Netcord WMDA Cord Blood Banking Day 2015

Transcription

1 Netcord WMDA Cord Blood Banking Day 215 November 5, 215 Minneapolis, United States Education Day Welcome Etienne Baudoux, president Netcord 1

2 Oral presentation of Sloan Memorial Kettering Cancer Center Courtney Byam Accreditation, CBU quality and selection criteria Unrelated Donor & Cord Blood Searches: The MSKCC Approach Courtney Byam, MPH, CHTC Program Manager Bone Marrow Transplant Service URD Program Memorial Sloan Kettering Cancer Center New York, NY 2

3 Standard Stem Cell Source Prioritization: Adult Patients 8/8 Related Donors 8/8 Unrelated Donors CB 7/8 Unrelated Donors Haplo Donors URD vs CB Availability by Patient Ancestry MSKCC 7-8/8 URD, CB, or No Graft N = 124, 1/6/25 9/3/215 2 No URD/CB CB 7/8 URD 8/8 URD CB extends access Barker et al (unpublished), 215 3

4 MSKCC 3-year DFS in Adult Acute Leukemia/ CML if T-cell Depleted 7-8/8 URDT or DCBT (n = 166) 1 Disease-Free Survival Logrank (3 groups): p =.68. DCBT 8/8 URDT 7/8 URDT DCBT vs 7/8 URDT: logrank p =.21 & difference at 3 years p = Months Post BMT DCBT significantly better than mismatched URDT & comparable to gold standard of 8/8 HLA-matched URDT Ponce et al, BBMT 215 MSKCC 2-Year PFS after Intermediate Intensity dcbt by Age-Adjusted HCT-CI/ Revised Disease Risk Index (n=1) Median 51 years (range 19-7) & 78 kg (range ). Cyclophosphamide 5 mg/kg, fludarabine 15 mg/m 2, thiotepa 5-1 mg/kg, 4 cgy TBI + CSA/ MMF for acute leukemia/ MDS/ MPD ( 1% blasts), B-cell NHL or HL. Progression-Free Survival AA-HCTCI -3/ DRI low-intermediate: n = 35 AA-HCTCI -3/ DRI- lowintermediate AA-HCTCI -3/ N= DRI 35 high-very high: n = 25 AA-HCTCI -3/ DRI- high-very high N= 25 AA-HCTCI > 4/ DRI high-very high: n = 14 AA-HCTCI > 4/ DRI- AA-HCTCI highvery high N= 14 AA-HCTCI > n 4/ = DRI- 26 low- > 4/ DRI low-intermediate: intermediate N= Months Post-Transplant Kosuri et al ASH, 215 High PFS in adults (including > 5 years) if lower comorbidity scores regardless of disease risk after intermediate intensity dcbt: strongly supports dcbt. 4

5 CB & Haplo Donor Availability dcb + Haplo-identical Donor Availability: n = 89 Group 1 dcbt only: n = 6 No haplo within extended family Pts with CB graft & Haplo donor(s) identified: n = 7 Group 4 no CB graft +/- no Haplo: n = 13 11/13 (85%) Non-European Median weight 93 kg (range ) Group 2 dcbt + Haplo: n = 52 1 st haplo donor chosen cleared 24/52 (46%) Non-European Group 3 dcbt +/- Haplo: n = haplo donors worked up/pt 14/18 (78%) Non-European dcbt + Haplo: n = 7 dcbt only: n = 11 Total haplo donors worked up: n = 41 Haplo donors cleared: n = 7 Non-European pts are at increased risk for not having a suitable CB &/or haplo. Donor clearance cannot be assumed. The need to workup multiple haplos/pt can delay transplant & increase costs. Kosuri et al ASH, 215 Information Requested At Search Formalization Need Diagnosis / remission status Recipient high resolution HLA Current weight Transplant urgency (in weeks)* Prior transplant history (Auto / Allo?) Priority for HSC source if no 8/8 in required time period? Confirmation CMV serology has been drawn * Urgency Definition Very Urgent: Admission < 4 weeks Urgent: Admission 4 6 weeks Standard: Admission > 6 weeks Want Ancestry information Recipient CMV status ABO / RH Significant co-morbidities Likely transplant type (eg: TCD, unmodified, CB if no 8/8) Status of sibling typing 5

6 URD Searches: Additional Considerations All CBT and haplo candidates should have HLA antibodies drawn at search formalization. Patients and URDs typed at HLA-A,B,C,DR,DQ,DP KIR advantage considered if 1/1 URDs if AML or MDS. HLA alleles that are identical over the Antigen Recognition Site (ARS) are considered a match. URD Searches At MSKCC At MSKCC only ~ 5% of patients without matched related donors will have an 8/8 URD. Searches are on spectrum from easy to difficult ~35% of searches can predict with certainty the best donor. ~65% of searches cannot be predicted with certainty. Incorporate HapLogic SM predictions to guide CT. 6

7 URD Search Result Categories: The Good, The Bad & The Ugly 6 MSKCC Search Result Categories: o Very Good o Good o Fair o Poor o Very Poor o Futile URDs: The Good (or Not Bad) Very Good Good Fair 2 8/8 potential donors with a 85% chance likelihood of matching at 8 alleles /8 potential donors with a 85% chance likelihood of matching at 8 alleles 2 8/8 potential donors with a 7% chance likelihood of matching at 8 alleles 1-4 8/8 potential donors with 85% chance likelihood of matching at 8 alleles /8 potential donors with 7% chance likelihood of matching at 8 alleles 2 8/8 potential donors with a 4 69% chance likelihood of matching at 8 alleles 7

