Size: px
Start display at page:



1 ЖВЩДНБИЗОБ ПЕВВРЕБ, 2006, 40, 2, Н Д Дapple ъfl ЗВАВЩ ЙЩЖЩГЙ АВ ЕЙКЩИРЕИВАОЗЗЛ КВА ВИВА Е РЩЗВЖО ҐЩХНГҐО Л ИЩК ЕЕГ Й. О. Д, В. И. Пapple, А. А. Рapple*,. О. Дappleapple Е flapple ъ И, Ж, К apple Д : SINE, appleapple, apple. A NEW FAMILY OF INTERSPERSED REPEATS FROM SQUAMATE REPTILES, by S. A. Kosushkin, O. R. Borodulina, V. V. Grechko*, D. A. Kramerov (Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, Russia, * * appleapple apple SINE (Short Interspersed Elements) fl. Ч ъ - appleъ, appleapple apple ъ - appleapple appleapple SINEs. З 5'- - fl, apple, apple- -ъ ИЗД, apple, apple ъ - apple apple LINE [1]. З - SINE fl ъ apple applefl - apple, ъ (О)--, apple ъ,, fl fl ъapple appleapple apple- fl ЗД- [2, 3]. apple SINEs apple (flapple, apple. Squamata) -. В apple flapple Podarcis sicula (. Lacertidae), 5'-ъ apple ИЗД, -apple c LINE-ъ - [4]. В apple apple - fl fl apple apple- appleappleapple ЗД apple apple. * Ч. : А appleъ - appleapple apple SINE flapple apple Darevskia (Squamat: Lacertidae) Darevskia praticola D. raddei, applefl - fl apple apple apple applefl apple (apple). Кapple ъapple- apple apple К И-apple - ЗД D. raddei ( apple [5, 6]). А appleapple -, apple, apple- A-ъ appleapple fl ИЗД-apple III (О-К И). Йapple apple fl fl apple ЗД, apple - SINE, fl ъ A ( > apple, 5'-TRGCTCAGTGG-). З apple- appleapple ъapple appleapple (ъ- < apple, 5'-GCTCTCYAG- GRTTTCA-), apple К И apple, apple- 5'- SINE. Дapple, appleapple apple apple - D. praticola -. Ч appleapple О1 2 apple apple SINE (apple ъ). О fl (apple ), fl appleapple, appleapple fl К SINE Squam-2 flapple. Lacertidae (Dra Darevskia raddei, Dpr Darevskia praticola). Аapple fl К И appleapple ъ A (ъ >), - apple ъapple appleapple (<). З appleapple - applefl apple apple. trna-ala ИЗД Оla(CGC) - (fl ъapple apple apple ). ъ Аapple SINE, ИЗД Оla(CGC) : Squam-2 flapple, Das-1 ъapple [6, 14], Vic-1 [13] ID-Rno apple [12]. А apple- appleapple О1, О2, 1 2. Йfl appleapple Squam-2 fl apple apple apple -, ъ appleapple ИЗД-apple III (ъ A ъ B). 378

2 ЗВАВЩ ЙЩЖЩГЙ АВ ЕЙКЩИРЕИВАОЗЗЛ КВА ВИВА ъ 5' П О П А ' 5' 5' appleapple О1 appleapple О2 appleapple T1 appleapple 2

