Save this PDF as:

Size: px
Start display at page:

Download "LORENZA PUTIGNANI, UNITA' DI METAGENOMICA E DI PARASSITOLOGIA Children s Hospital and Research Institute, IRCCS, Rome, Italy"


1 Utilizzo di piattaforme metaomiche nella descrizione del microbiota intestinale di importanti patologie croniche: il caso della fibrosi cistica e della steatosi epatica MICROBIOTA TECHOLOGY AD DATA MAAGEMET LOREZA PUTIGAI, UITA' DI METAGEOMICA E DI PARASSITOLOGIA Children s Hospital and Research Institute, IRCCS, Rome, Italy


3 3 OPBG OMICS and METAOMICS COSORTIUM THE SYSTEMS MEDICIE MODELS: MOUSE AD HUMA TOWARDS METABOTYPES.. TOWARDS ETEROTYPES.. Healthy nutrition Resistance to infection Oral tolerance Organ vitality Healthy ageing HEALTH DIET HOMEOSTASIS DYSFUCTIO DISEASE ITESTIE AS BIOREACTOR Obesity Metabolic syndrome Diabetes Infection Cancer IBD From Putignani et al., 2014, In press, Pediatric Research-ature

4 From Putignani et al., 2014, In press, Pediatric Research-ature 4

5 5 -OMICS PHEOTYPES AD CHARTS SYMBIOSIS I THE GUT DYSBIOSIS I THE GUT ITESTIAL DISEASES Age scale..critical to fill 0-24 months for fine programming plan Age scale..neonates and follow-up, phase and type of the disease DESCRIPTIO De Filippo et al., 2010, PAS; Dominguez-Bello et al., 2010, PAS; Palmer et al., 2007, PLOS Biology; Koenig et al., 2011, PAS; Meghan, et al., CMAJ; Jost et al., 2012 Yatsunenko et al., ature 486, (14 June 2012) CATEGORIES Arumugam et al., 2011, ature 473 (12 May 2012) Schloissnig et al., 2013, ature 493 (12 January 2013) From Putignani et al., 2014, In press, Pediatric Research-ature

6 GUT MICROBIOTA RELATED DISEASES 6 GUT DISEASE From Putignani et al., 2014, In press, Pediatric Research-ature


8 CULTUROMICS PROTEOMICS 8 Saliva Stool Sample collection Microbiological cultures Axenic cultures Del Chierico et al., 2013, IJMS 41875R Metagenomics in AD: tools and applications

9 HUMA ITESTIAL TRACTCHIP (HITChip) GEOMICS 9 DA extraction optimised for very earlylife samples Microbial community profiling HITChip Rajilic-Stojanovic et al., 2009 Microarray platform HITChip Agilent Technologies, 8 arrays, 15,000 probes, with over 4,800 tiling oligonucleotides targeting the V1 or the V6 region of the 16S rra gene from 1,140 microbial phylotypes present in the human gut. Italian Baby Trial Optimised procedures for meconium DA extraction: 95% Pearson correlation index Metagenomics of the human intestinal tract From Petrucca et al., 2014, Manuscript in preparation, American Journal of Gastroenterology


11 METABOLOMICS: towards biomarker searching 11 Technological platforms Data analysis Statistical approach GC-MS GC-MS chromatogram PCA Heat map 1 H-MR 1 H-MR spectrum Sample collection: blood, plasma, faeces, urine and saliva Scatter plot LC-MS LC-MS spectrum AOVA Del Chierico et al., 2014, IJMS 41875R1-2014, Metagenomics in AD: tools and applications

12 METAPROTEOMICS 12 METAPROTEOMICS An original metaproteomic pipeline to identify newborn mouse gut phylotypes BACTERIAL PURIFICATIO METAPROTEOMIC (LC-MS 2 ) EWBOR MOUSE GUT HOMOGEATE EBS Proxeon EASY-nLCTM AO-LC chromatogra m MUCOSAL AD FECAL BACTERIA BIOIFORMATIC WORKOW PROTEIS PEPTIDES AmaZon Ion Trap MS nanoflow ESI Sprayer MS and MS 2 SPECTRA MASCOT DATA Peptides to protein hits Protein hits to OTUs LIK TO FUCTIO OTUs linking to phyla and families F. Del Chierico, A. Petrucca, S. Levi Mortera, P. Vernocchi, M M Rosado; L. Pieroni, R. Carsetti, A. Urbani, L. Putignani. A metaproteomic pipeline to identify newborn mouse gut phylotypes. Journal of Proteomics, 2014 Jan 31;97: doi: /j.jprot

13 Relative abundance (%) Taxonomic classification of Balb/c and Rag2 ko gut microbiota characterized by axenic based MALDI- 13 TOF MS approach 100 Balb/c Rag2 ko age (days) Del Chierico et al., Journal of Proteomics, 2014 Jan 31;97:17-26

14 Taxonomic classification of Balb/c and Rag2ko gut microbiota characterized by metaproteomic pipeline 14 METAPROTEOMICS Del Chierico et al., Journal of Proteomics, 2014 Jan 31;97:17-26

15 COG functional category distribution associated to Firmicutes and Proteobacteria phyla: towards biomarker searching METAPROTEOMICS 15 Del Chierico et al., Journal of Proteomics, 2014 Jan 31;97:17-26

16 ORIGIAL BIOIFORMATIC PIPELIE 16 16S rra barcoded amplicons Statistical analysis Emulsion -PCR Database searching Principal component analysis Canonical Correlation analysis Pyrosequencing RAKIG Metadata analysis OTUs identification Raw sequences 1 CCCCAAGCGATACCATGCAATCGAACGGT CAGGAAGCCCGACTCGATCCAATTCCGGG 2 GGTCCAGACTCTACGAAAGGCAGCAGTGG GAATATTGCGGTTAAACTAGTAGCCATGCA 3 CTGGGAACTGATCTGATACTGGCAAGCTT GAGTCTCGTATTAAAACCCGTAGTCACTG SC OTUs grouping OTU phylogeny Denoising procedures Relative abundance of OTUs Del Chierico et al., 2013, IJMS 41875R Metagenomics in AD: tools and applications

17 Physiological status/disease 1 Patient (n ) Sample (n ) Years of project samples/year Project Priority Healthy subjects (reference cohort for all sub-projects, 1-18 years) (consortium OBG, RC) Early life vaginally-delivered neonates (0-1 years) (RF ) Juvenile Idiopathic Arthritis (MD Paedigree Project) Obeses (consortium OBG) Obeses (MD Paedigree Project) Cystic fibrosis (consortium OBG/Milan, Regione Lazio CF Grant, RC) OPBG microbiome Projects Obeses (consortium OBG, RC) ASH/AD (consortium OBG, RC) Williams Syndrome (consortium OBG, RC) EC/bowel syndromes/congenital gut malformations (RC) TBD TBD Mediterrean diet (HORIZO 2020) Mice Model (RC 2014) Autism spectrum disorder (ASD) TBD TBD GUT PROGRAMMIG GUT DISEASE GRADI OBESI TBD TBD ORAL COMMUITIES TBD TBD Idiopathic nephrotic syndrome (RC) 20 TBD 1-1 IBD/IBS (HORIZO 2020) TBD TBD Metabolic diseases TBD TBD Total sample number (minimum)

18 Gut microbiota in cystic fibrosis (CF) patients: a combined -omic translational workflow P. Vernocchi 1,2,3, M. Valerio 4, F. Del Chierico 1,2, L. Casadei 4, A. La Storia 5, F. De Filippis 5, G. Salerno 5, A. Petrucca 1,2,6, F. Majo 7, C. Rizzo 8, E. Fiscarelli 8, C. Manetti 4, M. Muraca 8, V. Lucidi 7, D. Ercolini 5, B. Dallapiccola 9 and L. Putignani 1,2 1. Unit of Parasitology, Bambino Gesù Children's Hospital, IRCCS, Rome, Italy 2. Units of Metagenomics, Bambino Gesù Children's Hospital, IRCCS, Rome, Italy 3. Interdipartimental Centre for Industrial Research-CIRI AGRIFOOD-Almat Mater, Bologna, Italy 4. Department of Chemistry, Sapienza, Università di Roma 5. Department of Agriculture, Università Federico II, aples, Italy 6. Department of Diagnostic Science, Sant Andrea Hospital, Rome, Italy 7. Unit of Cystic Fibrosis, Bambino Gesù Children's Hospital, IRCCS, Rome, Italy 8. Laboratory Medicine, Bambino Gesù Children's Hospital, IRCCS, Rome, Italy 9. Scientific Directorate, Bambino Gesù Children's Hospital, IRCCS, Rome, Italy

