ЗВАВЩ ЙЩЖЩГЙ АВ ЕЙКЩИРЕИВАОЗЗЛ КВА ВИВА Е РЩЗВЖО ҐЩХНГҐО Л ИЩК ЕЕГ

Size: px
Start display at page:

Download "ЗВАВЩ ЙЩЖЩГЙ АВ ЕЙКЩИРЕИВАОЗЗЛ КВА ВИВА Е РЩЗВЖО ҐЩХНГҐО Л ИЩК ЕЕГ"

Transcription

1 ЖВЩДНБИЗОБ ПЕВВРЕБ, 2006, 40, 2, Н Д Дapple ъfl ЗВАВЩ ЙЩЖЩГЙ АВ ЕЙКЩИРЕИВАОЗЗЛ КВА ВИВА Е РЩЗВЖО ҐЩХНГҐО Л ИЩК ЕЕГ Й. О. Д, В. И. Пapple, А. А. Рapple*,. О. Дappleapple Е flapple ъ И, Ж, К apple Д : SINE, appleapple, apple. A NEW FAMILY OF INTERSPERSED REPEATS FROM SQUAMATE REPTILES, by S. A. Kosushkin, O. R. Borodulina, V. V. Grechko*, D. A. Kramerov (Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, Russia, * * appleapple apple SINE (Short Interspersed Elements) fl. Ч ъ - appleъ, appleapple apple ъ - appleapple appleapple SINEs. З 5'- - fl, apple, apple- -ъ ИЗД, apple, apple ъ - apple apple LINE [1]. З - SINE fl ъ apple applefl - apple, ъ (О)--, apple ъ,, fl fl ъapple appleapple apple- fl ЗД- [2, 3]. apple SINEs apple (flapple, apple. Squamata) -. В apple flapple Podarcis sicula (. Lacertidae), 5'-ъ apple ИЗД, -apple c LINE-ъ - [4]. В apple apple - fl fl apple apple- appleappleapple ЗД apple apple. * Ч. : А appleъ - appleapple apple SINE flapple apple Darevskia (Squamat: Lacertidae) Darevskia praticola D. raddei, applefl - fl apple apple apple applefl apple (apple). Кapple ъapple- apple apple К И-apple - ЗД D. raddei ( apple [5, 6]). А appleapple -, apple, apple- A-ъ appleapple fl ИЗД-apple III (О-К И). Йapple apple fl fl apple ЗД, apple - SINE, fl ъ A ( > apple, 5'-TRGCTCAGTGG-). З apple- appleapple ъapple appleapple (ъ- < apple, 5'-GCTCTCYAG- GRTTTCA-), apple К И apple, apple- 5'- SINE. Дapple, appleapple apple apple - D. praticola -. Ч appleapple О1 2 apple apple SINE (apple ъ). О fl (apple ), fl appleapple, appleapple fl К SINE Squam-2 flapple. Lacertidae (Dra Darevskia raddei, Dpr Darevskia praticola). Аapple fl К И appleapple ъ A (ъ >), - apple ъapple appleapple (<). З appleapple - applefl apple apple. trna-ala ИЗД Оla(CGC) - (fl ъapple apple apple ). ъ Аapple SINE, ИЗД Оla(CGC) : Squam-2 flapple, Das-1 ъapple [6, 14], Vic-1 [13] ID-Rno apple [12]. А apple- appleapple О1, О2, 1 2. Йfl appleapple Squam-2 fl apple apple apple -, ъ appleapple ИЗД-apple III (ъ A ъ B). 378

2 ЗВАВЩ ЙЩЖЩГЙ АВ ЕЙКЩИРЕИВАОЗЗЛ КВА ВИВА ъ 5' П О П А ' 5' 5' appleapple О1 appleapple О2 appleapple T1 appleapple 2

3 380 Д apple. SINE. 5'- ъ - ИЗД Оla(CGC) - (apple ), apple applefl - apple appleapple fl ИЗД-apple III ъ A B. apple ИЗД 100.., fl apple - applefl. ИЗД-apple apple (85..) fl ъ apple-, apple apple fl , apple ъ- ИЗД. apple, ъ - appleъ. apple - apple. ъapple, apple apple 15., apple- fl apple. А, ИЗД-apple apple - ИЗД. А applefl, ъapple apple ъ- apple, SINE appleъ [1, 7, 8]., ъapple (О)-, applefl apple apple --. SINE, apple (О)-- ( tailless retroposons), ъ- apple ъ, -, apple fl ъapple appleapple- apple appleapple [9]. Дapple, apple- fl ъapple apple applefl apple apple, applefl ъ - -, apple,, apple apple SINE. Ч fl apple apple, applefl appleapple - fl Ж apple,, apple apple SINE (apple- apple, MIR [10]), ъapple - applefl, fl appleapple,, apple apple -- apple applefl apple. Оapple, fl, appleapple SINE apple fl apple- SINE, ъflfl fl appleapple. Ґъ apple, fl SINE ЗД apple, -ъ-ъapple - ЗД apple 12 flapple apple. Squamata, apple- : apple, apple, ъ (apple- flfl fl), ( - ) apple applefl (ъ). Ръapple- fl -, apple, apple- apple О1 О2, apple ъ apple (ИЗД-apple) - apple, apple, apple appleapple 1 2, ИЗД-apple SINE, fl apple. Й ъapple ЗД ъ - ъ apple apple, ЗД, (fl Iguania), (Boa constrictor Elaphe dione) ъapplefl ъ ъ (ъ). ЗД, fl apple. Squamata, ъapple- appleapple, ъ ъapple appleapple, - fl ИЗД. Вfl, apple fl ъapple apple- apple apple Squam-2. А ЗД, fl - ъ ъ apple ъapple, ИЗД Ala(CGC). Й ИЗД- apple apple apple ъ. Ч ъ ъ- apple apple - SINE ID, apple- ИЗД. Дapple, ИЗД- applefl fl - ъ ъ apple ИЗД, - ъapple ИЗД-apple, ЗД apple Squam-2. И ъapple apple -, apple ЗД fl apple К И appleapple О1 2. Кapple apple, - appleapple apple SINE, ъapple ЗД apple apple applefl,., flapple К И-apple,, -ъ- applefl ЗД ъ ъ (ъ- ). Ч apple appleъ - fl. Въapple ъfl, apple, ъ ъ, fl apple Squam-2 flapple: Boa constrictor apple apple ъ, Elaphe dione, apple, ъ apple- fl. А apple -, SINE flfl apple apple, fl - applefl, [11]. К flfl SINEs, -, appleappleapple apple appleapple apple apple apple.