3 380 Д apple. SINE. 5'- ъ - ИЗД Оla(CGC) - (apple ), apple applefl - apple appleapple fl ИЗД-apple III ъ A B. apple ИЗД 100.., fl apple - applefl. ИЗД-apple apple (85..) fl ъ apple-, apple apple fl , apple ъ- ИЗД. apple, ъ - appleъ. apple - apple. ъapple, apple apple 15., apple- fl apple. А, ИЗД-apple apple - ИЗД. А applefl, ъapple apple ъ- apple, SINE appleъ [1, 7, 8]., ъapple (О)-, applefl apple apple --. SINE, apple (О)-- ( tailless retroposons), ъ- apple ъ, -, apple fl ъapple appleapple- apple appleapple [9]. Дapple, apple- fl ъapple apple applefl apple apple, applefl ъ - -, apple,, apple apple SINE. Ч fl apple apple, applefl appleapple - fl Ж apple,, apple apple SINE (apple- apple, MIR [10]), ъapple - applefl, fl appleapple,, apple apple -- apple applefl apple. Оapple, fl, appleapple SINE apple fl apple- SINE, ъflfl fl appleapple. Ґъ apple, fl SINE ЗД apple, -ъ-ъapple - ЗД apple 12 flapple apple. Squamata, apple- : apple, apple, ъ (apple- flfl fl), ( - ) apple applefl (ъ). Ръapple- fl -, apple, apple- apple О1 О2, apple ъ apple (ИЗД-apple) - apple, apple, apple appleapple 1 2, ИЗД-apple SINE, fl apple. Й ъapple ЗД ъ - ъ apple apple, ЗД, (fl Iguania), (Boa constrictor Elaphe dione) ъapplefl ъ ъ (ъ). ЗД, fl apple. Squamata, ъapple- appleapple, ъ ъapple appleapple, - fl ИЗД. Вfl, apple fl ъapple apple- apple apple Squam-2. А ЗД, fl - ъ ъ apple ъapple, ИЗД Ala(CGC). Й ИЗД- apple apple apple ъ. Ч ъ ъ- apple apple - SINE ID, apple- ИЗД. Дapple, ИЗД- applefl fl - ъ ъ apple ИЗД, - ъapple ИЗД-apple, ЗД apple Squam-2. И ъapple apple -, apple ЗД fl apple К И appleapple О1 2. Кapple apple, - appleapple apple SINE, ъapple ЗД apple apple applefl,., flapple К И-apple,, -ъ- applefl ЗД ъ ъ (ъ- ). Ч apple appleъ - fl. Въapple ъfl, apple, ъ ъ, fl apple Squam-2 flapple: Boa constrictor apple apple ъ, Elaphe dione, apple, ъ apple- fl. А apple -, SINE flfl apple apple, fl - applefl, [11]. К flfl SINEs, -, appleappleapple apple appleapple apple apple apple.

4 ЗВАВЩ ЙЩЖЩГЙ АВ ЕЙКЩИРЕИВАОЗЗЛ КВА ВИВА 381 Иappleapple Squam-2 apple- ъapple К И Mammalia: Eutheria Mammalia: Marsupialia Ръapplefl К И О1-О2 1-2 Hominidae 1 с с Rodentia 2 с Macropodidae 3 Aves Strigidae 4 Falconidae 5 Passeridae 6 Amphibia: Anura Ranidae 7 + Squamata Testudines Crocodylia Chamaeleonidae 8 + с Agamidae Iguanidae Lacertidae Lacertidae Cordylidae Scincidae Varanidae Anguidae Teiidae с Helodermatidae Eublepharidae Gekkonidae Colubridae 21 с с с Boidae 22 с + + Testudinidae 23 Crocodylidae 24 Кapple. ЗД ъapple, appleapple О1 + О (. apple). + ъapple applefl apple К И; ъapple apple К И; с ъ ъapple ъfl apple К И. Е, ъ- ъ apple: 1, Homo sapiens; 2, Mus musculus; 3 apple apple, Dendrolagus bennettianus; 4 fl, Asio otus; 5, Falco tinnunculus; 6 appleъ, Passer domesticus; 7 applefl- fl fl, Rana temporaria; 8, Chamaeleo calyptratus; 9 fl flapple, Chlamidosaurus kingii; 10 ъfl, Iguana iguana; 11 flapple, Darevskia raddei/praticola; 12 - applefl flapple, Gallotia sp.; 13 fl, Cordylus giganteus; 14 fl, Tiliqua sp.; 15 apple apple, Varanus prasinus; 16 fl apple-, Anguis fragilis; 17, Tupinambis teguixin; 18 -, Heloderma suspectum; 19 fl ъapple, Eublepharis macularius; 20, Gekko gecko; 21 apple -, Elaphe dione; 22 ъ, Boa constrictor; 23 appleapplefl apple, Testudo graeca; 24 - apple, Crocodylus niloticus. Кapple, SINE (ИЗД-apple), Genbank apple- apple BLAST ъapple. Й ъ ИЗД fl SINE -,,, applefl ИЗД, ID apple [12], Vic-1 [13] Das1 [6, 14] ъapple (apple- ъ). Аapplefl, ИЗД apple- -- SINEs, apple apple appleapple. ъapple, ЗД apple applefl Squamata appleapple apple SINE Squam-2. В fl applefl apple, apple ИЗД Ala(CGC), -, ъ, apple appleapple, - fl appleapple apple apple apple. Е- apple apple appleapple ИЗД-apple ъ-,, -ъ apple- -, appleapple fl. Вapple ъapple apple apple SINE (Squam-1), apple. Пapple.П. А Е.Й. apple apple ъapple apple apple. Иъ apple И- ( ; ). ЙКЕЙВД Е ЩИО НИ 1. Ohshima K., Hamada M., Terai Y. et al The ends of trna-derived short interspersed repetitive elements are derived from the ends of long interspersed repetitive elements. Mol. Cell. Biol. 16, Okada N SINEs. Curr. Opin. Genet. Dev. 1, Schmid C.W Alu: structure, origin, evolution, significance and function of one-tenth of human DNA. Prog. Nucleic Acid Res. Mol. Biol. 53, Fantaccione S., Russo C., Palomba P. et al A new pair of CR1-like LINE and trna-derived SINE elements in Podarcis sicula genome. Gene. 339, Borodulina O.R., Kramerov D.A Wide distribution of short interspersed elements among eukaryotic genomes. FEBS Lett. 457, Borodulina O.R., Kramerov D.A PCR-based approach to SINE isolation: simple and complex SINEs. Gene. 349, Kajikawa M., Okada N LINEs mobilize SINEs in the eel through a shared sequence. Cell. 111,