8 Poor Very Poor Futile URDs: The Bad & Ugly /8 potential donors with 4 69% chance likelihood of matching at 8 alleles 1 8/8 potential donor with 25-39% chance likelihood of matching at 8 alleles 1 7/8 potential donors with a 7% chance likelihood of matching at 7 alleles 1 7/8 potential donors with a 25 69% chance likelihood of matching at 7 alleles 1 8/8 potential donor with 24% chance likelihood of matching at 8 alleles 1 7/8 potential donor with 24% chance likelihood of matching at 7 alleles 8/8 & 7/8 donor options Tailoring Donor Priority to Transplant Urgency URD SEARCH Urgency Very Good / Good Fair Poor Very Poor Futile Very Urgent Admission < 4 weeks Urgent Admission 4 6 weeks Standard Admission > 6 weeks 1 st : 8/8 URDs & CBs 2 nd : 7/8 URDs 1st: 8/8 URDs 2 nd : CBs 1 st : 8/8 URDs 1 st : 8/8 URDs & CBs 2 nd : 7/8 URDs 1 st : 8/8 URDs 2 nd : CBs 3 rd : 7/8 URDs 1 st : CBs 2 nd : 8/8 & 7/8 URDs 1 st : 8/8 URDs & CBs 2 nd : 7/8 URDs 1 st : CBs 2 nd : 8/8 & 7/8 URDs 1 st : CBs Note: Insurance coverage available for typing is combined with likelihood of securing 8/8 Urgency influences triage of URD vs CB typing. 8

9 Just To Make It More Complicated KIR advantageous donors can be prioritized if AML/ MDS if 1/1 URDs and time permits. DPB1 matches - or DPB1 permissive mismatches - will be considered if URD 8/8 HLA-matched. Cord Blood Graft Selection Criteria Cell Dose HLA Match Bank of Origin Processing / Cryovolume Other Factors Barker et al, How I Treat, Blood 21 Purtill, Blood 214; Purtill et al, BBMT 215 9

10 Selecting Cord Blood Units: TNC & CD34+ Cell Dose Total Nucleated Cells Single Unit: 2.5 x 1 7 /kg Double Unit: 1.5 x 1 7 /kg CD34+ Cells Single Unit: 1.5 x 1 5 /kg Double Unit: 1. x 1 5 /kg Post-thaw CD34+ dose can be predicted at the time of unit selection. Selecting Cord Blood Units: Donor-recipient HLA-match* Traditional match grade: 4-6/6 HLA-A, -B antigen, -DRB1 allele 8 allele level match grade: HLA-A, -B, -C, -DRB1 allele * unit-unit HLA match not considered 1

11 High resolution typing permits selection of better matched units Number of CB Units (CBU) Note: median match at MSKCC is 5/8 6/6 CBU N=1 1% 2% 5% 2% 5/6 CBU N=94 3% 12% 29% 34% 22% 4/6 CBU N=96 6% 25% 34% 31% 3% % Dahi et al, BMT 214 Using High Resolution Match To Select CB Units MSKCC now selects units based on 8 allele donorrecipient match as extreme mismatch could increase TRM (& agvhd). Exactly how to trade off CD34+ dose & high resolution match is unknown. Currently CD34+ cell dose is given priority as no HLA-match DFS signal in MSKCC & U of MN data to date. Current lower limit of acceptable match: 4-6/6 HLA-A, -B antigen, -DRB1 allele 3/8 A,B,C,DRB1 HLA-alleles. 11

12 CD 34+ Viability Post-Thaw % CD34+ Cell Viability (n = 537) 1% 8% 6% 4% 94% 93% 91% 87% 2% % Barker et al (unpublished), 215 Most frequently Other frequently Other US International used CBB used CBBs CBBs CBBs (n=198) (n=79) (n=122) (n=138) Bank of Origin Demonstrates variable unit quality by CB bank Unit Quality Bank Netcord FACT Accreditation Standard cryovolume (~25 mls) No red blood cell containing units (problems with thaw & infusion) Purtill et al, Blood

13 Other Factors in Unit Selection Attached Segment Typing Must be done prior to shipment to confirm unit identity Infectious Disease Markers & Hemoglobinopathy Screen Previously described (Barker et al, How I Treat, Blood 21) Cost Does not influence optimal unit selection Donor Specific HLA Antibodies (DSA) Usually does not influence selection in hematologic malignancies KIR Typing Not used in unit selection Backup Unit(s) At least one domestic backup unit is confirmatory typed & reserved pre-transplant. Must be ready for shipment in case of unexpected problems during shipment, at thaw, or graft failure. Reserved until patient engrafted. Ponce et al, BBMT

14 Conclusions Efficient URD/ CB search management: Identify patient characteristics & needs at search formalization with close coordination with MD. If URD is priority, rapidly evaluate search: Is the search Good, Bad or Ugly? If URD search is Bad/Ugly or transplant urgent, initiate CB search at time of formalization. Optimize CB unit selection: especially considering CD34+ dose, 8 allele HLA-match, CB bank, & unit processing. 14

15 Acknowledgements MSKCC Dr. Juliet Barker Dr. Machi Scaradavou Search Coordinators Eric Davis Jennifer Paulson Melissa Sideroff Debbie Wells NMDP Jason Dehn Cord Blood Bank Technology Survey E. BAUDOUX M. JÖRIS 15

16 Rationale Understand the current trends Identify operational inventory Identify the main procedures in cord blood collection, processing, testing and storage Identify the main technical procedures currently used by public cord blood banks worldwide 16

17 Intentions Make available in Confluence the characteristics of cord blood banks For transplant centers For other cord blood banks to compare practices and improve processes at their center Publish a description of global public cord blood banking 73 responding banks - 3 countries Northern Europe 2 7,241 North Am erica ,735 Western Europe Eastern Europe 3 13,419 Southern Europe Western Asia 4 13,81 Eastern Asia 3 33,13 Central America South Eastern Asia 2 12,436 South America 7 11,74 Oceania 3 34,355 17

18 73 responding banks 25, 76% of inventory 45 Responding banks , , , , North America Western Europe Southern Europe Oceania Eastern Asia Western Asia Eastern Europe South Eastern Asia South America Northern Europe Central America 5 Inventory % Accreditations and State license Both (FACT+AABB) FACT Only AABB only None Yes No In process banks banks 63 9 banks banks FACT and/or AABB Registry audit CA license CA inspection ISO

19 Pre-processing Threshold volume below >1 NA NR Threshold CD Below 2 2 to 4 4 and above Non standard 54 NA 6 NR banks Threshold TNC up to over 18 NR Policy for minorities Yes NR IDMs Standard or on request CB/Mother Not Done/Non responder 2 1 HBs Ag HBs Ab HCV Ab HIV 1-2() p24 Ag HTLV Syphilis CMV IgG CMV IgM CMV Total WNV Ab HIBV NAT HBV NAT HCV NAT HTLV NAT WNV NAT 19