4 ЗВАВЩ ЙЩЖЩГЙ АВ ЕЙКЩИРЕИВАОЗЗЛ КВА ВИВА 381 Иappleapple Squam-2 apple- ъapple К И Mammalia: Eutheria Mammalia: Marsupialia Ръapplefl К И О1-О2 1-2 Hominidae 1 с с Rodentia 2 с Macropodidae 3 Aves Strigidae 4 Falconidae 5 Passeridae 6 Amphibia: Anura Ranidae 7 + Squamata Testudines Crocodylia Chamaeleonidae 8 + с Agamidae Iguanidae Lacertidae Lacertidae Cordylidae Scincidae Varanidae Anguidae Teiidae с Helodermatidae Eublepharidae Gekkonidae Colubridae 21 с с с Boidae 22 с + + Testudinidae 23 Crocodylidae 24 Кapple. ЗД ъapple, appleapple О1 + О (. apple). + ъapple applefl apple К И; ъapple apple К И; с ъ ъapple ъfl apple К И. Е, ъ- ъ apple: 1, Homo sapiens; 2, Mus musculus; 3 apple apple, Dendrolagus bennettianus; 4 fl, Asio otus; 5, Falco tinnunculus; 6 appleъ, Passer domesticus; 7 applefl- fl fl, Rana temporaria; 8, Chamaeleo calyptratus; 9 fl flapple, Chlamidosaurus kingii; 10 ъfl, Iguana iguana; 11 flapple, Darevskia raddei/praticola; 12 - applefl flapple, Gallotia sp.; 13 fl, Cordylus giganteus; 14 fl, Tiliqua sp.; 15 apple apple, Varanus prasinus; 16 fl apple-, Anguis fragilis; 17, Tupinambis teguixin; 18 -, Heloderma suspectum; 19 fl ъapple, Eublepharis macularius; 20, Gekko gecko; 21 apple -, Elaphe dione; 22 ъ, Boa constrictor; 23 appleapplefl apple, Testudo graeca; 24 - apple, Crocodylus niloticus. Кapple, SINE (ИЗД-apple), Genbank apple- apple BLAST ъapple. Й ъ ИЗД fl SINE -,,, applefl ИЗД, ID apple [12], Vic-1 [13] Das1 [6, 14] ъapple (apple- ъ). Аapplefl, ИЗД apple- -- SINEs, apple apple appleapple. ъapple, ЗД apple applefl Squamata appleapple apple SINE Squam-2. В fl applefl apple, apple ИЗД Ala(CGC), -, ъ, apple appleapple, - fl appleapple apple apple apple. Е- apple apple appleapple ИЗД-apple ъ-,, -ъ apple- -, appleapple fl. Вapple ъapple apple apple SINE (Squam-1), apple. Пapple.П. А Е.Й. apple apple ъapple apple apple. Иъ apple И- ( ; ). ЙКЕЙВД Е ЩИО НИ 1. Ohshima K., Hamada M., Terai Y. et al The ends of trna-derived short interspersed repetitive elements are derived from the ends of long interspersed repetitive elements. Mol. Cell. Biol. 16, Okada N SINEs. Curr. Opin. Genet. Dev. 1, Schmid C.W Alu: structure, origin, evolution, significance and function of one-tenth of human DNA. Prog. Nucleic Acid Res. Mol. Biol. 53, Fantaccione S., Russo C., Palomba P. et al A new pair of CR1-like LINE and trna-derived SINE elements in Podarcis sicula genome. Gene. 339, Borodulina O.R., Kramerov D.A Wide distribution of short interspersed elements among eukaryotic genomes. FEBS Lett. 457, Borodulina O.R., Kramerov D.A PCR-based approach to SINE isolation: simple and complex SINEs. Gene. 349, Kajikawa M., Okada N LINEs mobilize SINEs in the eel through a shared sequence. Cell. 111,

