beyond the BRCA1/2 and PARP inhibitor saga. Jorge S Reis-Filho, MD PhD FRCPath
Translating DNA repair pathways into therapeutic targets: beyond the BRCA1/2 and PARP inhibitor saga Jorge S Reis-Filho, MD PhD FRCPath Summary How do PARP inhibitors work? Synthetic lethality Potential
The EGFR mutation and precision therapy for lung cancer
for lung cancer Outcomes in advanced lung cancer have seen meaningful improvement in the past decade thanks to new precision drug therapies. Because tumors usually develop resistance to the drugs, scientists
Opportunities and Challenges in Translating Novel Discoveries into Useful Clinical Tests
Opportunities and Challenges in Translating Novel Discoveries into Useful Clinical Tests James H. Doroshow, M.D. NCI Deputy Director for Clinical and Translational Research NCI Workshop: Evidence Needed
Launching a Cancer Genetic Laboratory to Enhance Diagnosis and Treatment
Launching a Cancer Genetic Laboratory to Enhance Diagnosis and Treatment Arthur L. Beaudet, M.D. Department of Molecular and Human Genetics Baylor College of Medicine ORIGIN AND PRECEDENT Decades of experience
What is Cancer? Cancer is a genetic disease: Cancer typically involves a change in gene expression/function:
Cancer is a genetic disease: Inherited cancer Sporadic cancer What is Cancer? Cancer typically involves a change in gene expression/function: Qualitative change Quantitative change Any cancer causing genetic
Non Small Cell Lung Cancer: Scientific Discoveries and the Pursuit of Progress
Non Small Cell Lung Cancer: Scientific Discoveries and the Pursuit of Progress Lung Cancer Accounts for 14% of All New Cancer Diagnoses in the United States 1 Lung cancer is the second most common malignancy
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
Nuovi Scenari in Oncologia. G. Zoppoli X-Files in Nutrizione Clinica e Artificiale, 08/06/2012
Nuovi Scenari in Oncologia G. Zoppoli X-Files in Nutrizione Clinica e Artificiale, 08/06/2012 WHAT is cancer? «Cancer is a genetic disease of the somatic cell» [B. Vogelstein] Ten years ago Now [Cell.
Genomic Clinical Trials: NCI Initiatives
Genomic Clinical Trials: NCI Initiatives James H. Doroshow, M.D. Deputy Director for Clinical and Translational Research National Cancer Institute National Cancer Advisory Board Washington, DC December
Essais de médicine personnalisée en cancérologie. Jean-Charles SORIA
Essais de médicine personnalisée en cancérologie Jean-Charles SORIA Cured Cancer patients 2.8 M / year in the EU Local failure Not cured Distant failure Cured Cancer patients 2.8 M / year in the EU Not
Access to hormone receptor testing and other basic diagnostic pathology services in Colombia
Access to hormone receptor testing and other basic diagnostic pathology services in Colombia Dr Fernando Perry Clínica de seno y tejidos blandos Instituto Nacional de Cancerología de Colombia Breast cancer
microrna Signatures in Cancer E. ROBERT WASSMAN, MD, FAAP, FACMG CHIEF MEDICAL OFFICER, ROSETTA GENOMICS
microrna Signatures in Cancer E. ROBERT WASSMAN, MD, FAAP, FACMG CHIEF MEDICAL OFFICER, ROSETTA GENOMICS 1st International Congress on Controversies in Personalized Oncology (CONPO) BARCELONA, SPAIN MARCH
Clinical development of AZD9291 in non-small cell lung cancer
Clinical development of AZD9291 in non-small cell lung cancer Rachael Lawrance (AstraZeneca) PSI One Day Meeting: The Innovative, Challenging and Diversified World of Respiratory Disease 13 Nov 2015 Overview
Lung Cancer: More than meets the eye