20 Storage conditions 38 Current practice Done previously, not anymore NR Manual Automatic Plasma only Manual Automatic Plasma only Manual Automatic Plasma only Manual Automatic Plasma only Liquid phase Vapour phase Liquid Vapour phase With segments Without segments Plan for storage in 215 Banks Banks additional units expected New units expected: and below above Thousands 2

21 Inventory Responding banks No Reduction Any reduction Units (1 banks did not complete this item) % of inventory Collection and processing Responding banks Collection methods In-utero Ex-utero Both Collection methods Time to processing up to 12H up to 24H up to 36H Up to 48 hours 5 Others (includes non responding) 21

22 Processing and cryopreservation Inventory Current 9 8 AXP No Optipress SEPAX Manual Other (Non Processing standard response) BioArchive Conventional CRF 2 Both 6 NR Cryopreservation DMSO Dextran (includes on site preparation) Cryoprotectants DMSO DMSO HES CryoStor CS1 Non standard responses (includes NR) Single bag (one fraction) 42 Cryobags 5 5 Single 8:2 Multiple bags NR and non standard 22

23 Packaging Current packaging for storage Metal canister 72 More than one segment 68 Overwrap 58 Additional separate segments 13 One segment attached 5 Extra material Current storage of extra material Maternal plasma/serum 72 Plasma/cord blood 69 CB material for DNA extraction 64 Maternal material for DNA extraction 6 CB DNA 41 23

24 HLA 6 Listing HLA HR IR LR NR HR IR LR NR HR IR LR NR HR IR LR NR HR IR LR NR HR IR LR NR HLA-A HLA-B HLA-C HLA-DR HLA-DQ HLA-DP Post processing Post processing evaluation > <5 NA NR/Non standard 1 Threshold TNC (1E7) > <1. NA NR/Non standard 3 Threshold CD34 (Single) 8 24

25 Segment Current confirmatory/verification HLA typing on segments below 5% 5-75% 75-9% 9-1% Yes No Yes No Yes No NR Units with attached segments 3 Attached segment extended/verification typing 64 Pre release requirement CT on attached segment Units without attached segments without CT 1 Hemoglobinopathy 7 66 Hemoglobinopathy screening Yes No 25

26 Release 2 18 Shipping acceptable range viability (%) >= <5 Na NR/Non standard Packaging Current packaging for shipment Metal canister 7 One segment attached 5 Overwrap 43 Protective sleeve 31 Transport rack 25 Separate segment 2 attached segments or more segments 5 26

27 Shipment Current average time to prepare a cord blood unit for shipment -3 days 25 4 days-1 week weeks weeks Other Difference urgent vs non-urgent Difference National vs International Depends on additional testing 6 Transport company Selection of transport company World Courier Selected by National registry Other Requesting transplant centre CBB (total 48) 27

28 S(P)EARS Reporting S(P)EARS National registry 58 Competent authority 5 Internal report 43 Transplant centre 39 WMDA 22 Thank you! Sergio Querol Merry Duffy Lydia Foeken Rachel Glissmann Katie Paulson AND all participating CBB banks! 28

29 World Café 1:45 11: Introduction explanation of the principle- M. Duffy 11: 11:15 First round 11:2 11:35 Second round 11:4 11:55 Third round 12: 12:15 Fourth round Experts: Inventory management: Sergio Querol/ Federico Garnier Experts: Cord Blood Collection: Deborah Wood/ Etienne Baudoux Experts: Processing/Storage: Gesine Kögler/ Joanne Kurtzberg/ Alexander Platz Experts: Release/Shipment: Susana Gomez/ Heidi Elmoazzen/ Mary Laughlin LUNCH SYMPOSIUM GAEL Ltd 29

30 What we learnt from the World Cafe Keywords and feedback of the World Café 13:45 13:5 Inventory management Sergio Querol 13:5 13:55 Cord Blood Collection Deborah Wood 13:55 14: Processing and Storage Gesine Kögler 14: 14:5 Release and Shipment Susana Gomez/Heidi Elmoazzen Future Cord Blood Banking 3

31 New technologies to improve post transplant reconstitution, Joanne Kurtzberg How processing influences potency, Gesine Kögler 31

32 How processing influences potency Gesine Koegler Cord blood progenitor s and gestational age, clinical implications Impact of the way of volume reduction (HES, NON-HES) on cord blood quality Measurement of CD34-7AAD as compared to Annexin Fresh versus cryopreserved 32

33 Hematopoietic cells in preterm and term CB: Biology and gestational age Preterm: weeks Term: weeks Wisgrill, L. et al. 214 Hematopoietic cells capacity of preterm cord blood in vivo is reduced and lower expression of CXCR4 on CD34+ Nakajima et al

34 Hematopoietic cells capacity of term cord blood Comparing volume reduction and quality parameters (CD34+; CFC) of cord blood units after cryopreservation with HES and Non-HES 34

35 Experimental design: HES vs. non-hes protocol Cord Blood Volume Reduction HES Concentrate (HES) Cryopreservation and storage in LN 2 (at least two weeks) Volume Reduction non-hes Concentrate (non-hes) After Thawing (HES) After Thawing (non-hes) Factors affecting potency: Processing (defined buffy coat) HES- 42 ml NonHES-42 35

36 Factors affecting potency: Processing TNC and MNC HES versus Non-HES Factors affecting potency: Processing Hematocrit -HES versus Non-HES-post thaw viability 36

37 Measurement of CD34+7AAD as compared to Annexin after cryopreservation with HES and Non-HES 37

38 Determination of viability of leukocytes and CD34+ cells by 7-AAD Many viability dyes intercalate with DNA. If cell membrane integrity is compromised, dyes can enter the cell, resulting in detectable fluorescence. For some substances, such as 7-Aminoactinomycin D (7-AAD) or Propidium iodide (PI), this light emission can easily be detected in flow cytometry (e.g., 7-AAD at 67 nm in the PeCy5-channel). Determination of viability of leukocytes and CD34+cells in fresh and cryopreserved CB Using 7-AAD as viability dye, only few of the total leukocytes are non-viable after processing. After thawing, this can increase to more than 5%, depending on the composition (granulocytes!) CB after volume reduction CB after thawing 38