5 382 Д apple. 8. Ohshima K., Okada N SINEs and LINEs: symbionts of eukaryotic genomes with a common tail. Cytogenet. Genome Res. 110, Schmitz J., Churakov G., Zischler H. et al A novel class of mammalian-specific tailless retropseudogenes. Genome Res. 14, Jurka J., Zietkiewicz E., Labuda D Ubiquitous mammalian-wide interspersed repeats (MIRs) are molecular fossils from the mesozoic era. Nucleic Acids Res. 23, Carroll R.L Vertebrate Paleontology and Evolution. N.Y.: W.H. Freeman and Company. 12. Kim J., Martignetti J.A., Shen M.R. et al Rodent BC1 RNA gene as a master gene for ID element amplification. Prc. Natl. Acad. Sci. USA. 91, Lin Z., Nomura O., Hayashi T. et al Characterization of a SINE species from vicuna and its distribution in animal species including the family Camelidae. Mamm. Genome. 12, Churakov G., Smit A.F., Brosius J. et al A novel abundant family of retroposed elements (DAS-SINEs) in the nine-banded armadillo (Dasypus novemcinctus). Mol. Biol. Evol. 22,

ИО ЖЩИЗОБ Е АВ ИОЙ ЗОБ Й ИНД НИО КВКНБ ЕГ ЧКЕМЕ ЗВРВ ЕХОГЗЕДО HYPOGYMNIA PHYSODES (L.) NYL. А НЙВАЕБЛ О ЖВЙМЩИЗВРВ ОРИБ ЗЩЗЕБ

ИО ЖЩИЗОБ Е АВ ИОЙ ЗОБ Й ИНД НИО КВКНБ ЕГ ЧКЕМЕ ЗВРВ ЕХОГЗЕДО HYPOGYMNIA PHYSODES (L.) NYL. А НЙВАЕБЛ О ЖВЙМЩИЗВРВ ОРИБ ЗЩЗЕБ ЧДВВРЕБ, 1999, 2,. 130137 Н Д 574.3+504.054+582.29 ИО ЖЩИЗОБ Е АВ ИОЙ ЗОБ Й ИНД НИО КВКНБ ЕГ ЧКЕМЕ ЗВРВ ЕХОГЗЕДО HYPOGYMNIA PHYSODES (L.) NYL. А НЙВАЕБЛ О ЖВЙМЩИЗВРВ ОРИБ ЗЩЗЕБ 1999. Е. З. Ж, Щ.. Аappleъ

More information

2007. Ж. А., А.. З, Ж. Е. Й, З. О. Л Йapple М. К.З. ъ ИОЗ

2007. Ж. А., А.. З, Ж. Е. Й, З. О. Л Йapple М. К.З. ъ ИОЗ ЩВИЩ ЕҐЩЙДЕЩ ВЙЗВА ЛЕЖЕҐЩЙДВГ ЩЛЗВВРЕЕ, 007, 41,,. 17618 Н Д 66.011:66.069.83 Рappleapple apple apple apple applefl appleapple apple apple, applefl fl 007. Ж. А., А.. З, Ж. Е. Й, З. О. Л Йapple М. К.З.

More information

apple 0 9fl К 0 4

apple 0 9fl К 0 4 1 3 0 5 0 1 391/395 0 3 0 3 0 1 63.5(2) P24 0 5 0 0apple 0 9fl 0 7 0 6 0 0 0 7 6 5 6 0 0 0 6 0 6 5 1971 6 7 0 7 К 0 4 0 0 К 6 0 0 1 0 3 0 9 0 7 0 0 0 0 6 0fl 0 1 0 7 0 2 0 2 0 0 6 7 0 9fl: 0 5. 0 2. 0

More information

ИОЗЙРЩЗЩИО ЕВЗЗОБ КЩИЩ ОҐО ИО ЕО ЕВЗЗВ-ЕЗ Н ЕИВАОЗЗВГ ЗЩЙ ОПЕ ЗВЙ Е РЩЗВЖО

ИОЗЙРЩЗЩИО ЕВЗЗОБ КЩИЩ ОҐО ИО ЕО ЕВЗЗВ-ЕЗ Н ЕИВАОЗЗВГ ЗЩЙ ОПЕ ЗВЙ Е РЩЗВЖО ИО ЕО ЕВЗЗОБ ПЕВВРЕБ. ИО ЕВЧДВВРЕБ 2006 46 4. 441446 Н Д [57:539.1.04].001:575.224.23 apple apple apple [3]. О fl apple flfl apple [6] appleapple [7] apple fl ЗД [8] (BrDU) ЗД [9]. Е apple applefl fl appleapple.

More information

е ефе едееедебед ец ец ецеееде ебедец ецедефеце«ец ецедеце

е ефе едееедебед ец ец ецеееде ебедец ецедефеце«ец ецедеце едеге е е ецедедеце, 2009, 43, 5, 795806 ег 57721 LTR-appleappleapple - apple applefl apple, apple- appleapple е appleapple apple - LINE (long interspersed elements) е 3 7 apple apple LINE apple apple

More information

НЙВАЕБ Е КВЙЩ Й АЕБ ОАОИЕГ ЙН ВА А ДЩИҐЩЗЙДВЖ КИВЕАЩ АВ АИЩЖБ Х ВИЖО 11 ЗВБПИБ 2007.

НЙВАЕБ Е КВЙЩ Й АЕБ ОАОИЕГ ЙН ВА А ДЩИҐЩЗЙДВЖ КИВЕАЩ АВ АИЩЖБ Х ВИЖО 11 ЗВБПИБ 2007. АЩЙ ЗЕД ЦЪЗВРВ ЗОНҐЗВРВ ЩЗ ИО ИОЗ 4, 3, 2008, apple 5463 ЗОНДЕ В ЩЖЩ Н Д 62839417; 6656(28224736)(26254)(2655) НЙВАЕБ Е КВЙЩ Й АЕБ ОАОИЕГ ЙН ВА А ДЩИҐЩЗЙДВЖ КИВЕАЩ АВ АИЩЖБ Х ВИЖО 11 ЗВБПИБ 2007 2008 О

More information

є і 0 5, і 0 5, і і.