Lung Cancer Education Program November 23, 2013 Lung Cancer: More than meets the eye Shantanu Banerji MD, FRCPC Presenter Disclosure Faculty: Shantanu Banerji Relationships with commercial interests: Grants/Research
EGFR gene mutations Ex 19 Ex 21 Paez et al, Science 2004
Evolution of knowledge in NSCLC Pao and Girard, Lancet Oncology 2011 Fattori da considerare nella scelta terapeutica del NSCLC nel 2012 Stadio di malattia PS Età Comorbidità Compliance e desiderio del
Microsatellite Instability (MSI) A New Paradigm in Cancer Treatment. Lynch Syndrome OUTLINE. GI Molecular Pathology
OUTLINE GI Molecular Pathology Microsatellite Instability and Lynch Syndrome GI Cancer Genotyping KRAS Mutations in Colorectal Cancer A. John Iafrate MD-PhD Department of Pathology Massachusetts General
Using genetic biomarkers to pre-identify oncology patients for clinical trials
White paper Quintiles Vantage Point Quintiles helped develop or commercialize all of the Top 30 bestselling oncology products of 2014 Oncology pre-profiling: Using genetic biomarkers to pre-identify oncology
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application
Stage III & IV colon and rectal cancers share a similar genetic profile: a review of the Oregon Colorectal Cancer Registry
The American Journal of Surgery (2013) 205, 608-612 North Pacific Surgical Association Stage III & IV colon and rectal cancers share a similar genetic profile: a review of the Oregon Colorectal Cancer
The Role of Genetic Testing in the Evaluation of Thyroid Nodules. Thyroid Cancer and FNA. Thyroid Cancer. Pure Follicular Cancers.
Where does Molecular Analysis of FNA Specimens fit into the evaluation of thyroid nodules? The Role of Genetic Testing in the Evaluation of Thyroid Nodules Ultrasound TSH Risk factors Jill E. Langer, MD
A clinicians view on NGS of (lung) cancer
A clinicians view on NGS of (lung) cancer oliver.gautschi@onkologie.ch 14.1.2015 Predictive Role of Biomarkers for Lung Cancer Therapy Chemotherapy: not confirmed Anti-Angiogenic-Therapy: not confirmed
FINDING RELATION BETWEEN AGING AND
FINDING RELATION BETWEEN AGING AND TELOMERE BY APRIORI AND DECISION TREE Jieun Sung 1, Youngshin Joo, and Taeseon Yoon 1 Department of National Science, Hankuk Academy of Foreign Studies, Yong-In, Republic
The Diagnosis of Cancer in the Pathology Laboratory
The Diagnosis of Cancer in the Pathology Laboratory Dr Edward Sheffield Christmas Select 74 Meeting, Queen s Hotel Cheltenham, 3 rd December 2014 Agenda Overview of the pathology of cancer How specimens
High-quality genomic DNA isolation and sensitive mutation analysis
Application Note High-quality genomic DNA isolation and sensitive mutation analysis Izabela Safin, Ivonne Schröder-Stumberger and Peter Porschewski Introduction A major objective of cancer research is
La diagnostica molecolare nelle neoplasie colo-rettali. A do Scarpa. U iversita di Vero a
La diagnostica molecolare nelle neoplasie colo-rettali C-NET A do Scarpa e Dipartime to Pato ogia e U iversita di Vero a La stessa malattia puo avere diverse patogenesi cucchiaio moneta forchetta Gastrointestinal
POSICIONAMIENTO TECNOLOGICO Y CLINICO DE LA BRAQUITERAPIA FRENTE A LOS AVANCES DE LA ALTA TECNOLOGIA MODERNA
POSICIONAMIENTO TECNOLOGICO Y CLINICO DE LA BRAQUITERAPIA FRENTE A LOS AVANCES DE LA ALTA TECNOLOGIA MODERNA Alfredo Polo MD, PhD Brachytherapy & Intraoperative Radiotherapy Unit Ramon y Cajal University
HER2/neu (erbb2) Analysis on FNA Smears and Core Biopsies of Primary or Metastatic Breast Cancer. Ann Thor M.D.