39 Determination of viability of leukocytes and CD34+ cells in fresh and cryopreserved CB 7-AAD does not show an significant impact of freezing and thawing on CD34+ HSC (viability > 95%). Problems associated with 7-AAD staining/dyes Dead or heavily damaged cells might get lost in centrifugation/ washing steps. Especially after thawing it is mandatory to use a lyse/no-wash protocol for staining. To avoid further influence of DMSO after thawing, immediate dilution of aliquots/segments with washing solution is recommended. Since 7-AAD / PI only detect cells with damaged cell membrane, cells that are undergoing apoptosis are not detected. 39

40 Assessement of apoptotic cells Annexin V (AnnV) : Stains phosphatidylserine (PS). PS is present on the cytosolic side of the cell membrane, but gets exposed on the outside in case of apoptosis. Assessement of apoptotic cells Annexin V-staining reveals presence of apoptotic HSC in fresh and thawed cord blood which are not detectable with 7-AAD alone 4

41 Factor affecting potency: Processing, addition of DMSO Using Annexin V, it clearly shows that viability of HSC is not as high as estimated with 7-AAD alone. Viability [%] Viability CD34 (7-AAD) Viability [%] Viability CD34 (AnnV + 7-AAD) Whole blood Whole blood + HES Post reduction Pre freeze + DMSO Bag thawed undiluted Bag thawed post wash Whole Blood Whole blood + HES Post reduction Pre freeze + DMSO Bag thawed undiluted Bag thawed post wash Viability CD34+ after AnnexinV-staining 12 Live CD34 AnnV B Live CD34 AnnV 1 1 Viability [%] Viability [%] Whole Blood Whole blood + HES Post reduction Pre freeze + DMSO Bag thawed undiluted Bag thawed post wash Whole blood Whole blood + HES Post reduction Pre freeze + DMSO Bag thawed undiluted Bag thawed post wash Percentage [%] Live Apoptotic Necrotic CD34 AnnV Live CD34 Apoptotic CD34 Dead CD34 Percentage [%] Live Apoptotic Necrotic CD34 AnnV Live CD34 Apoptotic CD34 Dead CD34 Whole blood Whole blood + HES Post reduction Pre freeze + DMSO Bag thawed undiluted Bag thawed post wash Whole blood Whole blood + HES Post reduction Pre freeze + DMSO Bag thawed undiluted Bag thawed post wash 41

42 Determination of viability of leukocytes and CD34+ cells in fresh and cryopreserved CB (HES and non-hes) 7-AAD does not show a significant impact of freezing and thawing on CD34 + HSC (viability > 9%). 7-AAD staining HES Concentrate after Thawing CD34 + alive Recovery: 9 % 42

43 7-AAD staining non-hes Concentrate after Thawing CD34 + alive Recovery: 9 % 7-AAD staining non-hes Concentrate after Thawing 43

44 Annexin V staining HES, 42ml Concentrate after Thawing CD34 + alive : 63% 12 Annexin V staining nonhes 42mL Concentrate After Thawing Concentrate CD34+ Viability: 65±1% 44

45 Annexin V staining nonhes 21mL Concentrate After Thawing CD34+ Viability: 5±6% HES and nonhes: CD34+ post-thaw HES nonhes Recovery CD34 + > 9% > 9% Viability CD34 + (7-AAD) > 9% > 9% Viability CD34 + (Ann V) 63.6% (42 ml) TNC VB mean: x 1 6 TNC K mean: x 1 6 TNC na mean: x % (21 ml) TNC VB mean: x 1 6 TNC K mean: x 1 6 TNC na mean: x % (42 ml) TNC VB mean: x 1 6 TNC K mean: x 1 6 TNC na mean: x % (21 ml) TNC VB mean: x 1 6 TNC K mean: x 1 6 TNC na mean: x

46 Requirements for the cord blood bank Estimation of the cord blood unit potency is most critical before release to a transplant center. The haematopoietic potency of a cord blood transplant describes the presence of specific stem cells with the ability to engraft in and reconstitute a patient after transplantation. Most cord blood banks perform: 1) the CD34 assay. 2) the CFU (colony forming unit) assay. The CFU assay measures the function of the cord blood stem cells. One colony reflects one stem cell. It defines the biological cell function. Post-Thaw CD34 + Cell Count x ml - nonhes 25 CD34+ CD34+ total alive 2 Correlation r Mean Recovery 92% 45% slope:.85±.11 slope:.36± ml - nonhes 25 CD34+ CD34+ total alive 2 Correlation r Mean Recovery 14% 67% slope:.86±.1 slope:.5± ml - HES 25 CD34+ CD34+ total alive 2 Correlation r Mean Recovery 16% 73% slope:.97±.12 slope:.86± ml - HES 25 CD34+ CD34+ total alive 2 Correlation r Mean Recovery 14% 83% slope: 1.1±.7 slope: 1.6± Pre-Freeze CD34 + Cell Count x

47 Acknowledgements Svenja Schwandt Lutz Körschgen BIOSAFE Sergio Querol Richard Duggleby Thanks for organizing this day! 47

48 Future view on Cord Blood Banking from a registry perspective, Federico Garnier Future view on Cord Blood Banking: a registry perspective Federico GARNIER, MD Head of France Greffe de Moelle WMDA Nov

49 Cord blood transplantation in France Where do we stand? WMDA Nov 215 Number of allogeneic transplants N % ,5 2,6 2,7 2,8 2,9 2,1 2,11 2,12 2,13 2,14 Related Unrelated WMDA Nov

50 National patients: unrelated transplants (according to the HSC source) Source : Registre France Greffe de Moelle, Agence de la biomédecine Total HSCT in 214 n=129 BM Moelle n=27 osseuse PBSC CSP n=72 USP CBU n= WMDA Nov 215 WMDA Nov 215 5

51 National patients: number of national and international CBUs October October WMDA Nov 215 National patients: total number of CBU transplants single double October WMDA Nov

52 International patients: Number of national CBU shipments EMDISCORD October October 214 WMDA Nov 215 Preliminary search & shipment What did we find? WMDA Nov