5 382 Д apple. 8. Ohshima K., Okada N SINEs and LINEs: symbionts of eukaryotic genomes with a common tail. Cytogenet. Genome Res. 110, Schmitz J., Churakov G., Zischler H. et al A novel class of mammalian-specific tailless retropseudogenes. Genome Res. 14, Jurka J., Zietkiewicz E., Labuda D Ubiquitous mammalian-wide interspersed repeats (MIRs) are molecular fossils from the mesozoic era. Nucleic Acids Res. 23, Carroll R.L Vertebrate Paleontology and Evolution. N.Y.: W.H. Freeman and Company. 12. Kim J., Martignetti J.A., Shen M.R. et al Rodent BC1 RNA gene as a master gene for ID element amplification. Prc. Natl. Acad. Sci. USA. 91, Lin Z., Nomura O., Hayashi T. et al Characterization of a SINE species from vicuna and its distribution in animal species including the family Camelidae. Mamm. Genome. 12, Churakov G., Smit A.F., Brosius J. et al A novel abundant family of retroposed elements (DAS-SINEs) in the nine-banded armadillo (Dasypus novemcinctus). Mol. Biol. Evol. 22,

е ефе едееедебед ец ец ецеееде ебедец ецедефеце«ец ецедеце

е ефе едееедебед ец ец ецеееде ебедец ецедефеце«ец ецедеце едеге е е ецедедеце, 2009, 43, 5, 795806 ег 57721 LTR-appleappleapple - apple applefl apple, apple- appleapple е appleapple apple - LINE (long interspersed elements) е 3 7 apple apple LINE apple apple

More information



More information

Lecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr

Lecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr Introduction to Databases Shifra Ben-Dor Irit Orr Lecture Outline Introduction Data and Database types Database components Data Formats Sample databases How to text search databases What units of information

More information


FINDING RELATION BETWEEN AGING AND FINDING RELATION BETWEEN AGING AND TELOMERE BY APRIORI AND DECISION TREE Jieun Sung 1, Youngshin Joo, and Taeseon Yoon 1 Department of National Science, Hankuk Academy of Foreign Studies, Yong-In, Republic

More information

Non-genic evolution and selection in the human genome. or: Junk DNA. Gerton Lunter, Statistics, Bioinformatics group

Non-genic evolution and selection in the human genome. or: Junk DNA. Gerton Lunter, Statistics, Bioinformatics group Non-genic evolution and selection in the human genome or: Junk DNA Gerton Lunter, Statistics, Bioinformatics group Two puzzling observations About of our genome codes for protein. What is remaining for?