19 CFTR-opathies : phenomics PHEOMICS 19 ID Age (years) Gender Sweat test (Cl, mmol/l) Genotype CFTR Pancreatic status Meconium ileus W/L or BMI (Z-score) Lung colonization Antibiotics Use of probiotics Disease severity P M 77 F508del/dele2,3 insufficient yes -1,5 Staphylococcus aureus no no severe P F 81 F508del/L1065P Insufficient no 2,1 Serratia marcescens yes no severe P F 95 F508del/F508del insufficient no -1 Stenotrophomonas maltophilia no no severe P F 125 F508del/F508del insufficient no 0,1 S. aureus no no severe P M 91 F508del/F508del insufficient yes -1 S. aureus no yes severe P F G>T/R553X insufficient yes -0,8 S. maltophilia no no severe P M 98 F508del/G1244E insufficient no 0,6 negative yes no severe P F G>T/1898+G> A insufficient no 2,5 Pseudomonas aeruginosa no no severe P F 94 F508del/1303K insufficient no 0 P. aeruginosa yes no severe P F 95 F508del/M1V insufficient no 0,3 S. maltophilia yes no severe P F 89 F508del/P5L sufficient no 1 negative no no mild P M 98 F508del/R1162X sufficient no 0,4 P. aeruginosa yes no severe P M 140 F508del/Unknown insufficient no 2,1 negative no yes mild P F 99 F508del/712-1G>T insufficient no -0,1 P. aeruginosa yes no severe P M 100 F508del/F508del insufficient no -1 S. aureus no no severe P F 95 F508del/R553X insufficient no -0,2 S. aureus yes yes severe P F K/2694 T>G sufficient no 0,44 negative no no mild P M K/2184m5A insufficient yes -1,27 P. aeruginosa yes no mild P M 96 F508del/F508del insufficient yes -0,48 Escherichia coli yes yes severe P M 90 F508del/R1070Q insufficient no 3,2 P. aeruginosa yes no severe P F 78 F508del/S1253R insufficient yes -0,4 S. maltophilia no yes severe P F 85 F508del/G542X insufficient no -0,1 P. aeruginosa yes no mild P M G>A/D1152H sufficient no -0,7 P. aeruginosa no no severe P M G>A/S1455X sufficient no 0,6 negative yes no mild P F 61 G542X/187K sufficient no 0,54 negative yes no mild P M 114 F508del/W1282X insufficient no 1,3 Haemophilus influentiae no no mild P F G>A/Unknown P F 84 F508del/3659delC insufficient no -1,2 S. aureus no no severe insufficient yes -3,1 S. aureus no no severe






25 UIFRAC: β-diversity analysis, UWEIGHTED and WEIGHTED 25

26 UIFRAC: β-diversity analysis, UWEIGHTED and WEIGHTED 26

27 Statistics at Phylum, Family, Genera and Species level (AOVA) 27 Tenericutes were more abundant in negative samples (avg. 14% in vs 1.8% in P) (p<0.001) Erysipelotrichaceae (avg. 14% in vs 1.8% in P), Ruminococcaceae (avg. 13% in vs 3.8% in P) and Lachnospiraceae (avg. 22% in vs 12% in P) families had a significantly lower occurrence in P, while Clostridiaceae (avg. 3% in vs 21% in P) was significantly higher (p<0.05). In P individuals it was found a lower occurrence of: Eggerthella spp. (avg. 2% in vs 0.19 in P) (p<0.001) Eggerthella lenta (avg. 1.1% in vs 0.05 in P) (p<0.05) Ruminococcus spp. (avg. 4% in vs. 0.2 in P) (p<0.01) Faecalibacterium praumitzii (avg. 2.5% in vs. 0.04% in P) (p<0.01) And an higher occurrence of: Escherichia spp. (avg. 0.2% in vs. 7.3% in P) (p<0.01) Clostridium spp. (avg. 2% in vs. 11% in P) (p<0.01) In particular, Clostridium difficile (avg. 0.01% in vs. 2.5% in P) (p<0.05) FUCTIOAL METAGEOMICS From Vernocchi et al., Manuscript in preparation, 2014

28 ppm equivalent ppm equivalent ppm equivalent ppm equivalent GC-MS/SPME (solid phase microextraction) : VOLATILOME butanol 2-ethyl- 1hexanol Phenyl ethyl alcohol HC benzyl alcohol 2 ethyl 1 hexanol 1 octen 3 ol 2-dodecanol 1 hexanol 1-butanol 1-propanol ethanol benzyl alcohol 2 ethyl 1 hexanol 1 octen 3 ol 2-dodecanol 1 hexanol 1-butanol 1-propanol ethanol CF ethanol 1-propanol 1-pentanol HC CF P-06-8 P-11-7 P-11-4 P-10-7 P-10-4 P-10-2 P-09-4 P-09-2 P-08-6 P-08-4 P-08-2 P-07-7 P-07-6 P-07-5 P-07-1 P-06-2 P-11-3 P-06-6 P-11-9 P P P-07-9 P-08-8 P-07-4 P-06-7 P-08-3 P-09-6 P-09-7 P P-11-8 HC samples CF samples Median value and total amount (ppm) of Alcohols were higher in HC children but methyl acetate butyl acetate HC HC methyl pentanoate propyl decanoate ethyl decanoate ethyl octanoate butyl hexanoate propyl hexanoate iso amyl butyrate butyl butyrate propyl butyrate 2-methyl butanoate butyl acetate ethyl butyrate ethyl acetate methyl acetate methyl pentanoate propyl decanoate ethyl decanoate ethyl octanoate butyl hexanoate propyl hexanoate iso amyl butyrate butyl butyrate propyl butyrate 2-methyl butanoate butyl acetate ethyl butyrate ethyl acetate methyl acetate CF P-11-8 P P-09-7 HC samples CF samples P-11-3 P-06-6 P-11-9 P P P-07-9 P-08-8 P-07-4 P-06-7 P-08-3 P-09-6 P-06-8 P-11-7 P-11-4 P-10-7 P-10-4 P-10-2 P-09-4 P-09-2 P-08-6 P-08-4 P-08-2 P-07-7 P-07-6 P-07-5 P-07-1 P-06-2 CF ethyl acetate butyl butyrate 4-methyl pentanoate Median value and total amount (ppm) of Esters were higher in CF children From Vernocchi et al., Manuscript in preparation, 2014

29 ppm equivalent ppm equivalent ppm equivalent ppm equivalent GC-MS/SPME results 29 Butyric acid Valeric acid HC HC methyl butyric acid valeric acid 3 methyl butanoic acid butyric acid propionic acid acetic acid methyl butyric acid valeric acid 3 methyl butanoic acid butyric acid propionic acid acetic acid CF Acetic acid Propionic acid 3 methyl butanoic acid CF 0 P-06-8 P-11-7 P-11-4 P-10-7 P-10-4 P-10-2 P-09-4 P-09-2 P-08-6 P-08-4 P-08-2 P-07-7 P-07-6 P-07-5 P-07-1 P-06-2 P-11-3 P-06-6 P-11-9 P P P-07-9 P-08-8 P-07-4 P-06-7 P-08-3 P-09-6 P-09-7 P P-11-8 HC samples CF samples Median value and total amount (ppm) of SCFAs were higher CF children Phenol 4 methyl pehnol HC p-cresol phenol 2,6 bis phenol p-cresol phenol 2,6 bis phenol CF 2,6 phenol HC CF P-06-8 P-11-7 P-11-4 P-10-7 P-10-4 P-10-2 P-09-4 P-09-2 P-08-6 P-08-4 P-08-2 P-07-7 P-07-6 P-07-5 P-07-1 P-06-2 P-11-3 P-06-6 P-11-9 P P P-07-9 P-08-8 P-07-4 P-06-7 P-08-3 P-09-6 P-09-7 P P-11-8 HC samples CF samples Total amount (ppm) of Phenols was similar between HC and CF Median value (ppm) of Phenols was higher in HC children From Vernocchi et al., Manuscript in preparation, 2014

30 GC-MS/SPME results 30 Median values and ranges of the concentration (ppm) of volatile organic compounds (VOCs) (grouped in chemical class) of faecal samples from CF and HC determined by GC-MS/SPME Healthy children (HC) Cystic fibrosis patients (CF) p-value Chemical class IQR(25%-75%) IQR(25%-75%) median median acids alcohols alcanes alkenes aldehydes ketones sulphur compounds esters < eterocycles phenols furan furanones indoles piperidine pirazine pyridine pyrimidine terpenes *Data are the means of three independent experiments (n = 3) for each children From Vernocchi et al., Manuscript in preparation, 2014