є і 0 5, і 0 5, і і. 1 3 0 5. 0 2. 0 2 є 0 4 0 1 і 0 5, 0 5. 0 4. 0 0 0 5 0 5 0 0 0 0 0 4 0 1 і 0 5, 0 2. 0 5. 0 1 і 0 0 0 0 0 4 0 1 і. 0 7 0 0 0 2 0 2 0 4 0 5 0 1 є 0 0 0 0 0 0 0 2 0 0 0 4 0 2 0 5 0 5 і 0 9 0 4 0 2 0 7 і

More information

Lecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr

Lecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr Introduction to Databases Shifra Ben-Dor Irit Orr Lecture Outline Introduction Data and Database types Database components Data Formats Sample databases How to text search databases What units of information

More information

Analysis of DNA of Higher Primates Using Inter-SINE PCR

Analysis of DNA of Higher Primates Using Inter-SINE PCR ISSN 1022-7954, Russian Journal of Genetics, 2008, Vol. 44, No. 3, pp. 266 272. Pleiades Publishing, Inc., 2008. Original Russian Text N.L. Ryabinina, A.A. Bannikova, V.A. Sheremet eva, M.G. Chikobava,

More information

ЗВАГ ЙКВЙВП ДВЗ ЩЗ ИЕИВАОЗЕБ Е Е АЩҐЩЗЕБ ВВ О Е РИОМЕ ВАЛ ИН НИРЩЗЩАЙДВРВ ЖЩЙ ВИВЪ ЩЗЕБ, КИЕЖВИ Щ

ЗВАГ ЙКВЙВП ДВЗ ЩЗ ИЕИВАОЗЕБ Е Е АЩҐЩЗЕБ ВВ О Е РИОМЕ ВАЛ ИН НИРЩЗЩАЙДВРВ ЖЩЙ ВИВЪ ЩЗЕБ, КИЕЖВИ Щ ВДО ОДО ЩЖЕЕ ЗОНД, 2008, 423, 1,. 110113 Н Д 553.411+546.59 РЩВЛЕЖЕБ ЗВАГ ЙКВЙВП ДВЗ ЩЗ ИЕИВАОЗЕБ Е Е АЩҐЩЗЕБ ВВ О Е РИОМЕ ВАЛ ИН НИРЩЗЩАЙДВРВ ЖЩЙ ВИВЪ ЩЗЕБ, КИЕЖВИ Щ 2008. О О. Е. Л, Ж. О. Ж,. К. К, А.

More information

FINDING RELATION BETWEEN AGING AND

FINDING RELATION BETWEEN AGING AND FINDING RELATION BETWEEN AGING AND TELOMERE BY APRIORI AND DECISION TREE Jieun Sung 1, Youngshin Joo, and Taeseon Yoon 1 Department of National Science, Hankuk Academy of Foreign Studies, Yong-In, Republic

More information

Human Genome Complexity, Viruses & Genetic Variability

Human Genome Complexity, Viruses & Genetic Variability Human Genome Complexity, Viruses & Genetic Variability (Learning Objectives) Learn the types of DNA sequences present in the Human Genome other than genes coding for functional proteins. Review what you

More information

Non-genic evolution and selection in the human genome. or: Junk DNA. Gerton Lunter, Statistics, Bioinformatics group

Non-genic evolution and selection in the human genome. or: Junk DNA. Gerton Lunter, Statistics, Bioinformatics group Non-genic evolution and selection in the human genome or: Junk DNA Gerton Lunter, Statistics, Bioinformatics group Two puzzling observations About of our genome codes for protein. What is remaining for?

More information

BARCODING LIFE, ILLUSTRATED

BARCODING LIFE, ILLUSTRATED BARCODING LIFE, ILLUSTRATED Goals, Rationale, Results Barcoding is a standardized approach to identifying animals and plants by minimal sequences of DNA. 1. Why barcode animal and plant species? By harnessing

More information

MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788

MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788 MATCH Communications in Mathematical and in Computer Chemistry MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788 ISSN 0340-6253 Three distances for rapid similarity analysis of DNA sequences Wei Chen,

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Station #1: Taxonomy

Station #1: Taxonomy Station #1: Taxonomy Examine the table showing the classification of four organisms. The answer the questions. Taxon Green Frog Mountain Lion Domestic Dog Human Kingdom Phylum Class Order Family Genus

More information

The phylogeny of squamate reptiles (lizards, snakes, and amphisbaenians) inferred from nine nuclear protein-coding genes

The phylogeny of squamate reptiles (lizards, snakes, and amphisbaenians) inferred from nine nuclear protein-coding genes C. R. Biologies 328 (2005) 1000 1008 http://france.elsevier.com/direct/crass3/ Evolution / Évolution The phylogeny of squamate reptiles (lizards, snakes, and amphisbaenians) inferred from nine nuclear

More information

Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action

Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action Les Rencontres de L INRA Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action E Albina (CIRAD) / S Guyomard(Institut Pasteur) Guadeloupe The era

More information

SAM Teachers Guide Nucleic Acids and Proteins (Long Version) Overview Learning Objectives Possible Student Pre/Misconceptions