More information


BARCODING LIFE, ILLUSTRATED BARCODING LIFE, ILLUSTRATED Goals, Rationale, Results Barcoding is a standardized approach to identifying animals and plants by minimal sequences of DNA. 1. Why barcode animal and plant species? By harnessing

More information

The phylogeny of squamate reptiles (lizards, snakes, and amphisbaenians) inferred from nine nuclear protein-coding genes

The phylogeny of squamate reptiles (lizards, snakes, and amphisbaenians) inferred from nine nuclear protein-coding genes C. R. Biologies 328 (2005) 1000 1008 http://france.elsevier.com/direct/crass3/ Evolution / Évolution The phylogeny of squamate reptiles (lizards, snakes, and amphisbaenians) inferred from nine nuclear

More information

MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788

MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788 MATCH Communications in Mathematical and in Computer Chemistry MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788 ISSN 0340-6253 Three distances for rapid similarity analysis of DNA sequences Wei Chen,

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Station #1: Taxonomy

Station #1: Taxonomy Station #1: Taxonomy Examine the table showing the classification of four organisms. The answer the questions. Taxon Green Frog Mountain Lion Domestic Dog Human Kingdom Phylum Class Order Family Genus

More information

Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action

Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action Les Rencontres de L INRA Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action E Albina (CIRAD) / S Guyomard(Institut Pasteur) Guadeloupe The era

More information

CCR Biology - Chapter 10 Practice Test - Summer 2012

CCR Biology - Chapter 10 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 10 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What is the term for a feature

More information

Webserver: bioinfo.bio.wzw.tum.de Mail: w.mewes@weihenstephan.de

Webserver: bioinfo.bio.wzw.tum.de Mail: w.mewes@weihenstephan.de Webserver: bioinfo.bio.wzw.tum.de Mail: w.mewes@weihenstephan.de About me H. Werner Mewes, Lehrstuhl f. Bioinformatik, WZW C.V.: Studium der Chemie in Marburg Uni Heidelberg (Med. Fakultät, Bioenergetik)

More information

Profiling of non-coding RNA classes Gunter Meister

Profiling of non-coding RNA classes Gunter Meister Profiling of non-coding RNA classes Gunter Meister RNA Biology Regensburg University Universitätsstrasse 31 93053 Regensburg Overview Classes of non-coding RNAs Profiling strategies Validation Protein-RNA

More information

An introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle

An introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle An introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle Faculty of Science; Department of Marine Sciences The Swedish Royal

More information

Biological Sequence Data Formats

Biological Sequence Data Formats Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA

More information

Analytical Study of Hexapod mirnas using Phylogenetic Methods

Analytical Study of Hexapod mirnas using Phylogenetic Methods Analytical Study of Hexapod mirnas using Phylogenetic Methods A.K. Mishra and H.Chandrasekharan Unit of Simulation & Informatics, Indian Agricultural Research Institute, New Delhi, India akmishra@iari.res.in,

More information

The marine iguana (Amblyrhynchus cristatus)

The marine iguana (Amblyrhynchus cristatus) 07 alberts chap06 7/23/03 9:10 AM Page 84 6 Sodium and Potassium Secretion by Iguana Salt Glands ACCLIMATION OR ADAPTATION? Lisa C. Hazard The marine iguana (Amblyrhynchus cristatus) is well known for

More information

AP Biology Essential Knowledge Student Diagnostic

AP Biology Essential Knowledge Student Diagnostic AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in

More information

Biological Sciences Initiative. Human Genome

Biological Sciences Initiative. Human Genome Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.

More information

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript

More information

ттгт ци тг цсс пястсгс цсгс TELOS

ттгт ци тг цсс пястсгс цсгс TELOS пепистги ягтгр сг хети епистг тг епистггс упцист гисс пхг еусгс и диеияисгс ттгт ци тг цсс пястсгс цсгс TELOS цв цв applefi евfl г, ж 1994 пепистги ягтгр сг хети епистг тг епистггс упцист гисс пхг еусгс

More information

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

01 02 03 04 05 06 Haemophilus influenza 07 08 09 Proc. Natl. Acad. Sci. U.S.A. Proc. Acad. Natl. Sci. U.S.A. Nature Science Anal. Chem. Anal.Chem Nuc. Acids Res Anal. Chem Nature Science Haemophilus influenzae

More information

Human Genome and Human Genome Project. Louxin Zhang

Human Genome and Human Genome Project. Louxin Zhang Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular

More information

Experiment 2: DNA fingerprinting for microbial source tracking

Experiment 2: DNA fingerprinting for microbial source tracking Experiment 2: DNA fingerprinting for microbial source tracking Goal: To fingerprint strains of E. coli, and determine the source, as best as possible, for each of the strains. Introduction The Clean Water

More information

Chapter 2. Using and Understanding RepeatMasker. Sébastien Tempel. Abstract. 1. Introduction