31 31 GC-MS/SPME results CF children PC Healthy children PC1 GC-MS/SPME data by using Principal Component Analysis (PCA) carried out on samples from CF and HC children. The score plot shows a clear separation between the CF and healthy children on the PC1 (p= ) and PC2 (p= E-05). From Vernocchi et al., Manuscript in preparation, 2014

32 GC-MS/SPME results 32 PC acetic acid propyl butyrate ethyl butyrate amyl acetate propyl acetate 2,3 octanedione butyl butyrate ethyl octanoate 2 pentyl furan gamma terpinene dodecane heptanal AR curcumene octanal tetradecane Hexanal octanoic acid ethyl acetato nonanal octenal 2 heptanol Indole butyl acetato propionic acid alpha pinene 1-propanol 2-nonanone 2,4 octanedione 2-heptanone heptane ethanol 2-propanone 2,3 butanedione 2-pentanone gamma curcumene 2-octanol methyl pirazine 3 methyl indole linalool 2-nonanol 2,6 octadiene phenol 2,3 butanediol 2-dodecanol 2 ethyl hexanal 2-butanol 3-hexanone octyl acetate benzaldehyde decanol heptanoic acid pyridine 3-heptanol 2-hexanol HC CF Acetone CF children Overview of the PCA model built on the VOCs dataset of CF and HC faecal samples. The score and loading plots of the first two components (PC1 versus PC2) are shown superimposed. The score plot shows the differentiation between the CF and HC, while the loading plot highlights which metabolites are responsible in separating the samples Healthy children PC1 From Vernocchi et al., Manuscript in preparation, 2014

33 to[1] GC-MS/SPME results campioni FC tutti completo 28 GIUGO.M4 (OPLS/O2PLS-DA) t[comp. 1]/to[XSide Comp. 1] Colored according to classes in M METABOLOMICS 7 6 P-06-6 P Healthy children (2) P P-07-9 P-11-9 P P-06-7 P-11-3 P-08-6 P-09-7 P P-09-2 P-08-3 P-11-7 P-07-7 P-07-4 P-07-5 P-08-1 P-10-2 CF children P-10-7 P-08-2 P-07-6 P t[1] R2X[1] = R2X[XSide Comp. 1] = Ellipse: Hotelling T2 (0.95) SIMCA-P :54:51 (UTC+1) To eliminate these metabolic effects not due to CF disease, we analyzed the GC-MS/SPME data by using the orthogonal projections to latent structures-discriminant analysis (OPLS-DA). This analysis revealed a net separation between CF young patients and healthy children on first latent variable (p < ). From Vernocchi et al., Manuscript in preparation, 2014

34 1 H-MR results 34 PCA - Data set: 31 FC patients and 37 healthy children PC4 (5%) 5 0 P_09_2-5 P_7_ PC1 (12%) FC Controls MR data were investigated by using PCA carried out on samples from CF and healthy children. Five components are sufficient to explain 40% of total variability of the system. The score plot shows a clear separation between the CF and healthy children on the PC1 (p= 0.001) and PC4 (p< ). From Vernocchi et al., Manuscript in preparation, 2014

35 Comparison of clinical characteristics of patient s cohort and their corresponding metabolic profiles 35 Age FACTORS PATIETS PRICIPAL COMPOETS PC1 PC2 PC3 PC4 PC5 Relationship between Age or Sweat test values and the metabolic profiles of FC patients and healthy children. The table reports the Spearman's rank correlations between Age or Sweat test values with their corresponding metabolic profiles. All FC Healthy (0.04) ( ) Sweat test FC Sources of variability in metabolomic data of FC patients and healthy children as measured by analysis of variance (AOVA). The table reports the F-values for each factor (Gender, IP, Antibiotics and Probiotics) and, in parenthesis, the corresponding p-values. Significant values (p<0.05) are in bold. Gender All (0.898) (0.465) (0.859) (0.531) (0.288) IP All (0.001) (0.575) (0.871) (<0.0001) (0.031) Antibiotics All (0.133) (0.256) (<0.0001) (0.004) (0.389) From Vernocchi et al., Manuscript in preparation, 2014

36 Comparison of clinical characteristics of FC patient and their corresponding metabolic profiles 36 Sources of variability in metabolomic data of FC patients as measured by two-way analysis of variance. The table reports the F-values for each factor (Genotype, Lung and Age) and combination of factors (Genotype*Lung, Genotype*Age and Lung*Age) and, in parenthesis, the corresponding p-values. Significant values (p<0.05). PCs Factor Genotype Lung Age Genotype*Lung Genotype*Age Lung*Age PC (0.376) (0.768) (0.883) (0.481) (0.412) (0.216) PC (0.30) (0.647) (0.621) (0.307) (0.903) (0.701) PC (0.496) (0.395) (0.353) (0.60) (0.387) (0.198) PC (0.222) (0.705) (0.470) (0.995) (0.238) (0.825) PC (0.386) (0.577) (0.361) (0.997) (0.150) (0.762) From Vernocchi et al., Manuscript in preparation, 2014

37 1 H-MR results 37 OPLS-DA: FC patients without IP vs. FC with IP vs. Healthy children LV2 4 2 P_09_ MILD P_7_10-6 FC grading? LV1 FC patients without IP FC patients with IP Healthy children The metabolic FC effects is partially overwhelmed by IP and antibiotic consumption factors (AOVA: PC1 ( (p = 0.001)), PC4 ( (p <0.0001)) for IP and PC4 (8.828 (0.004)) for Antibiotic consumption). To eliminate these metabolic effects not due to CF disease, we analyzed the MR data by using the orthogonal projections to latent structures-discriminant analysis (OPLS-DA). This analysis revealed a net separation between CF patients and healthy children on first latent variable (p < ). From Vernocchi et al., Manuscript in preparation, 2014

38 1 H-MR results 38 Relative levels of the main metabolites which explain the differences across CF and healthy children according to O-PLS-DA analysis Spectral region Average Fold change Metabolites (ppm) a over control p value 0.82, Hydroxyisovalerate , 1.54, 2.14 Butyrate Isovalerate , 0.99 Ile Leu , 1.03 Val , 2.17 Propionate Ala Arg Acetate , 2.63 Methionine , Aminobutyrate 2.34 Glu < Sarcosine < Choline , 3.42, 3.45, Glucose , 4.63, Glycine , 7.52 Uracyl < , 7.19 Tyr , Phenyllactate , 2.79 Asp Phe From the analysis of O-PLS-DA loadings, the CF patients showed lower levels of: 1. SCFA (acetate, propionate, and butyrate), 2. amino acids (isoleucine, leucine, valine, alanine, arginine, methionine, glutamate, aspartate, glycine, tyrosine and phenylalanine) 3. isovalerates (2-hydroxy-isovalerate and isovalerate) 4. sarcosine, 5. glucose, 6. 3-phenyllactate, 7. uracyl than healthy children. On the other hand, the CF patients showed higher levels of: 1. 4-aminobutyrate, 2. choline. a Mid spectral integral region, i.e., 3.26 represents ppm 3.23 to 3.27; only spectral regions containing only one metabolite are reported.

39 1 H-MR results 39 1) The role of gender and age as potential confounding factors was investigated. o correlation between gender and metabolic profiles were found. For FC patients, no correlation between age and metabolic profiles were found. For healthy children, a negative correlation with PC1 (ρ = t-test 2006 vs p = 0.03; 2007 vs p = 0.04) as well as a positive correlation with PC4 were found (ρ = 0.448; t-test 2006 vs p = 0.02; 2006 vs p = 0.03; 2006 vs p = 0.003; 2007 vs p = 0.02) 2) o relationship of Sweat test values with metabolic profiles was found. 3) The metabolic variations due to IP is mainly accounted for by PC1 (12.738, p = 0.001), PC4 (37.148, p <0.0001) and PC5 (4.858, p = 0.031) 4) The metabolic variations due to antibiotic consumption is mainly accounted for by PC3 and PC4 components 5) o relationship between Genotype, Lung and age factors of FC patients and their metabolic profiles were found From Vernocchi et al., Manuscript in preparation, 2014

40 1 H-MR results 40 Graphical representation: comparison of clinical characteristics of the children cohort and their corresponding metabolic profiles I From Vernocchi et al., Manuscript in preparation, 2014

41 1 H-MR results 41 Graphical representation: comparison of clinical characteristics of the patient cohort and their corresponding metabolic profiles II Significant values (p<0.05) are in bold. From Vernocchi et al., Manuscript in preparation, 2014