SAM Teachers Guide Nucleic Acids and Proteins (Long Version) Overview Learning Objectives Possible Student Pre/Misconceptions SAM Teachers Guide Nucleic Acids and Proteins (Long Version) Overview Students explore the structure and function of two of the four major macromolecules: proteins and nucleic acids. On the first day they

More information

Cells. DNA and Heredity

Cells. DNA and Heredity Cells DNA and Heredity ! Nucleic acids DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) Determines how cell function " change the DNA and you change the nature of the organism Changes of DNA allows

More information

CCR Biology - Chapter 10 Practice Test - Summer 2012

CCR Biology - Chapter 10 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 10 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What is the term for a feature

More information

Webserver: bioinfo.bio.wzw.tum.de Mail: w.mewes@weihenstephan.de

Webserver: bioinfo.bio.wzw.tum.de Mail: w.mewes@weihenstephan.de Webserver: bioinfo.bio.wzw.tum.de Mail: w.mewes@weihenstephan.de About me H. Werner Mewes, Lehrstuhl f. Bioinformatik, WZW C.V.: Studium der Chemie in Marburg Uni Heidelberg (Med. Fakultät, Bioenergetik)

More information

Profiling of non-coding RNA classes Gunter Meister

Profiling of non-coding RNA classes Gunter Meister Profiling of non-coding RNA classes Gunter Meister RNA Biology Regensburg University Universitätsstrasse 31 93053 Regensburg Overview Classes of non-coding RNAs Profiling strategies Validation Protein-RNA

More information

An introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle

An introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle An introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle Faculty of Science; Department of Marine Sciences The Swedish Royal

More information

CH. 15: Darwin s Theory of Evolution. Directions: READ ch. 15 in your textbook and use the note outline to help you answer the questions below.

CH. 15: Darwin s Theory of Evolution. Directions: READ ch. 15 in your textbook and use the note outline to help you answer the questions below. CH. 15: Darwin s Theory of Evolution Directions: READ ch. 15 in your textbook and use the note outline to help you answer the questions below. 1. What is a theory? 2. Describe some of the ideas that influenced

More information

II. Pathways of Discovery in Microbiology. 1.6 The Historical Roots of Microbiology. Robert Hooke and Early Microscopy

II. Pathways of Discovery in Microbiology. 1.6 The Historical Roots of Microbiology. Robert Hooke and Early Microscopy II. Pathways of Discovery in Microbiology 1.6 The Historical Roots of Microbiology 1.6 The Historical Roots of Microbiology 1.7 Pasteur and the Defeat of Spontaneous Generation 1.8 Koch, Infectious Disease,

More information

The marine iguana (Amblyrhynchus cristatus)

The marine iguana (Amblyrhynchus cristatus) 07 alberts chap06 7/23/03 9:10 AM Page 84 6 Sodium and Potassium Secretion by Iguana Salt Glands ACCLIMATION OR ADAPTATION? Lisa C. Hazard The marine iguana (Amblyrhynchus cristatus) is well known for

More information

Biological Sequence Data Formats

Biological Sequence Data Formats Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA

More information

Analytical Study of Hexapod mirnas using Phylogenetic Methods

Analytical Study of Hexapod mirnas using Phylogenetic Methods Analytical Study of Hexapod mirnas using Phylogenetic Methods A.K. Mishra and H.Chandrasekharan Unit of Simulation & Informatics, Indian Agricultural Research Institute, New Delhi, India akmishra@iari.res.in,

More information

AP Biology Essential Knowledge Student Diagnostic

AP Biology Essential Knowledge Student Diagnostic AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in

More information

Antibiotic Scaffolds:

Antibiotic Scaffolds: Antibiotic Scaffolds: Past, Present, & Future Michael Fischbach University of California, San Francisco Department of Bioengineering and Therapeutic Sciences There s drugs and then there s antibiotics

More information

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript

More information

Course outline. Code: LFS252 Title: Molecular Biology

Course outline. Code: LFS252 Title: Molecular Biology Course outline Code: LFS252 Title: Molecular Biology Faculty of: Science, Health, Education and Engineering Teaching Session: Semester 2 Year: 2016 Course Coordinator: Joanne Macdonald Tel: 5456 5944 Email:

More information

Biological Sciences Initiative. Human Genome

Biological Sciences Initiative. Human Genome Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.

More information

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.

More information

01 02 03 04 05 06 Haemophilus influenza 07 08 09 Proc. Natl. Acad. Sci. U.S.A. Proc. Acad. Natl. Sci. U.S.A. Nature Science Anal. Chem. Anal.Chem Nuc. Acids Res Anal. Chem Nature Science Haemophilus influenzae

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-8 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Genomic Mapping & Mapping Databases High resolution, genome-wide maps of DNA markers. Integrated maps, genome catalogs and comprehensive

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA)

OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA) OUTCOMES PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation 3.5.1 Compare the structure of RNA and DNA. 3.5.2 Outline DNA transcription in terms of the formation of an RNA strand

More information

Human Genome and Human Genome Project. Louxin Zhang

Human Genome and Human Genome Project. Louxin Zhang Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular

More information

Evolutionary analysis of gorilla, chimps and humans using sequence divergence

Evolutionary analysis of gorilla, chimps and humans using sequence divergence Journal of Bioinformatics and Sequence Analysis Vol. 3(1), pp. 1-5, January 2011 Available online at http://www.academicjournals.org/jbsa ISSN 2141-2464 2011 Academic Journals Full length Research Paper