Chapter 2. Using and Understanding RepeatMasker. Sébastien Tempel. Abstract. 1. Introduction Chapter 2 Using and Understanding RepeatMasker Sébastien Tempel Abstract RepeatMasker is a program that screens DNA sequences for interspersed repeats and low-complexity DNA sequences. In this chapter,

More information


THE GENBANK SEQUENCE DATABASE Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Second Edition Andreas D. Baxevanis, B.F. Francis Ouellette Copyright 2001 John Wiley & Sons, Inc. ISBNs: 0-471-38390-2 (Hardback);

More information

AP Biology Learning Objective Cards

AP Biology Learning Objective Cards 1.1 The student is able to convert a data set from a table of numbers that reflect a change in the genetic makeup of a population over time and to apply mathematical methods and conceptual understandings

More information

Genetomic Promototypes

Genetomic Promototypes Genetomic Promototypes Mirkó Palla and Dana Pe er Department of Mechanical Engineering Clarkson University Potsdam, New York and Department of Genetics Harvard Medical School 77 Avenue Louis Pasteur Boston,

More information

Integration of data management and analysis for genome research

Integration of data management and analysis for genome research Integration of data management and analysis for genome research Volker Brendel Deparment of Zoology & Genetics and Department of Statistics Iowa State University 2112 Molecular Biology Building Ames, Iowa

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Evidence for evolution factsheet

Evidence for evolution factsheet The theory of evolution by natural selection is supported by a great deal of evidence. Fossils Fossils are formed when organisms become buried in sediments, causing little decomposition of the organism.

More information

Gene Switches A Model

Gene Switches A Model Gene Switches A Model Abstract Conceptually, how genetic switches function and their role in the process of evolution, can be difficult for students to visualize. Gene Switches A Model attempts to make

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

Answer Key. Vocabulary Practice

Answer Key. Vocabulary Practice Answer Key Vocabulary Practice Copyright by McDougal Littell, a division of Houghton Mifflin Company A. Categorize Words 1. organism, L; cell, L; species, L; transgenic, B; biotechnology, T; molecular

More information

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary

More information

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S. A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT

More information

mirnapath: a database of mirnas, target genes and metabolic pathways

mirnapath: a database of mirnas, target genes and metabolic pathways mirnapath: a database of mirnas, target genes and metabolic pathways A.O. Chiromatzo 1, T.Y.K. Oliveira 1, G. Pereira 1, A.Y. Costa 2, C.A.E. Montesco 3, D.E. Gras 1, F. Yosetake 4, J.B. Vilar 5, M. Cervato

More information

mirnaselect pep-mir Cloning and Expression Vector

mirnaselect pep-mir Cloning and Expression Vector Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect

More information

In silico comparison of nucleotide composition and codon usage bias between the essential and non- essential genes of Staphylococcus aureus NCTC 8325

In silico comparison of nucleotide composition and codon usage bias between the essential and non- essential genes of Staphylococcus aureus NCTC 8325 International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 3 Number 12 (2014) pp. 8-15 http://www.ijcmas.com Original Research Article In silico comparison of nucleotide

More information

The world of non-coding RNA. Espen Enerly

The world of non-coding RNA. Espen Enerly The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often

More information

Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations

Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations AlCoB 2014 First International Conference on Algorithms for Computational Biology Thiago da Silva Arruda Institute

More information

Chapter 2 Phosphorus in the Organic Life: Cells, Tissues, Organisms

Chapter 2 Phosphorus in the Organic Life: Cells, Tissues, Organisms Chapter 2 Phosphorus in the Organic Life: Cells, Tissues, Organisms As already mentioned (see Chap. 1 ), in the living cell phosphorus plays a decisive role in three different essential structures: In

More information


SUGAR BEET (Beta vulgaris L.) PROMOTERS FOR DIRECTED TISSUE- SPECIFIC ROOT TRANSCRIPTION SUGAR BEET (Beta vulgaris L.) PROMOTERS FOR DIRECTED TISSUE- SPECIFIC ROOT TRANSCRIPTION Senthilkumar Padmanaban, Haiyan Li, David P. Puthoff and Ann C. Smigocki USDA-ARS Molecular Plant Pathology Laboratory,

More information



More information

Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005

Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 26.03.2012 to 25.03.2017

More information

DnaSP, DNA polymorphism analyses by the coalescent and other methods.