53 Preliminary search: HLA typing / sample requests Number of CBU requested in 213 N=745 Number of CBU requested in 214 N= % 15 14% 96 9% % % 78% 6-12 x 1e x 1e7 >=15 x 1e x 1e x 1e7 >=15 x 1e7 Source : Registre France Greffe de Moelle, Agence de la biomédecine Source : Registre France Greffe de Moelle, Agence de la biomédecine WMDA Nov % CBUs for pediatric and 82% for adult patients contain CNT % CBUs for pediatric and 8% for adult patients contain CNT WMDA Nov

54 Preliminary search: HLA typing / sample requests Median number of TNC and CD34+ Number of CBU requested in Number of CBU requested in Median 19,3 Median 19,3 Cryopreserved TNC (x1e8) Min 7, Cryopreserved TNC (x1e8) Min 6,4 Max 51,7 Max 64,2 Median 7,1 Median 7,1 CryopreservedCD34 (x1e6) Min 1,8 CryopreservedCD34 (x1e6) Min 1,8 Max 4,6 Max 6,4 WMDA Nov 215 Shipments according to TNC, CD34 and patient s characteristics National patients International patients Children Adults Children Adults ALL patients Single Double Single Double Single Double Single Double CBU shipped in 214 n=18 n=1 n=21 n=8 n=34 n=4 n=31 n=121 n=319 Cryopreserved TNC (x1e8) CryopreservedCD34 (x1e6) Patient's weight Median 17,4 15,5 25,8 18,7 18,5 16,8 2,5 21,3 19,9 Min 8,5 11,7 1,9 11,5 1,2 9, 9,8 11,7 8,5 Max 32,6 28,6 35,4 36,8 41,5 19,4 43,5 64,2 64,2 Median 5,3 5,7 1,8 6,8 7,4 5,1 1,5 7,6 7,4 Min 2,3 3,9 1,8 2,1 2,3 2,2 2,8 2,1 1,8 Max 14,3 13,8 21,6 29,8 32,6 14,7 4,6 33, 4,6 Median Min Max WMDA Nov

55 CBU shipped according to the date of collection Time between the date of collection and shipment n=251 Médiane Min Max Median années time in years 4,2,2 15,8 82% CBUs have been collected and cryopreserved between 28 and 214 WMDA Nov 215 Findings The number CBUs used for HCT has decreased in France (mainly double CBT) The French Society of BMT has stated that unrelated MO, PBSC and CBU are still needed for transplantation A national registry has the mission to facilitate the identification all stem cell sources French transplant centers continue to use all cell sources for unrelated transplants despite the (rapid) development of HLA-haploidentical transplants High TNC CBUs are requested from national CBB - preliminary search TNC 19.3x1e8 (n=128) - shipment TNC 19.9x1e8 (n=319) Median time from banking to shipment for French CBUs 4.2y ( ) WMDA Nov

56 Future Cord Blood Banking from a national registry perspective Decision to continue CBU banking (annual target > 2.) Public funding allocated to cover cost related to CB collections (processing and storage continue to be charged to the banks) Reorganization of the French CBB network and the associated maternities Selection of the most efficient maternities (criteria: nb of collections, new HLA-A,B,DR haplotype, motivated staff, location) Same SOP for the associated maternities: MRQ, consent, collection, antisepsis, etc (harmonization) Meeting twice/year of the reference midwife for each associated maternity WMDA Nov 215 Future Cord Blood Banking from a national registry perspective The 25 most commun haplotypes Donor panel A B DR * * * * * * * * * 59% CBU have uncommun haplotype Nombre d'haplotypes HLA-ABDR fréquents parmi la liste des 25 haplotypes les plus fréquents dans le fichier des DVMO inscrits fin 214 haplotype 1 haplotype 2 haplotypes BANQUE Total fréquent fréquent fréquents BESANCON BORDEAUX CRETEIL LILLE MARSEILLE MONPELLIER NANCY PARIS SAINT-LOUIS ANCIENNES UNITES PARIS SAINT-LOUIS NOUVELLES UNITES POITERS RENNES RHONE-ALPES TOTAL Source : Registre France Greffe de Moelle, Agence de la biomédecine WMDA Nov

57 Future Cord Blood Banking from a national registry perspective Cord blood units stored in 214 N = % 25% Median TNC 164,7 x1 7 Median CD34 5,6 x % 6 12 x 1e x 1e7 15 x 1e7 Source : Registre France Greffe de Moelle, Agence de la biomédecine New criteria for banking CBU are: - Minimal volume required for processing 8 ml - TNC after processing before cryopreservation is >16X1e7 (1-15% of the collected CBUs are expected to be qualified) WMDA Nov 215 Future Cord Blood Banking from a national registry perspective 36, Source : Registre France Greffe de Moelle, Agence de la biomédecine National inventory n= HLA typing levels of resolution 31, 26, 3,92 4,168 4,364 4,325 7,961 21, 16, 18,195 17,48 1,228 4,844 17,465 11, 6, 1, 1,713 8,64 7,782 5,87 2,223 A B C DRB1 Générique Codes NMDP Allélique 4 digits Mixte High resolution HLA typing: HLA-A,B,C,DRB1 Re-qualification of the existing inventory (HLA-C typing) WMDA Nov

58 Future Cord Blood Banking from a registry perspective Thank you for your attention WMDA Nov 215 Questions 58

59 Participants Cord Blood Banking Day meet participants WMDA Education Day Clinical outcomes living donor versus cord blood, Mary Eapen 59

60 Impact of cord blood factors on outcomes after single and double cord blood transplantation, Vanderson Rocha How to select double CBT units for adults with malignancies? Impact of cord blood factors on outcomes after Single and Double Cord Blood Transplants in Adults with Hematological Malignancies How to select double cord blood units for adults? Vanderson Rocha, MD, PhD Professor of Haematology- Oxford University BMT unit, Churchill Hospital Oxford, UK Scientific Director of Eurocord Paris, France 6

61 Unrelated UCBT for adults with malignancies; n= * * 5 5 Single; n=1722 Double, n=1654 MAC; n=1556 RIC; n=1735 * Still collecting 214data Age distribution of UCBT in adults years; n= years; n= years; n=763 5 years; n=116 * Still collecting 214 data 61