42 Gut microbiota in AD-ASH patients: a combined -omic translational workflow F. Del Chierico 1,2, P. Vernocchi 1,2,3, Alisi, A. 4, V. Giorgio 5, A. Petrucca 1,2,6, C. Rizzo 7, B. Dallapiccola 8, V. obili 4,5 and L. Putignani 1,2 1. Unit of Parasitology, Bambino Gesù Children's Hospital, IRCCS, Rome, Italy 2. Units of Metagenomics, Bambino Gesù Children's Hospital, IRCCS, Rome, Italy 3. Interdipartimental Centre for Industrial Research-CIRI AGRIFOOD-Almat Mater, Bologna, Italy 4. Liver Research Unit, Bambino Gesù Children s Hospital, IRCCS, Rome, Italy 5. Hepato-Metabolic Disease Unit, Bambino Gesù Children s Hospital, IRCCS, Rome, Italy 6. Department of Diagnostic Science, Sant Andrea Hospital, Rome, Italy 7. Laboratory Medicine, Bambino Gesù Children's Hospital, IRCCS, Rome, Italy 8. Scientific Directorate, Bambino Gesù Children's Hospital, IRCCS, Rome, Italy






48 ppm ppm GC-MS/SPME results ASH3/98 ASH26/98 ASH30/98 ASH 4/99 1-heptanol 1 octen 3 ol 1 hexanol 1-pentanol iso amyl alcohol 1-butanol 1-propanol ethanol // ASH11/99 ASH20/99 ASH2/00 ASH17/00 ASH28/00 ASH16/01 ASH27/01 ASH19/02 ASH9/02 ASH10/ samples ASH7/02 ASH15/03 ASH14/03 ASH5/03 ASH25/04 ASH12/04 ASH8/05 ASH6/05 ASH29/05 ASH24/06 ASH23/ Alcohols in particular: 1-heptanol 1-octen 3 ol 1-hexanol 1-pentanol Iso amyl alcohol 1-propanol ethanol // Esters in particular: methyl acetate butyl acetate propyl butyrate butyl propanoate ethyl hexanoate butyl 2- methylbutyrate iso amyl butyrate hexyl acetate ASH3/98 ASH26/98 ASH30/98 ASH 4/99 ASH11/99 ASH20/99 ASH2/00 ASH17/00 ASH28/00 ASH16/01 ASH27/01 hexyl acetate iso amyl butyrate butyl 2-methylbutyrate ethyl hexanoate butyl propanoato propyl butyrate butyl acetato methyl acetato ASH19/02 ASH9/02 ASH10/02 samples ASH7/02 ASH15/03 ASH14/03 ASH5/03 ASH25/04 ASH12/ ASH8/05 ASH6/05 ASH29/05 ASH24/06 ASH23/06

49 ppm ppm GC-MS/SPME results ASH3/98 ASH26/98 ASH30/98 ASH 4/99 octanoic acid heptanoic acid pentanoic acid/valeric acid 2-methyl butyric acid butanoic/butyric acid propionic acid acetic acid ASH11/99 ASH20/99 ASH2/00 ASH17/00 ASH28/00 ASH16/01 ASH27/01 ASH19/02 ASH9/02 // // ASH10/02 samples ASH7/02 ASH15/03 ASH14/03 ASH5/03 ASH25/04 ASH12/04 ASH8/05 ASH6/ ASH29/05 ASH24/06 ASH23/06 Acids and SCFAs in particular: acetic acid propionic acid butyric acid 2-methyl butyric acid valeric acid heptanoic acid octanoic acid Aldehydes in particular: hexanal octanal nonanal benzaldehyde benzeneacetaldeh yde 4-methyl benzaldehyde ASH3/98 4-methyl benzaldehyde Benzeneacetaldehyde benzaldehyde nonanal octanal Hexanal/caproaldehyde ASH26/98 ASH30/98 ASH 4/99 ASH11/99 ASH20/99 From Del Chierico et al., manuscript in preparation, ASH2/00 ASH17/00 // ASH28/00 ASH16/01 ASH27/01 ASH19/02 ASH9/02 ASH10/02 samples ASH7/02 ASH15/03 ASH14/03 ASH5/03 ASH25/ // ASH12/04 ASH8/05 ASH6/05 ASH29/05 ASH24/06 ASH23/06

50 ppm ppm GC-MS/SPME results // // methyl phenol 2-methyl phenol 4 methyl phenol/p-cresol phenol Phenols in particular: phenol p-cresol 2-methyl phenol 3 methyl phenol ASH3/98 ASH26/98 ASH30/98 ASH 4/99 ASH11/99 ASH20/99 ASH2/00 ASH17/00 ASH28/00 ASH16/01 ASH27/01 ASH19/02 ASH9/02 ASH10/02 samples ASH7/02 ASH15/03 ASH14/03 ASH5/03 ASH25/04 ASH12/04 ASH8/05 ASH6/05 ASH29/05 ASH24/ ASH23/ // Ketons in particular: 2-propanone 2-butanone 2,3 butanedione 2-pentanone 4 methyl 2 pentanone 2-hexanone 2,6-dimethyl 4 heptanone 2-octanone 6 methyl 5 hepten 2 one 2-nonanone nonanone 6 methyl 5 hepten 2 one 2-octanone 2,6-dimethyl 4 heptanone 2-hexanone 4 methyl 2 pentanone 2-pentanone 2,3 butanedione 2-butanone 2-propanone/acetone ASH3/98 ASH26/98 ASH30/98 ASH 4/99 ASH11/99 ASH20/99 ASH2/00 ASH17/00 ASH28/00 ASH16/01 ASH27/01 ASH19/02 ASH9/02 ASH10/02 samples ASH7/02 ASH15/03 ASH14/03 ASH5/03 ASH25/04 ASH12/04 ASH8/05 ASH6/05 ASH29/05 ASH24/06 ASH23/06 From Del Chierico et al., manuscript in preparation,

51 ppm ppm GC-MS/SPME results // // ASH3/98 ASH26/98 ASH30/98 ASH 4/99 ASH11/99 ASH20/99 ASH2/00 ASH17/00 ASH28/00 ASH16/01 ASH27/01 ASH19/02 ASH9/02 // ASH10/02 samples beta caryophyllene trans alpha bergamotene alpha terpinolene para cimene gamma terpinene delta 3-carene beta pinene ASH7/02 ASH15/03 ASH14/03 ASH5/03 ASH25/04 ASH12/04 ASH8/05 ASH6/05 ASH29/05 ASH24/ ASH23/06 Terpenes in particular: beta pinene delta 3-carene gamma terpinene para cimene alpha terpinolene trans alpha bergamotene beta caryophyllene Indoles in particular: 5-methyl- 2phenyl-1H-Indole 1H-indole Indole 7-methyl indole 3 methyl 1H indole 2 methyl 1H indole 3 methyl indole ASH3/98 ASH26/98 From Del Chierico et al., manuscript in preparation, methyl indole 2 methyl 1H indole 3 methyl 1H indole 7-methyl indole Indole 1H-indole 5-methyl-2phenyl-1H-Indole ASH30/98 ASH 4/99 ASH11/99 ASH20/99 ASH2/00 ASH17/00 ASH28/00 ASH16/01 ASH27/01 ASH19/02 ASH9/02 ASH10/02 samples // ASH7/02 ASH15/03 ASH14/03 ASH5/03 ASH25/04 ASH12/04 ASH8/05 ASH6/05 ASH29/05 ASH24/06 ASH23/



54 ACKOWLEDGEMETS Grant X "La proteomica in microbiologia: dallo studio dei singoli patogeni alla biologia dei sistemi complessi to L. Putignani/OPBG 2. Ricerca Corrente (201402G003251) Bambino Gesù Hospital and Research Institute (OBG) to L. Putignani/OPBG 3. Ricerca Corrente (RC P002991) Bambino Gesù Hospital and Research Institute (OBG) to L. Putignani/OPBG 4. Ricerca Corrente (RC G003050) Bambino Gesù Hospital and Research Institute (OBG) to L. Putignani/OPBG 5. Italian Proteomics Association, ItPA, Mobility fellowship, 2011, Studio proteomico dell'effetto modulante dell allattamento materno sul gut microbiota del neonato to P. Vernocchi, UIBO/OPBG 6. OPBG-DICOFARM: The protein high mobility group box1, HMGB1, as new intestinal marker in neonates affected by EC 7. COTO CAPITALE 2012 Studio integrato del metagenoma e del metaproteoma in patologie pediatriche associate ad alterazioni del microbiota intestinale to Dallapiccola/Putignani OPBG 8. SEVETH FRAMEWORK PROGRAMME, ICT , MD-PEDIGREE, GRAT UMBER , to Dallapiccola/Putignani FODAZIOE LUCA BARBARESCHI



Statistical Analysis. NBAF-B Metabolomics Masterclass. Mark Viant

Statistical Analysis. NBAF-B Metabolomics Masterclass. Mark Viant Statistical Analysis NBAF-B Metabolomics Masterclass Mark Viant 1. Introduction 2. Univariate analysis Overview of lecture 3. Unsupervised multivariate analysis Principal components analysis (PCA) Interpreting

More information

Deliverable 7.3.1 First report on sample storage, DNA extraction and sample analysis processes

Deliverable 7.3.1 First report on sample storage, DNA extraction and sample analysis processes Model Driven Paediatric European Digital Repository Call identifier: FP7-ICT-2011-9 - Grant agreement no: 600932 Thematic Priority: ICT - ICT-2011.5.2: Virtual Physiological Human Deliverable 7.3.1 First

More information



More information

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell?