More information

Experiment 2: DNA fingerprinting for microbial source tracking

Experiment 2: DNA fingerprinting for microbial source tracking Experiment 2: DNA fingerprinting for microbial source tracking Goal: To fingerprint strains of E. coli, and determine the source, as best as possible, for each of the strains. Introduction The Clean Water

More information

TECHNOLOGY PATENTS IN THE (CONTINUED)... 16

TECHNOLOGY PATENTS IN THE (CONTINUED)... 16 CHAPTER ONE: INTRODUCTION... 1 STUDY GOALS AND OBJECTIVES... 1 REASONS FOR DOING THIS STUDY... 1 SCOPE AND FORMAT... 1 METHODOLOGY AND INFORMATION SOURCES... 2 INTENDED AUDIENCE... 2 ANALYST CREDENTIALS...

More information

ESA Study Guide Year 10 Science

ESA Study Guide Year 10 Science Then and now Questions from page 278 of ESA Study Guide Year 10 Science 1. Name the two scientists who worked out the molecular structure of DNA. and 2. What is one word that means all the genes in an

More information

Chapter 2. Using and Understanding RepeatMasker. Sébastien Tempel. Abstract. 1. Introduction

Chapter 2. Using and Understanding RepeatMasker. Sébastien Tempel. Abstract. 1. Introduction Chapter 2 Using and Understanding RepeatMasker Sébastien Tempel Abstract RepeatMasker is a program that screens DNA sequences for interspersed repeats and low-complexity DNA sequences. In this chapter,

More information

Life History. Precambrian Time 4.6 BYA MYA 7/24/2009

Life History. Precambrian Time 4.6 BYA MYA 7/24/2009 Life History Scientists have developed a model of the history of life on Earth called the geologic time scale. Significant developments and extinctions of plant and animal life can be explained on the

More information

AP Biology Learning Objective Cards

AP Biology Learning Objective Cards 1.1 The student is able to convert a data set from a table of numbers that reflect a change in the genetic makeup of a population over time and to apply mathematical methods and conceptual understandings

More information

Chapter 10 Manipulating Genes

Chapter 10 Manipulating Genes How DNA Molecules Are Analyzed Chapter 10 Manipulating Genes Until the development of recombinant DNA techniques, crucial clues for understanding how cell works remained lock in the genome. Important advances

More information

SAM Teacher s Guide DNA to Proteins

SAM Teacher s Guide DNA to Proteins SAM Teacher s Guide DNA to Proteins Note: Answers to activity and homework questions are only included in the Teacher Guides available after registering for the SAM activities, and not in this sample version.

More information

ттгт ци тг цсс пястсгс цсгс TELOS

ттгт ци тг цсс пястсгс цсгс TELOS пепистги ягтгр сг хети епистг тг епистггс упцист гисс пхг еусгс и диеияисгс ттгт ци тг цсс пястсгс цсгс TELOS цв цв applefi евfl г, ж 1994 пепистги ягтгр сг хети епистг тг епистггс упцист гисс пхг еусгс

More information

Genetomic Promototypes

Genetomic Promototypes Genetomic Promototypes Mirkó Palla and Dana Pe er Department of Mechanical Engineering Clarkson University Potsdam, New York and Department of Genetics Harvard Medical School 77 Avenue Louis Pasteur Boston,

More information

Evidence for evolution factsheet

Evidence for evolution factsheet The theory of evolution by natural selection is supported by a great deal of evidence. Fossils Fossils are formed when organisms become buried in sediments, causing little decomposition of the organism.

More information

Biology Performance Level Descriptors

Biology Performance Level Descriptors Limited A student performing at the Limited Level demonstrates a minimal command of Ohio s Learning Standards for Biology. A student at this level has an emerging ability to describe genetic patterns of

More information

Integration of data management and analysis for genome research

Integration of data management and analysis for genome research Integration of data management and analysis for genome research Volker Brendel Deparment of Zoology & Genetics and Department of Statistics Iowa State University 2112 Molecular Biology Building Ames, Iowa

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Gene Switches A Model

Gene Switches A Model Gene Switches A Model Abstract Conceptually, how genetic switches function and their role in the process of evolution, can be difficult for students to visualize. Gene Switches A Model attempts to make

More information

Evidence for Evolution

Evidence for Evolution Evidence for Evolution Evidence for evolution 1. Fossil record and age of the earth (using radioactive dating) 2. Biogeography 3. Homologous structures and vestigial organs 4. Embryology 5. Cellular and

More information

Interest Grabber. Half of a Half of a Half...

Interest Grabber. Half of a Half of a Half... Interest Grabber Section 17-1 Half of a Half of a Half... Some forms of chemical elements are unstable that is, they break down into other substances. Like the decay of leftovers in your refrigerator,

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

行政院國家科學委員會補助專題研 究計畫成果報告

行政院國家科學委員會補助專題研 究計畫成果報告 - 1 - - 2-90 72 0.45µ 1 (2). 1. a. b. c. d. e. a. b. c. d. - 3 - µ EMBO 9, 2819-2826. Bernan V, et al. 1985. The nucleotide sequence of the tyrosinase gene from Streptomyces antibioticus and characterization

More information

Answer Key. Vocabulary Practice

Answer Key. Vocabulary Practice Answer Key Vocabulary Practice Copyright by McDougal Littell, a division of Houghton Mifflin Company A. Categorize Words 1. organism, L; cell, L; species, L; transgenic, B; biotechnology, T; molecular