62 2-year OS after UCBT for adults with malignancies by diagnosis Acute leukemia, n=1993: 4±1% MDS/MPS, n=651: 33±2% Lyphoproliferative disorders, n=56: 49±2% Plasma cell disorder, n=19: 4±1% Factors associated with outcomes after UCBT CORD BLOOD UNIT Bank procedures? CELL DOSE CD34 CFUGM HLA HLA..other genetic Factors PATIENT Disease status HLA antibodies ABO TRANSPLANT Use of Fludarabine Absence of MTX, MMF? Use of Growth Factors Use of ATG/ALG Hematopoietic and immune recovery, GVHD and GVL, TRM, relapse and disease-free survival 62

63 Unrelated Cord Blood Transplant in Adults Outcomes after single or double UCBT are comparable to matched (8/8) unrelated donors in adults with acute leukemias, lymphomas, however inferior in MDS patients In all outcomes after single UCBT (>2.5 x1 7 /kg) are comparable to double units depending on the conditioning regimen used In the last 2 years in Europe around 4-45% or transplants in adults are single and 55-6% double Are the criteria for choosing single units the same as for double units? Recommendations for CB unit choice 215 (single UCBT) Search for antibodies against HLA antigens of the cord blood unit Look at the number of TNC and/or CD34+ cells in MAC, RIC: > x1 7 NC/kg and/ or >1x1 5 CD34+/kg 2. Second look at HLA matches: -1 mm better than 2 avoid 3-4 mm Prefer class I mismatches than class II Include HLA C typing low resolution, avoiding mismatches C +DRB1 High resolution typing mainly for units 4/6 ( avoid 3 and if possible 4/8 and 5/8 TNC> 5x1e7/kg) 3. Then adapt to graft indication: Malignant diseases: cell dose is the best prognostic factor because HLA differences reduce relapse (GVL) Non malignant diseases: increase cell dose (>4.x1 7 NC/kg ) and find the best HLA match ( avoid CB 4/6 ) If the criterion for the minimum number of cells for a single CBU transplantation is not achieved, a double CBT should be considered 4. Other considerations, if several CBU are available consider: Cord Blood Bank accreditation and location NIMA status?kir? ( genotype), CTLA4? Other non HLA genetic polymorphisms? ABO compatibility 63

64 Is Allele-Level HLA-Matching Relevant for Single Umbilical Cord Blood Transplants? Eurocord and Center for International Blood and Marrow Transplant Research M Eapen, JP Klein, A Ruggeri, S Spellman, W Arcese, LA Baxter-Lowe, M Fernandez-Vina, MM Horowitz, SJ Lee, F Locatelli, A Paolo Lori, S Marino, G Michel, GF Sanz, E Gluckman and V Rocha Blood 214 Lesser vs. Allele-level HLA-match (n=15) 3/8 4/8 5/8 6/8 7/8 8/8 4/6 11% 31% 49% 1% 5/6 1% 8% 22% 44% 25% 6/6 4% 18% 24% 54% 64

65 Non-Relapse Mortality - Allele-level Matched at A, B, C, DRB P<.1 8 Incidence, % 6 4 4/8 (37%) ~ 15 % of adults >18 years 5/8 (34%) 6/8 (26%) 3/8 (41%) /8 (26%) 2 8/8 (9%) Years NRM at 1-year by pre-cryopreserved TNC and HLA-match HLA-match 4/8 5/8 6/8 7/8 TNC 3. 43% (28-58) 44% (33-57) 36% (24-49) 45% (29-62) TNC >3. 5. *39% (3-49) 31% (24-38) 21% (14-3) 15% (7-26) TNC >5. *25% (17-33) 25% (2-31) 2% (15-25) 19% (13-26) *Significant difference: p=.2 testing TNC >3. 5. vs. >5.. Other groups testing TNC >3. 5. vs. >5.: p-value=ns The multivariate model tested TNC 3. vs. >3. (optimal cut point determined statistically in the model for mortality). In the univariate analysis there is a significant difference between TNC 3. vs. >3. 65

66 Select units with TNC 3 x 1 7 /kg Best HLA-match Allele-level match at HLA-A, -B, -C and DRB1 Avoid 3/8 HLAmatched transplants Absence of HLA-C typing match at HLA-B HLA-C at confirmatory typing 7/8 and 6/8 are better tolerated than 5/8 or 4/8 HLA-matched transplants TNC in excess of minimum required does not lower NRM Double Units São Paulo University Prognostic association of genetic polymorphisms of immune response with umbilical cord blood transplantation outcomes Renato Cunha, Marco A Zago, Sergio Querol, Fernanda Volt, Annalisa Ruggeri, Guillermo Sanz, Fabienne Pouthier, Gesine Koegler, José L Vicario, Laura Salvaneschi, Riccardo Saccardi, Carmen H Lamas, Cristina Heredia, Gerard Michel, Henrique Bittencourt, Rodrigo A Panepucci, Francisco Fernandes, Julia Pavan, Eliane Gluckman, Vanderson Rocha 66

67 Study design Retrospective cohort study from January 1994 to December 21. Evaluated 851 consecutive UCBT with CBU provided by NetCord CBB. All UCBT were performed by EBMT centers Single Nucleotide Polymorphisms - Genes and probes - Gene SNP Chromosome Name Probes (VIC/FAM) LOC728392MIS12, MIND kinetochore GTCTTAAGATGACAAATCCCTAGGG[A/G]T NLRP1 (NALP1) rs : complex component, homolog (S. CAGGTGGTTTTCCCGCACGAACTC NLRP2 (NALP2) rs :55163 NLR family; pyrin domain containing 2 CTGCCTCTGTTTTATACCTGCACAC[A/G]T CCTTATCTTTGTTACATATGAAAT NLRP3 (NALP3) rs : NLR family; pyrin domain containing 3 GACAATGACAGCATCGGGTGTTGTT[C/G] TIRAP-MAL rs : IL1-592 rs : Interleukin 1 Toll-interleukin 1 receptor (TIR) domain containing adaptor protein REL (crel) rs : V-rel reticuloendotheliosis viral oncogene homolog (avian) TNFRSF1B rs : Tumor necrosis factor receptor superfamily; member 1B CTLA4 rs : Cytotoxic T-lymphocyte associated protein 4 TCATCACAGCGCCTCAGTTAGAGGA GAGGGCTGCACCATCCCCCTGCTGT[C/T] GGGCCTCAGCAGAGCTGCCTACCCA CTTTCCAGAGACTGGCTTCCTACAG[T/G] ACAGGCGGGGTCACAGGATGTGTTC TAAAGTTTGAAAAAATGGCTCATGT[G/T]T ACTTCATTGTCCTTTCTTTATTGC GTGGCCATCCCTGGGAATGCAAGCA[G/T] GGATGCAGTCTGCACGTCCACGTCC TCTTCACCACTATTTGGGATATAAC[A/G]T GGGTTAACACAGACATAGCAGTCC 67