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell? Pipe Cleaner Proteins GPS: SB1 Students will analyze the nature of the relationships between structures and functions in living cells. Essential question: How does the structure of proteins relate to their

More information

Canadian Microbiome Initiative

Canadian Microbiome Initiative Canadian Microbiome Initiative Background The human body plays host to trillions of microbes, including bacteria, viruses and protists. These microbes constitute the Human Microbiome that resides both

More information

Chapter 12 Organic Compounds with Oxygen and Sulfur

Chapter 12 Organic Compounds with Oxygen and Sulfur Chapter 12 Organic Compounds with Oxygen and Sulfur 1 Alcohols An alcohol contains a hydroxyl group ( OH) that replaces a hydrogen atom in a hydrocarbon. A phenol contains a hydroxyl group ( OH) attached

More information


BEER VOLATILE COMPOUNDS IN DEPENDENCE ON YEAST STRAIN USED FOR FERMENTATION BEER VOLATILE COMPOUNDS IN DEPENDENCE ON YEAST STRAIN USED FOR FERMENTATION Daniela Šmogrovičová Department of Biochemical Technology Institute of Biotechnology and Food Science e-mail: daniela.smogrovicova@stuba.sk

More information

Journal of Food Science and Biotechnology

Journal of Food Science and Biotechnology 27 6 2008 11 Journal of Food Science and Biotechnology 27 No. 6 Vol. Nov. 2008 :167321689 (2008) 0620115206 1,2, 1,2, 1,2, 3 1,2 (1., 214122 ; 2., 214122) : ( HS2SPM E) ( GC2MS) 3 95, 73 ; 46 52 50, 23

More information

Alcohols An alcohol contains a hydroxyl group ( OH) attached to a carbon chain. A phenol contains a hydroxyl group ( OH) attached to a benzene ring.

Alcohols An alcohol contains a hydroxyl group ( OH) attached to a carbon chain. A phenol contains a hydroxyl group ( OH) attached to a benzene ring. Chapter : rganic Compounds with xygen Alcohols, Ethers Alcohols An alcohol contains a hydroxyl group ( H) attached to a carbon chain. A phenol contains a hydroxyl group ( H) attached to a benzene ring.

More information

Screening per il cancro colorettale. Prospettive future: il ruolo dei VOCs

Screening per il cancro colorettale. Prospettive future: il ruolo dei VOCs Screening per il cancro colorettale. Prospettive future: il ruolo dei VOCs Prof Donato F Altomare, MD Dept of Emergency and Organ Transplantation, University of Bari, Italy Colorectal cancer (CRC) screening

More information



More information

NOMENCLATURE OF ORGANIC COMPOUNDS 2010, 2003, 1980, by David A. Katz. All rights reserved.

NOMENCLATURE OF ORGANIC COMPOUNDS 2010, 2003, 1980, by David A. Katz. All rights reserved. NMENCLATURE F RGANIC CMPUNDS 2010, 2003, 1980, by David A. Katz. All rights reserved. rganic chemistry is the chemistry of carbon compounds. Carbon has the ability to bond with itself to form long chains

More information

BOC334 (Proteomics) Practical 1. Calculating the charge of proteins

BOC334 (Proteomics) Practical 1. Calculating the charge of proteins BC334 (Proteomics) Practical 1 Calculating the charge of proteins Aliphatic amino acids (VAGLIP) N H 2 H Glycine, Gly, G no charge Hydrophobicity = 0.67 MW 57Da pk a CH = 2.35 pk a NH 2 = 9.6 pi=5.97 CH

More information


AMINO ACIDS QUANTITATION IN BIOLOGICAL MEDIA. Monica Culea STUDIA UNIVERSITATIS BABEŞ BLYAI, PHYSICA, L, 4b, 25 AMIN ACIDS QUANTITATIN IN BILGICAL MEDIA Monica Culea Univ. Babes Bolyai, Biomedical Physics Dept., 1 Kogalniceanu str, 34 Cluj Napoca, Romania e mail:

More information

The amino acids differ in the properties of their side chains. Hydrophobic, non acidic (the H+ ion won t associate with water)

The amino acids differ in the properties of their side chains. Hydrophobic, non acidic (the H+ ion won t associate with water) Amino Acids 101 What is an amino acid? Amino acids, or alpha- amino acids, are the building blocks of peptides and proteins They are composed of amine and carboxylic acid groups, separated by the alpha-carbon

More information

Results of experiment series I: C4-compounds

Results of experiment series I: C4-compounds Results of experiment series I: C4-compounds GC-MS-Results (total ion chromtogram and identification). PK: Number of peak identified RT: Retention time of the chromatogram Area Pct: % of the total measured

More information

Block 042: Organic Chemistry Naming Alcohols

Block 042: Organic Chemistry Naming Alcohols Sophomore Chemistry Block 042: Organic Chemistry Naming Alcohols Page 1 Block 042: Organic Chemistry Naming Alcohols What do you think of when you think of alcohol? NAME: Cliff and Norm from Cheers The

More information

A Streamlined Workflow for Untargeted Metabolomics

A Streamlined Workflow for Untargeted Metabolomics A Streamlined Workflow for Untargeted Metabolomics Employing XCMS plus, a Simultaneous Data Processing and Metabolite Identification Software Package for Rapid Untargeted Metabolite Screening Baljit K.

More information

DF2015. U Reading. Understanding the mechanism of action of prebiotics in metabolic health An overview of WP5 activities N.M.

DF2015. U Reading. Understanding the mechanism of action of prebiotics in metabolic health An overview of WP5 activities N.M. DF2015 U Reading Understanding the mechanism of action of prebiotics in metabolic health An overview of WP5 activities N.M. Delzenne Starting point : defining obesity and related metabolic disorders Obesity

More information

AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data

AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data Csaba Kerepesi, Dániel Bánky, Vince Grolmusz: AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data http://pitgroup.org/amphoranet/ PIT Bioinformatics Group, Department of Computer

More information

Rapid and Reproducible Amino Acid Analysis of Physiological Fluids for Clinical Research Using LC/MS/MS with the atraq Kit

Rapid and Reproducible Amino Acid Analysis of Physiological Fluids for Clinical Research Using LC/MS/MS with the atraq Kit Rapid and Reproducible Amino Acid Analysis of Physiological Fluids for Clinical Research Using LC/MS/MS with the atraq Kit Fast, simple and cost effective analysis Many areas of biochemical research and

More information

Part A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?)

Part A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?) ChemActivity 46 Amino Acids, Polypeptides and Proteins 1 ChemActivity 46 Part A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?) Model 1: The 20 Amino Acids at Biological p See

More information

Amino Acids, Peptides, Proteins

Amino Acids, Peptides, Proteins Amino Acids, Peptides, Proteins Functions of proteins: Enzymes Transport and Storage Motion, muscle contraction Hormones Mechanical support Immune protection (Antibodies) Generate and transmit nerve impulses

More information

Alcohols. Copyright 2009 by Pearson Education, Inc. Copyright 2009 Pearson Education, Inc. CH 3 CH 2 CH 2 OH 1-propanol OH

Alcohols. Copyright 2009 by Pearson Education, Inc. Copyright 2009 Pearson Education, Inc. CH 3 CH 2 CH 2 OH 1-propanol OH Chapter 12 rganic Compounds with xygen and Sulfur 12.1 Alcohols, Thiols, and Ethers Alcohols An alcohol contains a hydroxyl group ( ) attached to a carbon chain. A phenol contains a hydroxyl group ( )

More information

Nature s Chemistry Oxidation of Food

Nature s Chemistry Oxidation of Food Kirkcaldy High School CfE Higher Chemistry Nature s Chemistry Oxidation of Food Page 1 of 18 No. Learning Outcome Understanding? 1 Branched-chain alcohols with no more than 8 carbon atoms in the longest