More information

Biological Evolution. Major Concepts

Biological Evolution. Major Concepts Biological Evolution Darwinian Evolution and Natural Selection 1. Linnaean Classification Major Concepts 2. Fossils 3. Radioactive Dating 4. Fossil Record and Genetic Analysis 5. Theory of Evolution Random,

More information

Chapter 10: Genetics of Viruses

Chapter 10: Genetics of Viruses Chapter 10: Genetics of Viruses Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the structure and genomic composition of viruses. 2. Distinguish between

More information

DNA, RNA AND PROTEIN SYNTHESIS

DNA, RNA AND PROTEIN SYNTHESIS DNA, RNA AND PROTEIN SYNTHESIS Evolution of Eukaryotic Cells Eukaryotes are larger, more complex cells that contain a nucleus and membrane bound organelles. Oldest eukarytotic fossil is 1800 million years

More information

Recap. N = N * f s N * = 4 x f s = 0.2 f p = 1.0. N = 8 x 10 10

Recap. N = N * f s N * = 4 x f s = 0.2 f p = 1.0. N = 8 x 10 10 Life and fl Recap N = N * f s N * = 4 x 10 11 f s = 0.2 f p = 1.0 N = 8 x 10 10 Solar System 8 planets 3 in or close to habitable zone Extrapolating from one example: f p =1 N h = 3 N = N * f s f p N h

More information

Lecture 20: Protein-Protein Interaction

Lecture 20: Protein-Protein Interaction Lecture 20: Protein-Protein Interaction Proteins are responsible for several functions in a cell ranging from a catalyzing reaction to several complex functions. Protein-protein interaction plays an important

More information

Curriculum Vitae. Team Leader, Synthetic Molecular Biology Team, RIKEN Center for Life Science Technologies. President & CEO, TagCyx Biotechnologies

Curriculum Vitae. Team Leader, Synthetic Molecular Biology Team, RIKEN Center for Life Science Technologies. President & CEO, TagCyx Biotechnologies Curriculum Vitae Name: Position: Ichiro Hirao Team Leader, Synthetic Molecular Biology Team, RIKEN Center for Life Science Technologies President & CEO, TagCyx Biotechnologies Visiting Professor, Graduate

More information

THE GENBANK SEQUENCE DATABASE

THE GENBANK SEQUENCE DATABASE Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Second Edition Andreas D. Baxevanis, B.F. Francis Ouellette Copyright 2001 John Wiley & Sons, Inc. ISBNs: 0-471-38390-2 (Hardback);

More information

Accelerated evolution of conserved noncoding sequences in the human genome

Accelerated evolution of conserved noncoding sequences in the human genome Accelerated evolution of conserved noncoding sequences in the human genome Shyam Prabhakar 1,2*, James P. Noonan 1,2*, Svante Pääbo 3 and Edward M. Rubin 1,2+ 1. US DOE Joint Genome Institute, Walnut Creek,

More information

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S. A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT

More information

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary

More information

Transcription Animations

Transcription Animations Transcription Animations Name: Lew Ports Biology Place http://www.lewport.wnyric.org/jwanamaker/animations/protein%20synthesis%20-%20long.html Protein is the making of proteins from the information found

More information

Bioinformatics. Viruses, etc

Bioinformatics. Viruses, etc Bioinformatics, etc David Gilbert Bioinformatics Research Centre www.brc.dcs.gla.ac.uk Department of Computing Science, University of Glasgow Incorporating notes by Ali Al-Shahib, David Leader, and Wikipaedia

More information

In silico comparison of nucleotide composition and codon usage bias between the essential and non- essential genes of Staphylococcus aureus NCTC 8325

In silico comparison of nucleotide composition and codon usage bias between the essential and non- essential genes of Staphylococcus aureus NCTC 8325 International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 3 Number 12 (2014) pp. 8-15 http://www.ijcmas.com Original Research Article In silico comparison of nucleotide

More information

mirnaselect pep-mir Cloning and Expression Vector

mirnaselect pep-mir Cloning and Expression Vector Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect

More information

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes.

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology has had-and will havemany important

More information

Chapter 2 Phosphorus in the Organic Life: Cells, Tissues, Organisms

Chapter 2 Phosphorus in the Organic Life: Cells, Tissues, Organisms Chapter 2 Phosphorus in the Organic Life: Cells, Tissues, Organisms As already mentioned (see Chap. 1 ), in the living cell phosphorus plays a decisive role in three different essential structures: In

More information

Two Patterns of Genome Organization in Mammals: the Chromosomal. Distribution of Duplicate Genes in Human and Mouse

Two Patterns of Genome Organization in Mammals: the Chromosomal. Distribution of Duplicate Genes in Human and Mouse MBE Advance Access published February 12, 2004 Two Patterns of Genome Organization in Mammals: the Chromosomal Distribution of Duplicate Genes in Human and Mouse Robert Friedman and Austin L. Hughes Department

More information

Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations

Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations AlCoB 2014 First International Conference on Algorithms for Computational Biology Thiago da Silva Arruda Institute

More information

An Investigation of Codon Usage Bias Including Visualization and Quantification in Organisms Exhibiting Multiple Biases

An Investigation of Codon Usage Bias Including Visualization and Quantification in Organisms Exhibiting Multiple Biases An Investigation of Codon Usage Bias Including Visualization and Quantification in Organisms Exhibiting Multiple Biases Douglas W. Raiford, Travis E. Doom, Dan E. Krane, and Michael L. Raymer Abstract