PSC/USCAP 2008 Applications of Molecular Analysis to Small Biopsy and Cytology Specimens for Diagnosis and Targeted Therapy HER2/neu (erbb2) Analysis on FNA Smears and Core Biopsies of Primary or Metastatic
Pharmacogenomic markers in EGFR-targeted therapy of lung cancer
Pharmacogenomic markers in EGFR-targeted therapy of lung cancer Rafal Dziadziuszko, MD, PhD University of Colorado Cancer Center, Aurora, CO, USA Medical University of Gdansk, Poland EMEA Workshop on Biomarkers,
Epidemiology, Staging and Treatment of Lung Cancer. Mark A. Socinski, MD
Epidemiology, Staging and Treatment of Lung Cancer Mark A. Socinski, MD Associate Professor of Medicine Multidisciplinary Thoracic Oncology Program Lineberger Comprehensive Cancer Center University of
SAMO FoROMe Post-ESMO 2013 Breast Cancer
SAMO FoROMe Post-ESMO 2013 Breast Cancer Dr. med. Manuela Rabaglio Klinik und Poliklinik für Medizinische Onkologie Breast Cancer Track 300 Abstracts 142 Poster 11 Proffered paper 4 late breaking news
IBCSG Tissue Bank Policy
THE INTERNATIONAL BREAST CANCER STUDY GROUP IBCSG Tissue Bank Policy Accepted by the IBCSG Executive Committee on March 24, 2006 Accepted by the IBCSG Ethics Committee on March 24, 2006 Accepted by the
Revision of the Directive 98/79/EC on In Vitro Diagnostic Medical Devices. Response from Cancer Research UK to the Commission August 2010
Revision of the Directive 98/79/EC on In Vitro Diagnostic Medical Devices Response from Cancer Research UK to the Commission August 2010 1. Cancer Research UK (CR-UK) 1 is leading the world in finding
EGFR MUTATIONS IN NON-SMALL CELL LUNG CANCER: LOCAL EPIDEMIOLOGY AND CLINICAL IMPORTANCE
Rev. Med. Chir. Soc. Med. Nat., Iaşi 2015 vol. 119, no. 4 INTERNAL MEDICINE - PEDIATRICS ORIGINAL PAPERS EGFR MUTATIONS IN NON-SMALL CELL LUNG CANCER: LOCAL EPIDEMIOLOGY AND CLINICAL IMPORTANCE F. Rusu-Cordunean
Targeted therapies and brain metastases in lung cancer patients. Benjamin Besse, MD, PhD. Medical Oncologist. 19 septembre 2014
Targeted therapies and brain metastases in lung cancer patients Benjamin Besse, MD, PhD Medical Oncologist 19 septembre 2014 Targeted therapies and brain mets! Brain mets in NSCLC! Specific targeted therapies!
micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved
microrna 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions of target mrnas Act as negative
Clinical Trial Designs for Incorporating Multiple Biomarkers in Combination Studies with Targeted Agents
Clinical Trial Designs for Incorporating Multiple Biomarkers in Combination Studies with Targeted Agents J. Jack Lee, Ph.D. Department of Biostatistics 3 Primary Goals for Clinical Trials Test safety and
Understanding series. new. directions. 1-800-298-2436 LungCancerAlliance.org. A guide for the patient
Understanding series LUNG CANCER: new treatment directions 1-800-298-2436 LungCancerAlliance.org A guide for the patient TABLE OF CONTENTS What s New in lung cancer? Advancements...4 Changes in genes that
Non-small Cell Lung Cancer
Non-small Cell Lung Cancer Eva Szabo, MD Division of Cancer Prevention, NCI TRACO 11-2-15 Outline US Lung Cancer Statistics Tobacco use and lung cancer Risk Factors Tobacco, tobacco, tobacco (85% lung
NICE Pathways bring together all NICE guidance, quality standards and other NICE information on a specific topic.
bring together all NICE guidance, quality standards and other NICE information on a specific topic. are interactive and designed to be used online. They are updated regularly as new NICE guidance is published.