68 Neutrophil engraftment - Whole population, n= According to CBU CTLA4 genotype - AA (n=22): % AG (n=423): % GG (n=226): % p <.1 Non-relapse mortality - Malignant disease, n= According to CBU CTLA4 genotype - AA (n=162): % GG (n=185): % p <.1 AG (n=349): % Time (months) 68

69 Disease-free survival - Malignant disease, n= According to CBU CTLA4 genotype - Probability of disease free survival AA (n=162): % AG (n=349): % GG (n=185): % p =.3 Time (months) Recipients Outcome SNP HR CI 95.% < > p Neutrophil IL1 TT,77,68,87,3 CTLA4 GG 1,25 1,1 1,41,1 Platelet IL1 TT,66,59,75 <,1 TNFRSF1B GG 2,15 1,9 2,43 <,1 Global Malignant disease Summary of results - Multivariate analysis - Chronic GVHD NLRP1 GG 1,51 1,33 1,71,3 NRM CTLA4 GG 1,41 1,24 1,59,1 Overall survival CTLA4 GG 1,36 1,3 1,8,3 NRM CTLA4 GG 1,52 1,35 1,72 <,1 Relapse CTLA4 AA,64,57,72,2 DFS CTLA4 GG 1,41 1,6 1,88,2 69

70 Recommendations for CB unit choice 215 (single UCBT) Search for antibodies against HLA antigens of the cord blood unit Look at the number of TNC and/or CD34+ cells in MAC, RIC: > x1 7 NC/kg and/ or >1x1 5 CD34+/kg 2. Second look at HLA matches: -1 mm better than 2 avoid 3-4 mm Prefer class I mismatches than class II Include HLA C typing low resolution, avoiding mismatches C +DRB1 High resolution typing mainly for units 4/6 ( avoid 3 and if possible 4/8 and 5/8 TNC> 5x1e7/kg) 3. Then adapt to graft indication: Malignant diseases: cell dose is the best prognostic factor because HLA differences reduce relapse (GVL) Non malignant diseases: increase cell dose (>4.x1 7 NC/kg ) and find the best HLA match ( avoid CB 4/6 ) If the criterion for the minimum number of cells for a single CBU transplantation is not achieved, a double CBT should be considered 4. Other considerations, if several CBU are available consider: Cord Blood Bank accreditation and location KIR? (genotype), CTLA4? Other non HLA genetic polymorphisms? NIMA status? UCBT- Adult ( single Units) TNC dose and HLA Disease status and graft type 6% 63% 6% 51% 5% 4% 28% 24% % 17% 2% 3% < TNC dose at cryopreservation (median) TNC dose at infusion (median) >2 HLA disparity (%) < Adv. dis. Status (%) Double UCBT (%) RIC (%) 7

71 2-year OS for adults with malignancies by the year of UCBT Median follow-up: 27 months 25, n=32: 41±1% 2-25, n=22: 3±3% <2, n=67: 25±5% Which are the Cord Blood and other patient, disease and transplant characteristics associated with outcomes after double UCBT? 71

72 Choice of Double unit UCBT Minimum total nucleated cell? Minimum CD34 + cells? HLA? (low or allelic typing of Class I) Type of HLA mismatches? Gender of units? ABO? CD34+ cells (viable) dominant unit (Purtill D et al Blood 214) FACT-Netcord accredited banks (Purtill D et al Blood 214) Double Cord Blood Transplant in adults with malignancies Selection Criteria Double Cord Blood Transplant First allo ducbt in EBMT centres from 2 to 213 Adults (>18 y) with Hematological malignancies Data available of collected total nucleated cells and HLA (-A,-B low and DRB1 high) of both CB units Exclusion Criteria Expanded or experimentally manipulated CB units 72

73 Retrospective Analysis Variables Patient : Age, CMV, Gender Disease : diagnosis (AL,MDS/MPD, PCD), status at Tx ( early, intermediate, advanced) Cord Blood characteristics: Number of collected TNC (CB1+CB2) Number of collected CD34 (CB1+CB2) Number of HLA disparities (combinations of 6/6, 5/6,4/6 3/6) ( with the patient and between units) Gender Matching (combinations of sex matching with the patient and between units) ABO matching (combinations of with the patient and between units) Transplant characteristics: type of conditioning regimen, use of ATG ducbt recipients and Disease Characteristics (n=934) Median age: 47 years (18-72) Median weight: 71kg (4-15) Male: 6% Positive CMV serology: 56.5% Diagnosis Acute Leukemia MDS 2% 6% Myeloproliferative disorder (MPD) Lymphoproliferative disorder 8% 1% 56% Plasma cell disorder 73

74 ducbt in adults with malignancies (n=934) Disease status at ducbt 42% 29% 29% Early Intermediate Advanced Median follow-up time : 36 months (3-99) Cord Blood Characteristics (n=934) Cells Collected TNC 1 7 /kg CBU-1 TNC 1 7 /kg CBU-2 CD /kg CBU-1 CD /kg CBU-2 TOTAL TNC 1 7 /kg TOTAL CD /kg Number Missing Median Minimum Maximum Cells Infused Number Missing Median Minimum Maximum