More information

Tutorial for proteome data analysis using the Perseus software platform

Tutorial for proteome data analysis using the Perseus software platform Tutorial for proteome data analysis using the Perseus software platform Laboratory of Mass Spectrometry, LNBio, CNPEM Tutorial version 1.0, January 2014. Note: This tutorial was written based on the information

More information

4 Titration Curve of an Amino Acid

4 Titration Curve of an Amino Acid p H 4 Titration Curve of an Amino Acid Simple amino acid Acidic amino acid Basic amino acid 7 OH - equivalents Objectives: A) To determine the titration curve for an amino acid and B) to use this curve

More information


MASS SPECTROMETRY: BASIC EXPERIMENT Pavia 8.1-8.5 MASS SPECTROMETRY: BASIC EXPERIMENT scienceaid.co.uk -e - Molecule Molecule +. Types of Ionization Electron Ionization, EI Chemical Ionization, CI Desorption Ionization Techniques Secondary

More information

Ammonia (plasma, blood)

Ammonia (plasma, blood) Ammonia (plasma, blood) 1 Name and description of analyte 1.1 Name of analyte Ammonia 1.2 Alternative names None 1.3 NLMC code 1.4 Description of analyte Ammonia has the formula NH 3. At physiological

More information

William Shaw, Ph.D. The Great Plains Laboratory, Inc., Lenexa, Kansas, USA

William Shaw, Ph.D. The Great Plains Laboratory, Inc., Lenexa, Kansas, USA Inhibition of dopamine conversion to norepinephrine by Clostridia metabolites appears to be a (the) major cause of autism, schizophrenia, and other neuropsychiatric disorders. All these factors can now

More information

MarkerView Software 1.2.1 for Metabolomic and Biomarker Profiling Analysis

MarkerView Software 1.2.1 for Metabolomic and Biomarker Profiling Analysis MarkerView Software 1.2.1 for Metabolomic and Biomarker Profiling Analysis Overview MarkerView software is a novel program designed for metabolomics applications and biomarker profiling workflows 1. Using

More information

The Gut Microbiome and Inflammation in HIV-1 Disease

The Gut Microbiome and Inflammation in HIV-1 Disease The Gut Microbiome and Inflammation in HIV-1 Disease Cara C. Wilson, M.D. Professor of Medicine and Immunology Division of Infectious Diseases, Department of Medicine University of Colorado at Denver Objectives

More information


CORE ORGANIC CHEMISTRY MODULE 4 CORE ORGANIC CHEMISTRY CHEMISTRY NOTES I have designed and compiled these beautiful notes to provide a detailed but concise summary of this module. I have spent a lot of time perfecting the content

More information

Chemical Structures. Part I: Structures on paper and in 3-d

Chemical Structures. Part I: Structures on paper and in 3-d hemical Structures bjectives 1. To practice with the different atoms used in Bio 111: to know the number of bonds made by each kind of atom, the structures that they form, and the charges they have. 2.

More information

Unit 2 Review: Answers: Review for Organic Chemistry Unit Test

Unit 2 Review: Answers: Review for Organic Chemistry Unit Test Unit 2 Review: Answers: Review for Organic Chemistry Unit Test 2. Write the IUPAC names for the following organic molecules: a) acetone: propanone d) acetylene: ethyne b) acetic acid: ethanoic acid e)

More information

H H N - C - C 2 R. Three possible forms (not counting R group) depending on ph

H H N - C - C 2 R. Three possible forms (not counting R group) depending on ph Amino acids - 0 common amino acids there are others found naturally but much less frequently - Common structure for amino acid - C, -N, and functional groups all attached to the alpha carbon N - C - C

More information

Executive summary (maximum 2 sides A4)

Executive summary (maximum 2 sides A4) MINISTRY OF AGRICULTURE, FISHERIES AND FOOD CSG 15 Research and Development Final Project Report (Not to be used for LINK projects) Two hard copies of this form should be returned to: Research Policy and

More information


CYSTIC FIBROSIS CLINICS AS A MODEL OF INTERPROFESSIONAL CARE CYSTIC FIBROSIS CLINICS AS A MODEL OF INTERPROFESSIONAL CARE 1. Cystic fibrosis introduction 2. CF Foundation centers 3. Care disciplines: physician specialists (pulmonary, GI, endocrine, genetics, palliative

More information

Thermo Scientific SIEVE Software for Differential Expression Analysis

Thermo Scientific SIEVE Software for Differential Expression Analysis m a s s s p e c t r o m e t r y Thermo Scientific SIEVE Software for Differential Expression Analysis Automated, label-free, semi-quantitative analysis of proteins, peptides, and metabolites based on comparisons

More information

Autoignition temperatures of flammable liquids in closed vessels

Autoignition temperatures of flammable liquids in closed vessels Autoignition temperatures of flammable liquids in closed vessels PAPP Christian *), BRANDES Elisabeth *), HIRSCH Werner *), MARX, Marcus **) *) Physikalisch-Technische Bundesanstalt, Braunschweig **) Otto-von-Guericke-Universität,

More information

Advanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK

Advanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK Advanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK Dai Lu, Ph.D. dlu@tamhsc.edu Tel: 361-221-0745 Office: RCOP, Room 307 Drug Discovery and Development Drug Molecules Medicinal

More information

IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins

IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon A. Acid/Base properties 1. carboxyl group is proton donor! weak acid 2. amino group is proton acceptor! weak base 3. At physiological ph: H

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Ch14_PT MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Compounds with the -OH group attached to a saturated alkane-like carbon are known as A)

More information



More information

Chains and Rings: Organic Chemistry

Chains and Rings: Organic Chemistry Chains and Rings: Organic Chemistry Introduction: Welcome! You are now at the launching point of a new adventure. An adventure called Organic Chemistry. To succeed in this adventure, you must accept the

More information

Montana State University

Montana State University Montana State University General Guidelines What Send down the drain only those materials found on the safe list. Compounds not listed are not suitable for drain disposal. Where Drain disposal must only

More information

Ministero della Salute

Ministero della Salute Ministero della Salute Direzione Generale della Ricerca e dell' Innovazione in Sanità BANDO 2013 PROGRAMMI DI RETE FINANZIATI PROGRAMMA NETWORK CODICE: 02356160 SCORE MEDIO DEL NETWORK: 13,75 Pediatric

More information

Nutrient Data Laboratory Look up the nutrient content of 6,200 foods from the USDA database.

Nutrient Data Laboratory Look up the nutrient content of 6,200 foods from the USDA database. Nutritional Facts Nutrient Data Laboratory Look up the nutrient content of 6,200 foods from the USDA database. http://www.nal.usda.gov/fnic/foodcomp/search/ Coconut meat, raw Coconut meat, dried (desiccated),

More information

GT-020 Phase 1 Clinical Trial: Results of Second Cohort

GT-020 Phase 1 Clinical Trial: Results of Second Cohort GT-020 Phase 1 Clinical Trial: Results of Second Cohort July 29, 2014 NASDAQ: GALT www.galectintherapeutics.com 2014 Galectin Therapeutics inc. Forward-Looking Statement This presentation contains, in

More information

Chemical Analysis of Chardonnay Wines: Identification and Analysis of Important Aroma Compounds

Chemical Analysis of Chardonnay Wines: Identification and Analysis of Important Aroma Compounds Chemical Analysis of Chardonnay Wines: Identification and Analysis of Important Aroma Compounds ABSTRACT Chardonnay wines from leading world producers were selected for analysis and comparison of volatile

More information

DNA Lecture II Protein Synthesis Notes. Using the Code of Life DNA & RNA. Page #1 (Stratton 2010) Name: 2. : production of proteins

DNA Lecture II Protein Synthesis Notes. Using the Code of Life DNA & RNA. Page #1 (Stratton 2010) Name: 2. : production of proteins Page #1 Using the Code of Life DNA & RNA Slide #2 Two process involve DNA : making an copy of DNA a. purpose: b. occurs: c. uses: DNA : production of proteins a. purpose: & b. occurs: between nucleus &

More information

Molecular Biology Basic Concepts

Molecular Biology Basic Concepts Molecular Biology Basic Concepts Prof. Dr. Antônio Augusto Fröhlich Charles Ivan Wust LISHA - UFSC {guto charles}@lisha.ufsc.br http://www.lisha.ufsc.br/~{guto charles} September 2003 September 2003 http://www.lisha.ufsc.br/~guto

More information

Chem 401 Lab Exercise #5 Nomenclature Worksheet for Alkanes and Cycloalkanes

Chem 401 Lab Exercise #5 Nomenclature Worksheet for Alkanes and Cycloalkanes hem 401 Lab Exercise #5 Nomenclature Worksheet for Alkanes and ycloalkanes Structure and Nomenclature of Alkanes Alkanes are saturated hydrocarbons; that is, they contain only and which are bonded solely

More information

Functional properties of fructans and their potential role in management of intestinal inflammatory pathologies

Functional properties of fructans and their potential role in management of intestinal inflammatory pathologies Functional properties of fructans and their potential role in management of intestinal inflammatory pathologies Dr.ssa Valentina Pasqualetti Unità di Ricerca di Scienze degli Alimenti e della Nutrizione

More information

1. The functional group present in carboxylic acids is called a A) carbonyl group. B) carboxyl group. C) carboxylate group. D) carbohydroxyl group.