FARMACI PERSONALIZZATI PER
ISTITUTO NAZIONALE PER LO STUDIO E LA CURA DEI TUMORI FONDAZIONE G. Pascale NAPOLI SC Biologia Cellulare e Bioterapie CENTRO RICERCHE ONCOLOGICHE MERCOGLIANO (AV) Laboratorio di Farmacogenomica FARMACI
IKDT Laboratory. IKDT as Service Lab (CRO) for Molecular Diagnostics
Page 1 IKDT Laboratory IKDT as Service Lab (CRO) for Molecular Diagnostics IKDT lab offer is complete diagnostic service to all external customers. We could perform as well single procedures or complex
Molecular analyses of EGFR: mutation and amplification detection
Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens Outline presentation
Local Coverage Determination (LCD): MolDX: Breast Cancer Assay: Prosigna (L36125)
Local Coverage Determination (LCD): MolDX: Breast Cancer Assay: Prosigna (L36125) Contractor Information Contractor Name Palmetto GBA LCD Information Document Information LCD ID L36125 Original ICD-9 LCD
Developments in Biomarker Identification and Validation for Lung Cancer
Developments in Biomarker Identification and Validation for Lung Cancer Alexandre Passioukov, MD, PhD Alexandre.Passioukov@eortc.be Contents Introduction Lung cancer pathogenesis NSCLC treatment options
Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle
Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle TITLE PROJET NOM HOPITAL Assessment of tumor angiogenesis using PET/CT with 18 F-Galacto- RGD. (PNC_29_001) Division of
Lung Cancer. Advances in Lung Cancer Treatment
Lung Cancer Advances in Lung Cancer Treatment Treatment for lung cancer is changing rapidly. There are new therapies that target specific molecular changes that drive the growth and spread of the lung
GENETIC PROFILES AND TARGETED TREATMENT OF CANCER - PERSONALIZED MEDICINE
GENETIC PROFILES AND TARGETED TREATMENT OF CANCER - PERSONALIZED MEDICINE Branko Zakotnik MD, PhD Department of Medical Oncology Institute of Oncology Ljubljana 1 I have no conflict of interest to declare
Advancing Personalized Therapy for Advanced Non-Small Cell Lung Cancer
GUIDING THE WAY White Paper Advancing Personalized Therapy for Advanced Non-Small Cell Lung Cancer is a serum proteomic test for patients with advanced non-small cell lung cancer that helps healthcare
DNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
BIOBANK LPCE-NICE CHEST
BIOBANK LE-NIE HEST athologist : S. LASSALLE 01/03/2011 Time for frozen procedure : 10 mn LE / HU Unit atient : N LH 11-0004 N LB 11-0002 onsent : YES Age : 37 ID : TH ER Diagnosis and staging : Hodgkin
Analysis of the colorectal tumor microenvironment using integrative bioinformatic tools
MLECNIK Bernhard & BINDEA Gabriela Analysis of the colorectal tumor microenvironment using integrative bioinformatic tools INSERM U872, Jérôme Galon Team15: Integrative Cancer Immunology Cordeliers Research
targeted cancer therapy
LUNG CANCER TREATMENTS What you need to know about... targeted cancer therapy foreword About LUNGevity LUNGevity is the largest national lung cancer-focused nonprofit, changing outcomes for people with
Target enrichment using selector probes. Department of Genetics and Pathology, Uppsala University
Target enrichment using selector probes Mats Nilsson Department of Genetics and Pathology, Uppsala University Target enrichment using selector probes Even with radically improved sequencing throughput,
THE SIDNEY KIMMEL COMPREHENSIVE CANCER CENTER AT JOHNS HOPKINS
Ushering in a new era of cancer medicine Center is ushering in a new era of cancer medicine. Progress that could not even be imagined a decade ago is now being realized in our laboratories and our clinics.
PATOLOGIA MOLECULAR DEL CANCER GINECOLOGICO. Xavier Matias-Guiu Hospital Universitari Arnau de Vilanova, Universitat de Lleida, IRBLLEIDA.
PATOLOGIA MOLECULAR DEL CANCER GINECOLOGICO Xavier Matias-Guiu Hospital Universitari Arnau de Vilanova, Universitat de Lleida, IRBLLEIDA. Carcinoma de Endometrio Cáncer de Ovario Endometrial carcinoma
Contents. Updated July 2011
- Updated July 2011 Guideline Authors: Todd S. Crocenzi, M.D.; Mark Whiteford, M.D.; Matthew Solhjem, M.D.; Carlo Bifulco, M.D.; Melissa Li, M.D.; Christopher Cai, M.D.; and James Durham, M.D. Contents
Receptor conversion in distant breast cancer metastases. Breast cancer metastases: A spitting image of their primary?
Receptor conversion in distant breast cancer metastases Breast cancer metastases: A spitting image of their primary? Introduction Breast cancer is the leading cause of female cancer death worldwide (13,000