DnaSP, DNA polymorphism analyses by the coalescent and other methods. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,

More information

How/Why to Design PCR Primers

How/Why to Design PCR Primers 6/22/2014 How/Why to Design PCR Primers B3 Summer Science Camp at Olympic High School Dr. Jennifer Weller How to Design PCR Primers When we design the chloroplast primers what are we trying to do? One

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Molecular Cell Biology WS2011

Molecular Cell Biology WS2011 Molecular Cell Biology WS2011 Lecturer: Dr. Andreas Prokesch, Inst. for Genomics and Bioinformatics, TUG Purpose of this series of lectures: to offer you the basic knowledge required to know and understand

More information

Custom Antibody Services

Custom Antibody Services prosci-inc.com Custom Antibody Services High Performance Antibodies and More Broad Antibody Catalog Extensive Antibody Services CUSTOM ANTIBODY SERVICES Established in 1998, ProSci Incorporated is a leading

More information

Chapter 14. Modeling Experimental Design for Proteomics. Jan Eriksson and David Fenyö. Abstract. 1. Introduction

Chapter 14. Modeling Experimental Design for Proteomics. Jan Eriksson and David Fenyö. Abstract. 1. Introduction Chapter Modeling Experimental Design for Proteomics Jan Eriksson and David Fenyö Abstract The complexity of proteomes makes good experimental design essential for their successful investigation. Here,

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information


HOT SPOTS TO ENHACE LARGE VERTEBRATE CONSERVATION IN MEXICO HOT SPOTS TO ENHACE LARGE VERTEBRATE CONSERVATION IN MEXICO Rodríguez-Soto, Clarita 1 ; Octavio Monroy-Vilchis 1 ; Pricila Lemes 2 ; Alejandro Velázquez 3 and Rafael Loyola 4 1 -UAEMex, Toluca, México.

More information


CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the

More information

The Making of the Fittest: Evolving Switches, Evolving Bodies

The Making of the Fittest: Evolving Switches, Evolving Bodies OVERVIEW MODELING THE REGULATORY SWITCHES OF THE PITX1 GENE IN STICKLEBACK FISH This hands-on activity supports the short film, The Making of the Fittest:, and aims to help students understand eukaryotic

More information

Accelerated evolution of conserved noncoding sequences in the human genome

Accelerated evolution of conserved noncoding sequences in the human genome Accelerated evolution of conserved noncoding sequences in the human genome Shyam Prabhakar 1,2*, James P. Noonan 1,2*, Svante Pääbo 3 and Edward M. Rubin 1,2+ 1. US DOE Joint Genome Institute, Walnut Creek,

More information

The human genome has 49 cytochrome c pseudogenes, including a relic of a primordial gene that still functions in mouse

The human genome has 49 cytochrome c pseudogenes, including a relic of a primordial gene that still functions in mouse Gene 312 (2003) 61 72 www.elsevier.com/locate/gene The human genome has 49 cytochrome c pseudogenes, including a relic of a primordial gene that still functions in mouse Zhaolei Zhang, Mark Gerstein* Department

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/312/5781/1762/dc1 Supporting Online Material for Silk Genes Support the Single Origin of Orb Webs Jessica E. Garb,* Teresa DiMauro, Victoria Vo, Cheryl Y. Hayashi *To

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011 Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear

More information


MAKING AN EVOLUTIONARY TREE Student manual MAKING AN EVOLUTIONARY TREE THEORY The relationship between different species can be derived from different information sources. The connection between species may turn out by similarities

More information

Protein Sequence Analysis - Overview -

Protein Sequence Analysis - Overview - Protein Sequence Analysis - Overview - UDEL Workshop Raja Mazumder Research Associate Professor, Department of Biochemistry and Molecular Biology Georgetown University Medical Center Topics Why do protein

More information

Participated in Career Internship Program of Pittsford Central School, Pittsford, NY and served as External Advisor.