1. The functional group present in carboxylic acids is called a A) carbonyl group. B) carboxyl group. C) carboxylate group. D) carbohydroxyl group. Name: Date: 1. The functional group present in carboxylic acids is called a A) carbonyl group. B) carboxyl group. C) carboxylate group. D) carbohydroxyl group. 2. Which of the following statements concerning

More information

Owen White Institute for Genome Sciences University of Maryland

Owen White Institute for Genome Sciences University of Maryland Owen White Institute for Genome Sciences University of Maryland hmpdacc.org Gevers D, Knight R, Petrosino JF, Huang K, et al. (2012) The Human Microbiome Project: A Community Resource for the Healthy Human

More information

Symptoms of CF. Ion Balance - CF patients can easily become dehydrated. This may result in cardiac arrythmias or arrest.

Symptoms of CF. Ion Balance - CF patients can easily become dehydrated. This may result in cardiac arrythmias or arrest. Symptoms of CF Digestive - Thick mucus clogs the pancreas preventing digestive enzymes from reaching the intestine. Results in failure to gain weight, vomiting, pain. Now patients take pancreatic digestive

More information

ESPEN guidelines in cystic fibrosis

ESPEN guidelines in cystic fibrosis ESPEN Congress Barcelona 2012 Achieving goals by guidelines: myth or reality? ESPEN guidelines in cystic fibrosis D. Turck (France) Guidelines on the nutritional support in cystic fibrosis WG D Turck (Lille,

More information

Radical and Cation Stabilities Radical vs cation stabilities

Radical and Cation Stabilities Radical vs cation stabilities Mass Spectrometry and Free Radicals MS recap Positive mode of Electron Ionization / ESI MS sees charged species (M+, M+), but does not see uncharged (R ) Radical and Cation Stabilities Radical vs cation

More information

Nomenclature. IUPAC nomenclature for organic chemistry

Nomenclature. IUPAC nomenclature for organic chemistry Nomenclature IUPAC nomenclature for organic chemistry What is IUPAC nomenclature? A systematic method of naming organic chemical compounds as recommended by the International Union of Pure and Applied

More information

Section des Unités de recherche. Evaluation report. Research unit Ecosystème Intestinal, Probiotiques, Antibiotiques. University Paris 5

Section des Unités de recherche. Evaluation report. Research unit Ecosystème Intestinal, Probiotiques, Antibiotiques. University Paris 5 Section des Unités de recherche Evaluation report Research unit Ecosystème Intestinal, Probiotiques, Antibiotiques University Paris 5 February 2009 Section des Unités de recherche Evaluation report Research

More information

Alcohols, phenols and ethers

Alcohols, phenols and ethers Alcohols, phenols and ethers Chapter 14 water alcohol ether without pain Opioid analgesics phenol ether ester amine alcohol Morphine Codeine Heroin Functional groups: collections of atoms that define a

More information

General Strategy For Naming Simple Organic Compounds (Bare bones summary sheets)

General Strategy For Naming Simple Organic Compounds (Bare bones summary sheets) General Strategy For aming Simple rganic ompounds (Bare bones summary sheets) 1. Find the highest priority group. These are listed in order of priority in the table of functional groups. 2. Find the longest

More information

Introduction to mass spectrometry (MS) based proteomics and metabolomics

Introduction to mass spectrometry (MS) based proteomics and metabolomics Introduction to mass spectrometry (MS) based proteomics and metabolomics Tianwei Yu Department of Biostatistics and Bioinformatics Rollins School of Public Health Emory University September 10, 2015 Background

More information

Diabetes may be classified as. i) Type - I Diabetes mellitus. Type - II Diabetes mellitus. Type - 1.5 Diabetes mellitus. Gestational Diabetes INSULIN

Diabetes may be classified as. i) Type - I Diabetes mellitus. Type - II Diabetes mellitus. Type - 1.5 Diabetes mellitus. Gestational Diabetes INSULIN HYPOGLYCEMIC AGENT Diabetes mellitus is a chronic metabolic disorder of multiple aetiology characterized by chronic hyperglycaemia with disturbances of carbohydrate, fat and protein metabolism resulting

More information

Guidelines for Writing a Scientific Paper

Guidelines for Writing a Scientific Paper Guidelines for Writing a Scientific Paper Writing an effective scientific paper is not easy. A good rule of thumb is to write as if your paper will be read by a person who knows about the field in general

More information

Methods to assess effects of prebiotics in humans

Methods to assess effects of prebiotics in humans Methods to assess effects of prebiotics in humans Lieselotte Cloetens 1,2, Willem F. Broekaert 3,4, Björn Åkesson 1, Gunilla Önning 1, Jan A. Delcour 3, Kristin Verbeke 2 1 Biomedical Nutrition, Pure and

More information

Package acide-amine.sty

Package acide-amine.sty Package acide-amine.sty This package provide commands who draw an amino acid. You will nd below the list of amino acids available. Molecules were initialy drawn by Florian Hollandt, see : http://www.texample.net/tikz/examples/author/florian-hollandt/

More information

Understanding Blood Tests

Understanding Blood Tests PATIENT EDUCATION patienteducation.osumc.edu Blood delivers oxygen and nutrients to all the parts of the body. It also carries away waste products. The heart pumps blood in your body through a system of

More information

Nature s Chemistry Chemistry of Cooking

Nature s Chemistry Chemistry of Cooking Cathkin High School CfE Higher Chemistry Nature s Chemistry Chemistry of Cooking Page 1 of 11 No. Learning Outcome Understanding? 1 Many flavour and aroma molecules are aldehydes. 2 Aldehydes and ketones

More information

E1. Write the structural formula of the heptane and 2,2,4-trimethylpentane molecules. EA1.

E1. Write the structural formula of the heptane and 2,2,4-trimethylpentane molecules. EA1. E1. Write the structural formula of the heptane and 2,2,4-trimethylpentane molecules. EA1. E2. What is the name of the straight-chain hydrocarbon that has same molecular formula as 2,2,4-trimethylpentane?

More information

Chemistry 110. Bettelheim, Brown, Campbell & Farrell. Introduction to General, Organic and Biochemistry Chapter 14 Alcohols, Ethers and Thiols

Chemistry 110. Bettelheim, Brown, Campbell & Farrell. Introduction to General, Organic and Biochemistry Chapter 14 Alcohols, Ethers and Thiols Chemistry 110 Bettelheim, Brown, Campbell & Farrell Ninth Edition Introduction to General, rganic and Biochemistry Chapter 14 Alcohols, Ethers and Thiols Alcohols have a ydroxyl Group, -, bonded to tetrahedral

More information

MIBIE Summer School 2014. Molecular diagnostics of UTI & STI by using PCR, DHPLC and NGS

MIBIE Summer School 2014. Molecular diagnostics of UTI & STI by using PCR, DHPLC and NGS MIBIE Summer School 2014 Molecular diagnostics of UTI & STI by using PCR, DHPLC and NGS Eugen Domann Institute for Medical Microbiology Justus-Liebig University Gießen Human microbiome 14 Superorganism

More information

Concept 5.4: Proteins include a diversity of structures, resulting in a wide range of functions

Concept 5.4: Proteins include a diversity of structures, resulting in a wide range of functions Concept 5.4: Proteins include a diversity of structures, resulting in a wide range of functions Proteins account for more than 50% of the dry mass of most cells Some proteins speed up chemical reactions

More information

Colonocyte telomere shortening is greater with dietary red meat than white meat and is attenuated by resistant starch

Colonocyte telomere shortening is greater with dietary red meat than white meat and is attenuated by resistant starch Colonocyte telomere shortening is greater with dietary red meat than white meat and is attenuated by resistant starch Nathan J. O Callaghan, Shusuke Toden, Anthony R. Bird, David L. Topping, Michael Fenech

More information

Fuels. sea bed. land. 7. When sulfur dioxide reacts with water in the atmosphere, acid rain is produced.