More information

SUGAR BEET (Beta vulgaris L.) PROMOTERS FOR DIRECTED TISSUE- SPECIFIC ROOT TRANSCRIPTION

SUGAR BEET (Beta vulgaris L.) PROMOTERS FOR DIRECTED TISSUE- SPECIFIC ROOT TRANSCRIPTION SUGAR BEET (Beta vulgaris L.) PROMOTERS FOR DIRECTED TISSUE- SPECIFIC ROOT TRANSCRIPTION Senthilkumar Padmanaban, Haiyan Li, David P. Puthoff and Ann C. Smigocki USDA-ARS Molecular Plant Pathology Laboratory,

More information

NOVEL GENOME-SCALE CORRELATION BETWEEN DNA REPLICATION AND RNA TRANSCRIPTION DURING THE CELL CYCLE IN YEAST IS PREDICTED BY DATA-DRIVEN MODELS

NOVEL GENOME-SCALE CORRELATION BETWEEN DNA REPLICATION AND RNA TRANSCRIPTION DURING THE CELL CYCLE IN YEAST IS PREDICTED BY DATA-DRIVEN MODELS NOVEL GENOME-SCALE CORRELATION BETWEEN DNA REPLICATION AND RNA TRANSCRIPTION DURING THE CELL CYCLE IN YEAST IS PREDICTED BY DATA-DRIVEN MODELS Orly Alter (a) *, Gene H. Golub (b), Patrick O. Brown (c)

More information

Molecular Cell Biology WS2011

Molecular Cell Biology WS2011 Molecular Cell Biology WS2011 Lecturer: Dr. Andreas Prokesch, Inst. for Genomics and Bioinformatics, TUG Purpose of this series of lectures: to offer you the basic knowledge required to know and understand

More information

The world of non-coding RNA. Espen Enerly

The world of non-coding RNA. Espen Enerly The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often

More information

How/Why to Design PCR Primers

How/Why to Design PCR Primers 6/22/2014 How/Why to Design PCR Primers B3 Summer Science Camp at Olympic High School Dr. Jennifer Weller How to Design PCR Primers When we design the chloroplast primers what are we trying to do? One

More information

Aim #29: NYS Biodiversity Lab Review

Aim #29: NYS Biodiversity Lab Review Name: Aim #29: NYS Biodiversity Lab Review Date: 1. Which chemicals are used to cut DNA into fragments for a gel electrophoresis procedure? A) enzymes B) molecular bases C) hormones D) ATP molecules 2.

More information

Course- Based Research Grant Proposal - Best

Course- Based Research Grant Proposal - Best Abstract The course proposed is a full redesign of an existing general microbiology laboratory for undergraduate biology majors, the laboratory component of BIOL 301 General Microbiology. Typically, junior

More information

Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005

Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 26.03.2012 to 25.03.2017

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the

More information

Chapter 14. Modeling Experimental Design for Proteomics. Jan Eriksson and David Fenyö. Abstract. 1. Introduction

Chapter 14. Modeling Experimental Design for Proteomics. Jan Eriksson and David Fenyö. Abstract. 1. Introduction Chapter Modeling Experimental Design for Proteomics Jan Eriksson and David Fenyö Abstract The complexity of proteomes makes good experimental design essential for their successful investigation. Here,

More information

Custom Antibody Services

Custom Antibody Services prosci-inc.com Custom Antibody Services High Performance Antibodies and More Broad Antibody Catalog Extensive Antibody Services CUSTOM ANTIBODY SERVICES Established in 1998, ProSci Incorporated is a leading

More information

Genetics Notes C. Molecular Genetics

Genetics Notes C. Molecular Genetics Genetics Notes C Molecular Genetics Vocabulary central dogma of molecular biology Chargaff's rules messenger RNA (mrna) ribosomal RNA (rrna) transfer RNA (trna) Your DNA, or deoxyribonucleic acid, contains

More information

AP Biology Summer Assignment Due at the beginning of the first Red/Gold day of class 1

AP Biology Summer Assignment Due at the beginning of the first Red/Gold day of class 1 AP Biology 2016-2017 Summer Assignment Due at the beginning of the first Red/Gold day of class 1 Welcome to AP Biology! This is going to be an exciting and challenging year. This is a fastpaced class.

More information

DnaSP, DNA polymorphism analyses by the coalescent and other methods.

DnaSP, DNA polymorphism analyses by the coalescent and other methods. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,

More information

SSR, 2 SSR, 150 bp (Bn92A),250bp (Bn72A). , nitens ; 2.

SSR, 2 SSR, 150 bp (Bn92A),250bp (Bn72A). , nitens ; 2. 41 1 () Vol. 41 No. 1 2002 1 Journal of Xiamen University (Natural Science) Jan. 2002 :043820479 (2002)20089205 SSR,,, (, 361005) :, GEN E BAN K, 2 SSR (Bn92A,Bn72A). PCR ( Touchdown PCR),,,, 12 DNA PCR.,PCR.

More information

The Making of the Fittest: Evolving Switches, Evolving Bodies

The Making of the Fittest: Evolving Switches, Evolving Bodies OVERVIEW MODELING THE REGULATORY SWITCHES OF THE PITX1 GENE IN STICKLEBACK FISH This hands-on activity supports the short film, The Making of the Fittest:, and aims to help students understand eukaryotic

More information