Participated in Career Internship Program of Pittsford Central School, Pittsford, NY and served as External Advisor. BISWADIP DAS, Ph.D. JADAVPUR UNIVERSITY, DEPARTMENT OF LIFE SCIENCE AND BIOTECHNOLOGY, 188 RAJA S.C. MULLICK ROAD, KOLKATA - 700 032, INDIA TEL: 919748908607, FAX: 91-33-2414-6414, E-MAIL:biswadip_das@yahoo.com

More information

Arabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham

Arabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham Arabidopsis A Practical Approach Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham OXPORD UNIVERSITY PRESS List of Contributors Abbreviations xv xvu

More information


REPTILES: THE BEAUTIFUL AND THE DEADLY - ACTIVITY GUIDE Dear Educator: Thank you for requesting our REPTILES: The Beautiful and the Deadly Activity Guide. I hope you and your students find it both fun and informative. In this kit you ll find everything you

More information

4. Why are common names not good to use when classifying organisms? Give an example.

4. Why are common names not good to use when classifying organisms? Give an example. 1. Define taxonomy. Classification of organisms 2. Who was first to classify organisms? Aristotle 3. Explain Aristotle s taxonomy of organisms. Patterns of nature: looked like 4. Why are common names not

More information

Human-Mouse Synteny in Functional Genomics Experiment

Human-Mouse Synteny in Functional Genomics Experiment Human-Mouse Synteny in Functional Genomics Experiment Ksenia Krasheninnikova University of the Russian Academy of Sciences, JetBrains krasheninnikova@gmail.com September 18, 2012 Ksenia Krasheninnikova

More information

A. Definition of biology - Biology is the study of life.

A. Definition of biology - Biology is the study of life. Introduction to Biology and Chemistry Outline I. Introduction to biology A. Definition of biology - Biology is the study of life. B. Characteristics of Life 1. Form and size are characteristic. e.g. A

More information

Unit 1 - Fundamental Biology Skills and Knowledge

Unit 1 - Fundamental Biology Skills and Knowledge PREP TM AP* Biology Prep Course Syllabus Foundational Topics Review 10 units that cover fundamental biology topics typically covered in a general biology course. This content is perfect to use as a summer

More information

Expectations from structural genomics

Expectations from structural genomics Protein Science (2000), 9: 197-200. Cambridge University Press. Printed in the USA. Copyright 2000 The Protein Society Expectations from structural genomics STEVEN E. BRENNER 1 and MICHAEL LEVITT 1 1 Department

More information

Bi-8: Introduction to Molecular Biology by Prof. Angela Stathopoulos

Bi-8: Introduction to Molecular Biology by Prof. Angela Stathopoulos Division of Biology, California Institute of Technology Bi-8: Introduction to Molecular Biology by Prof. Angela Stathopoulos January-March, 2009 Tuesdays and Thursdays, from 1-2 pm, Kerckhoff 119 Recitation

More information


PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,

More information

3.1 Types of Living Things

3.1 Types of Living Things CHAPTER 3 CLASSIFYING LIVING THINGS 3.1 Types of Living Things Look around you. What types of living things do you see? You probably see plants and animals. What would you see if you could shrink down

More information

Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR

Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR Overview Genomic DNA (gdna) and plasmids containing cloned target sequences are commonly used as standards

More information


Worksheet - COMPARATIVE MAPPING 1 Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that

More information

An Investigation of Codon Usage Bias Including Visualization and Quantification in Organisms Exhibiting Multiple Biases

An Investigation of Codon Usage Bias Including Visualization and Quantification in Organisms Exhibiting Multiple Biases An Investigation of Codon Usage Bias Including Visualization and Quantification in Organisms Exhibiting Multiple Biases Douglas W. Raiford, Travis E. Doom, Dan E. Krane, and Michael L. Raymer Abstract

More information

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory.

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory. BIOTECHNOLOGY Levels: 11-12 Units of Credit: 1.0 CIP Code: 51.1201 Prerequisite: Biology or Chemistry Skill Certificates: #708 COURSE DESCRIPTION is an exploratory course designed to create an awareness

More information

Genomes and SNPs in Malaria and Sickle Cell Anemia

Genomes and SNPs in Malaria and Sickle Cell Anemia Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing

More information

A Tutorial in Genetic Sequence Classification Tools and Techniques

A Tutorial in Genetic Sequence Classification Tools and Techniques A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University jakemdrew@gmail.com www.jakemdrew.com Sequence Characters IUPAC nucleotide

More information

Level 3 Biology, 2012

Level 3 Biology, 2012 90719 907190 3SUPERVISOR S Level 3 Biology, 2012 90719 Describe trends in human evolution 2.00 pm Tuesday 13 November 2012 Credits: Three Check that the National Student Number (NSN) on your admission