75 7% Cord Blood Characteristics (n=934) Number of HLA disparities (HLA -A,-B low and DRB1 high) HLA matching was classified between patient and the highest HLA disparity CBU 1% 67% 25% 6/6 5/6 4/6 3/6 45% 1% 1% 3% 7% 6/6+6/6 22% 6/6+5/6 5/6+5/6 5/6+4/6 21% 4/6+4/6 4/6+6/6 any 3/6 Cord Blood Characteristics (n=934) ABO compatibility 52% 18% 3% both units are ABO compatible at least one unit has minor ABO incompatibility at least one unit has major ABO incompatibility 1% 14% 16% 26% 18% 16% both units are ABO compatible with the recipient 1 minor ABO incompatibility +1 ABO compatible with the recipient 1 major ABO incompatibility +1 ABO compatible with the recipient both units minor ABO incompatibility with the recipient 1 minor ABO incompatibility + 1 major ABO incompatibility with the recipient both units major ABO incompatibility with the recipient 75

76 Transplantation characteristics GVHD prophylaxis : CSA+MMF (77%) Conditioning regimen RIC : 642 (69%) (51 were CY+FLU+TBI <5) MAC : 292 (31%) (22 were CY+FLU+TBI 12) ATG Conditioning MAC RIC Total NO n % within 24.3% 75.7% 1.% ATG % within 54.7% 78.8% 71.2% CT YES n % within 49.8% 5.2% 1.% ATG % within CT 45.3% 21.2% 28.8% Results 76

77 Neutrophils recovery 8±2% 88±2% Neutrophils recovery Multivariate analysis Favorable Factors associated with greater recovery 95.% CI for Exp(B) P value HR Lower Upper Female recipient Negative CMV >3.5 x17/kg other diagnosis than MDS HLA 3/6, year and advanced disease status 77

78 Impact of total collected CD34 cells (1 5 /kg) on neutrophil recovery (n=818) >=2.59 >=1.87 and <2.59 >=1.26 and <1.87 <1.26 P<.1 Neutrophils recovery and total collected nucleated cell dose <3.5x1 7 /kg P=.1 78

79 Acute GVHD II-IV and III-IV Multivariate analysis 95.% CI for Exp(B) P HR Lower Upper Factors decreasing the incidence HLA 6/6 or 5/ Use of ATG < RIC % CI for Exp(B) P HR Lower Upper Factors increasing the incidence ABO Major incompatibility Median age > 47y Advanced Disease HLA 4/6 or more days incidence of a GVHD 3-4 after ducbt in adults Major ABO incompatibility 33% Minor ABO incompatibility 23% ABO compatible 22% P=.4 79

80 1 days incidence of a GVHD 3-4 after ducbt in adults HLA >=4/6 3% HLA 6/ or 5/6 2% NRM Multivariate analysis P HR 95.% CI for Exp(B) Lower Upper CMV + serology Advanced disease ABO major and minor incompatibility Use of ATG HLA 4/6 or 3/

81 3 year Probability of NRM by ABO compatibility after ducbt in adults Minor ABO incompatibility 47% Major ABO incompatibility 39% ABO compatible 27% P=.28 3 year Probability of NRM by HLA after ducbt in adults HLA >=4/6 43% HLA 6/ or 5/6 33% ABO compatible 27% P=.16 81

82 Causes of NRM after ducbt by ABO group Major Minor INFECTIONS TOX GVHD Compatible Survival Multivariate analysis 95.% CI for Exp(B) p HR Lower Upper CMV MDS HLA 4/ ABO incompatibility ATG <

83 3 year Probability of Survival by HLA after ducbt in adults 5/6+5/6 5% 5/6+4/6 42% 4/6+4/6 39% 3 year Probability of Survival by ABO compatibility after ducbt in adults ABO compatible 57% ABO compatible 57% Major ABO incompatibility 39% Minor ABO incompatibility 47% P=.8 83

84 Relapse Multivariate analysis 95.% CI for Exp(B) p HR Lower Upper advanced RIC ATG DFS Multivariate analysis P HR 95.% CI for Exp(B) Lower Upper Patient +CMV serology Advanced ABO Major/Minor incompatibility ATG

85 Summary Improving outcomes of ducbt TNC dose > 3.5x1 7 /kg or CD34 cell dose >1.8x1 5 /kg associated with better engraftment Better matching of HLA and ABO are important cord blood characteristics: associated with decreased incidence of GVHD, NRM and better survival Other transplant related factors such as use of ATG has to be defined MDS and CMV+ are also important factors that decrease survival Recommendations for CB unit choice 215 (double UCBT) Search for antibodies against HLA antigens of the cord blood unit 1. Look at the number of TNC and/or CD34+ cells in MAC, RIC: sum of both units should contain >-3.5 x1 7 TNC/kg and/or CD34+/kg >1.8x Look at HLA and ABO matches: Try to avoid combinations of 4/6 units (type of mismatches?) Try to avoid ABO incompatible units 3. Other considerations, if several CBU are available consider: Cord Blood Bank accreditation and location 85

86 Clinical Cases Patient, BAME, 42 years, 1kg, AML CR2, no HLA 1/1 or 9/1 donor. Few possibilities of Cords HLA 4/6 ( >3.5 x1 7 /kg TNC and CD34+ > /kg) ABO compatible Conditioning Regimen: TBI 4Gy, Thiotepa, FLU+CY Engraftment at day +14 Alive 8 months Patient, Caucasian, ALL Ph+, 62 kg, no HLA identical Few possibilities of Cords HLA 4/6 ( >3.5 x1 7 /kg TNC and CD34+ > /kg) ABO compatible Conditioning Regimen: TBI 4Gy, Thiotepa, FLU+CY Engraftment at day +18 Alive 4 months Thanks Transplant centers in Europe : data managers and physicians Netcord CBB Eurocord Registry ( ABM) (Dr I Ionescu) All Eurocord Collaborators (CIBMTR, NHSBT, WMDA, WBMT, Duke and Minnesota Universities 86

87 Annalisa Ruggeri, MD Vanderson Rocha, MD PhD Agnès Devergie, MD Eliane Gluckman, MD FRCP Chantal Kenzey, CRA Annalisa Paviglianiti, MD Fernanda Volt, MT Hanadi Elayoubi, MD Barbara Cappelli, MD Federica Giannotti, MD Alexandre Goutagny, AP Adverse events reporting lessons learned for the future, Heidi Elmoazzen 87

88 Closure future directions, Etienne Baudoux and Michael Boo 88