Fuels. sea bed. land. 7. When sulfur dioxide reacts with water in the atmosphere, acid rain is produced. Fuels 1. What is meant by the term fuel? 2. Name the gas required for a fuel to burn. 3. Give another name for burning. 3. What is meant by the term exothermic? 4. Oil is a fossil fuel. Name another two

More information

Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France

Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France Special Science Online Collec-on: Dealing with Data (feb 2011) DNA Protein TTGTGGATAACCTCAAAACTTTTCTCTTTCTGACCTGTGGAAAACTTTTTCGTTTTATGATAGAATCAGAGGACAAGAATAAAGA!

More information

Clinically Actionable Biomarkers in Rheumatoid Arthritis

Clinically Actionable Biomarkers in Rheumatoid Arthritis Clinically Actionable Biomarkers in Rheumatoid Arthritis PepTalk January 6, 2009 William Robinson, MD, PhD Stanford University School of Medicine VA Palo Alto Health Care System T cell mediated Autoimmune

More information

Forensic Science International

Forensic Science International Forensic Science International 186 (2009) 6 13 Contents lists available at ScienceDirect Forensic Science International journal homepage: www.elsevier.com/locate/forsciint Characterization of the volatile

More information

CfE Higher Chemistry Unit Two Nature s Chemistry Homework Booklet

CfE Higher Chemistry Unit Two Nature s Chemistry Homework Booklet Name: Reg: CfE Higher Chemistry Unit Two Nature s Chemistry Homework Booklet Topic Mark Page ) Esters, Fats and Oils 2 Teacher Comments: / 2) Proteins Teacher Comments: /7 6 3) Oxidation of Food Teacher

More information

Chemistry 1110 Organic Chemistry IUPAC Nomenclature

Chemistry 1110 Organic Chemistry IUPAC Nomenclature hemistry 1110 rganic hemistry IUPA Nomenclature 1 f the approximately 32 million unique chemical compounds presently known, over 95% of them can be classified as organic; i.e., containing carbon. The IUPA

More information

Nomenclature International Union of Pure and Applied Chemistry (IUPAC)

Nomenclature International Union of Pure and Applied Chemistry (IUPAC) Nomenclature International Union of Pure and Applied Chemistry (IUPAC) I. Alkanes A. Alkanes: Simple-Chain Alkanes consist of only hydrogen and carbon molecules and are known to be the simplest type of

More information

Introduction. Pathogenesis of type 2 diabetes

Introduction. Pathogenesis of type 2 diabetes Introduction Type 2 diabetes mellitus (t2dm) is the most prevalent form of diabetes worldwide. It is characterised by high fasting and high postprandial blood glucose concentrations (hyperglycemia). Chronic

More information

ProteinScape. Innovation with Integrity. Proteomics Data Analysis & Management. Mass Spectrometry

ProteinScape. Innovation with Integrity. Proteomics Data Analysis & Management. Mass Spectrometry ProteinScape Proteomics Data Analysis & Management Innovation with Integrity Mass Spectrometry ProteinScape a Virtual Environment for Successful Proteomics To overcome the growing complexity of proteomics

More information

Integrated Data Mining Strategy for Effective Metabolomic Data Analysis

Integrated Data Mining Strategy for Effective Metabolomic Data Analysis The First International Symposium on Optimization and Systems Biology (OSB 07) Beijing, China, August 8 10, 2007 Copyright 2007 ORSC & APORC pp. 45 51 Integrated Data Mining Strategy for Effective Metabolomic

More information

Concluding lesson. Student manual. What kind of protein are you? (Basic)

Concluding lesson. Student manual. What kind of protein are you? (Basic) Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:

More information

Regents Review Organic Worksheet Mr. Beauchamp

Regents Review Organic Worksheet Mr. Beauchamp Regents Review Mr. Beauchamp 1. Which general formula represents t he homologous serie s of hydrocarbons that includes the compound l-heptyne? 10. Which formula represents an unsatur ated hydrocarbon?

More information

Emission Testing February 2015 LMS Energy Pty Ltd - Jilliby Plant

Emission Testing February 2015 LMS Energy Pty Ltd - Jilliby Plant Page: 1 of 6 1/132 Ross Court Cleveland QLD 4163 Emission Testing February 2015 - Jilliby Plant Dear Nathan McClelland, Tests were performed 11 February 2015 to determine emissions to air from Unit 1 at

More information

Italian Food for Life

Italian Food for Life Presentazione della Piattaforma Tecnologica Nazionale Italian Food for Life BOLOGNA, 27 NOVEMBRE 2006 Italian Food for Life The Vision for 2020 and beyond Dr. Daniele Rossi Chairman of the Italian Technology

More information

Introduction to Chemical Biology

Introduction to Chemical Biology Professor Stuart Conway Introduction to Chemical Biology University of xford Introduction to Chemical Biology ecommended books: Professor Stuart Conway Department of Chemistry, Chemistry esearch Laboratory,

More information


UNIT (8) OXYGEN CONTAINING ORGANIC COMPOUNDS UNIT (8) XYGEN CNTAINING RGANIC CMPUNDS 8.1 Alcohols, Phenols, and Ethers An alcohol is an organic compound that contains the hydroxyl group (-) attached to an alkyl group. They are essentially alkanes

More information

U.S. Meat Animal Research Center Clay Center, NE

U.S. Meat Animal Research Center Clay Center, NE Agricultural Research Clay Center, NE The (USMARC) was authorized by Congress on June 16, 1964, following transfer of the Naval Ammunition Depot from the Department of Defense to the Department of Agriculture.

More information

Anaerobic degradation of gaseous alkanes by sulfate-reducing bacteria from marine gas and oil cold seeps

Anaerobic degradation of gaseous alkanes by sulfate-reducing bacteria from marine gas and oil cold seeps Anaerobic degradation of gaseous alkanes by sulfate-reducing bacteria from marine gas and oil cold seeps ISMOS 2015 Florin Musat Helmholtz entre for Environmental Research, Leipzig (Max Planck Institute

More information

Dietary emulsifiers impact the mouse gut microbiota promoting colitis and metabolic syndrome

Dietary emulsifiers impact the mouse gut microbiota promoting colitis and metabolic syndrome Dietary emulsifiers impact the mouse gut microbiota promoting colitis and metabolic syndrome Andrew T. Gewirtz et al N A T U R E VOL 519 5 M A R C H 2 0 1 5 Background Incidence of IBD Fact 1: increasing

More information

IUPAC System of Nomenclature

IUPAC System of Nomenclature IUPAC System of Nomenclature The IUPAC (International Union of Pure and Applied Chemistry) is composed of chemists representing the national chemical societies of several countries. ne committee of the

More information

Identifying Compounds by 2D Total Correlation Spectroscopy (TOCSY)

Identifying Compounds by 2D Total Correlation Spectroscopy (TOCSY) Identifying Compounds by 2D Total Correlation Spectroscopy (TOCSY) Michael Lewis, Pascal Mercier and Kathy Le Chenomx, Inc., Edmonton, AB, Canada Richard Taylor EWOS Innovation, Dirdal, Norway January

More information

Fermentation and Ester Taints. Anita Oberholster

Fermentation and Ester Taints. Anita Oberholster Fermentation and Ester Taints Anita Oberholster Introduction: Aroma Compounds Grape derived provide varietal distinction Yeast and fermentation derived Esters Higher alcohols Carbonyls Volatile acids Volatile

More information

Metabolic Disorders , The Patient Education Institute, Inc. idg90101 Last reviewed: 08/14/2014 1

Metabolic Disorders , The Patient Education Institute, Inc.  idg90101 Last reviewed: 08/14/2014 1 Metabolic Disorders Introduction Metabolism is the process your body uses to make energy from the food you eat. Your body can use this fuel right away, or it can store the energy in your body tissues,

More information

DEVELOPING WHEY-BASED INNOVATIVE BIOACTIVE INGREDIENTS. Éric Simard, Ph.D. Vice-President, Operations BiolActis, Canada

DEVELOPING WHEY-BASED INNOVATIVE BIOACTIVE INGREDIENTS. Éric Simard, Ph.D. Vice-President, Operations BiolActis, Canada DEVELOPING WHEY-BASED INNOVATIVE BIOACTIVE INGREDIENTS Éric Simard, Ph.D. Vice-President, Operations BiolActis, Canada Modus Operandi BiolActis commercializes innovative and clinically proven Whey-Based

More information

Guidance for Industry

Guidance for Industry Guidance for Industry Q3C Tables and List U.S. Department of Health and Human Services Food and Drug Administration Center for Drug Evaluation and Research (CDER) Center for Biologics Evaluation and Research

More information