More information

IsoBase: a database of functionally related proteins across PPI networks

IsoBase: a database of functionally related proteins across PPI networks D295 D300 doi:10.1093/nar/gkq1234 IsoBase: a database of functionally related proteins across PPI networks Daniel Park 1,2, Rohit Singh 1, Michael Baym 1,3,4, Chung-Shou Liao 5 and Bonnie Berger 1,4, *

More information

Professors: The topics in this course are divided into four sections:

Professors: The topics in this course are divided into four sections: Professors: Biochemistry, Cell & Molecular Biology II Course Description, Learning Objectives, and Grading Policy Note: This is the second in a series of three integrated courses in biochemistry, cell

More information

(ii) They are smaller than bacteria, and this can pass through bacteriological filter.

(ii) They are smaller than bacteria, and this can pass through bacteriological filter. Viruses Definition: Obligate intracellular parasite composed of: Nucleic acid - either DNA or RNA & Protein coat. Characteristics of viruses Viruses are the most primitive cellular and non-cytoplasmic

More information

Patent issues in Industrial Biotech:

Patent issues in Industrial Biotech: Patent issues in Industrial Biotech: Nucleic Acids, Life Forms & Natural Products Konrad Sechley PhD, Vancouver, Canada 18 April, 2016 OVERVIEW Gene patenting Life Forms & Natural Products Conclusions

More information

Human Genome Organization: An Update. Genome Organization: An Update

Human Genome Organization: An Update. Genome Organization: An Update Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion

More information

SARS SARS. Phone : ; Fax :

SARS SARS. Phone : ; Fax : A number of viruses isolated from bats have been believed to be causative agents of the emerging infectious diseases in humans. This idea is supported by the facts that SARS coronavirus (SARS-CoV)-like

More information


GENE REGULATION. Teacher Packet AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures

More information

Keystone Biology Exam Information: Module A: Cell and Cell Processes

Keystone Biology Exam Information: Module A: Cell and Cell Processes Keystone Biology Exam Information: Module A: Cell and Cell Processes Basic Biological Principles- Day 1 Describe the characteristics of life shared by prokaryotic and eukaryotic organisms. Compare cellular

More information

Title : Parallel DNA Synthesis : Two PCR product from one DNA template

Title : Parallel DNA Synthesis : Two PCR product from one DNA template Title : Parallel DNA Synthesis : Two PCR product from one DNA template Bhardwaj Vikash 1 and Sharma Kulbhushan 2 1 Email: vikashbhardwaj@ gmail.com 1 Current address: Government College Sector 14 Gurgaon,

More information

AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data

AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data Csaba Kerepesi, Dániel Bánky, Vince Grolmusz: AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data http://pitgroup.org/amphoranet/ PIT Bioinformatics Group, Department of Computer

More information

Nucleic Acid Amplification Life Science Dashboard Series 3

Nucleic Acid Amplification Life Science Dashboard Series 3 Brochure More information from http://www.researchandmarkets.com/reports/1937244/ Nucleic Acid Amplification Life Science Dashboard Series 3 Description: Nucleic acid amplification is one of the most commonly

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

DNA as a Mass-Storage Device: 1

DNA as a Mass-Storage Device: 1 DNA as a Mass-Storage Device Robert J. Robbins Johns Hopkins University rrobbins@gdb.org DNA as a Mass-Storage Device: 1 Goals of the Genome Project Sequence the Genome equivalent to obtaining an image

More information

Activity 7.21 Transcription factors

Activity 7.21 Transcription factors Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation

More information

Human Mendelian Disorders. Genetic Technology. What is Genetics? Genes are DNA 9/3/2008. Multifactorial Disorders

Human Mendelian Disorders. Genetic Technology. What is Genetics? Genes are DNA 9/3/2008. Multifactorial Disorders Human genetics: Why? Human Genetics Introduction Determine genotypic basis of variant phenotypes to facilitate: Understanding biological basis of human genetic diversity Prenatal diagnosis Predictive testing

More information

Olfactory Receptor Database: a metadata-driven automated population from sources of gene and protein sequences

Olfactory Receptor Database: a metadata-driven automated population from sources of gene and protein sequences 354 360 Nucleic Acids Research, 2002, Vol. 30, No. 1 2002 Oxford University Press Olfactory Receptor Database: a metadata-driven automated population from sources of gene and protein sequences Chiquito

More information