Functional Conservation and Structural Diversification of Silk Sericins in Two Moth Species

Size: px
Start display at page:

Download "Functional Conservation and Structural Diversification of Silk Sericins in Two Moth Species"

Transcription

1 pubs.acs.org/biomac Functional Conservation and Structural Diversification of Silk Sericins in Two Moth Species Michal Zurovec, Barbara Kludkiewicz, Robert Fedic, Jitka Sulitkova, Vaclav Mach, Lucie Kucerova, and Frantisek Sehnal* Entomological Institute, Biology Centre ASCR, Branis ovska 31, C eske Bude jovice, Czech Republic S Supporting Information * ABSTRACT: Sericins are hydrophilic structural proteins produced by caterpillars in the middle section of silk glands and layered over fibroin proteins secreted in the posterior section. In the process of spinning, fibroins form strong solid filaments, while sericins seal the pair of filaments into a single fiber and glue the fiber into a cocoon. Galleria mellonella and the previously examined Bombyx mori harbor three sericin genes that encode proteins containing long repetitive regions. Galleria sericin genes are similar to each other and the protein repeats are built from short and extremely serine-rich motifs, while Bombyx sericin genes are diversified and encode proteins with long and complex repeats. Developmental changes in sericin properties are controlled at the level of gene expression and splicing. In Galleria, MG-1 sericin is produced throughout larval life until the wandering stage, while the production of MG-2 and MG-3 reaches a peak during cocoon spinning. INTRODUCTION considerable and reaches 20 30% by weight in the cocoons of the commercial silk producer, the silkworm, Bombyx mori.4,5 In contrast to the increasing amount of information on the fibroins, our knowledge of sericins is largely limited to B. mori. Sericins of this species form a group of four to six major polypeptides and several minor ones, with molecular masses ranging from 65 to 400 kda.6,7 They are encoded by at least three sericin genes (Ser1, Ser2, and Ser3). The diversity of sericin proteins derived from the Ser1 and Ser2 genes is increased by alternative splicing of the transcripts and potentially also by differential protein glycosylation.5 In an earlier study we isolated two partial cdnas derived from sericin-like genes MG-1 and MG-2 in the waxmoth, Galleria mellonella.8 Like in Bombyx sericin genes, the core of both Galleria cdnas consisted of repetitive sequences encoding putative serine-rich proteins, and both cdnas hybridized with more than one transcript. We therefore concluded that they were derived from sericin genes. The production of multiple sericins in lepidopteran species from different superfamilies (Pyraloidea and Bombycoidea, respectively) indicated that the basic design of silk fiber consisting of a fibroin core and sericin coating was widespread and possibly represented a plesiomorphic feature of Lepidoptera. This assumption was largely confirmed for the fibroins9 11 but not for sericins. Our study fills this gap. The hybridization of MG-1 and MG-2 cdnas to more than one MSG-specific and gene-specific transcripts in the Northern analysis indicated that the transcripts arose from alternative splicing. The MG-2 yielded two mrnas (3.4 and 5.2 kb) Lepidopteran silk is an externally spun fibrous protein secretion produced by caterpillars from a pair of labial glands.1 Comparison of silk proteins present in the cocoons of several lepidopteran species has shown that they could be divided into three main groups: fibrous, in water insoluble proteins called fibroins, hydrophilic sericins, and low molecular silk components.2 Fibroins, which include a heavy and a light chain fibroin and a presumable chaperon P25, are produced in the posterior section of silk glands (PSG) and stored in the middle section (MSG) where they are enveloped by sericin secretions. During silk spinning, the jellylike fibroins are converted into a solid, strong and extensible filament. Sericins seal the pair of filaments into a single fiber (Figure 1) and attach this fiber to a substrate or glue it into a cocoon wall or a similar silk structure.3 Low molecular weight proteins, such as seroins and protease inhibitors, are mostly produced in MSG and presumably protect the silk by their antimicrobial or antidigestive properties. The contribution of sericins to the secreted silk is Figure 1. (A) Photograph of a small area of unfinished Galleria cocoon; note that a pair of filaments is sealed into a single uninterrupted silk fiber (magnification 400 ). (B) Cross sections of a loose fiber and (C) of a fiber interconnection viewed in transmission electron microscope. F, filaments from fibroin proteins; S, sericin proteins; bar = 2 μm) American Chemical Society Received: February 15, 2013 Revised: March 28, 2013 Published: April 17,

2 present in the MSG from day 3 of the last larval instar to the end of the wandering stage. 8,12 The MG-1 hybridized with four mrnas (1.9 kb, 4.2 kb, and weak bands of approximately 7.2 and 10 kb). The 1.9 kb band was specific for the penultimate and early last larval instars, the 4.2 and 7.2 kb bands appeared later in the last larval instar and were dominant in the wandering and cocoon-spinning larvae. This remarkable switch in occurrence of the 1.9 and larger transcripts depended on changes in the juvenile and ecdysteroid hormone titers. 12 In this study we demonstrate that there are at least three major sericin genes in Galleria mellonella. They show mutual similarity in overall gene organization and in the amino acid sequences of encoded proteins. Due to considerable similarity of the coding sequences, the MG1 and MG3 transcripts crosshybridize. The genes MG-2 and MG-3 are arranged in tandem in the same DNA strand. Characterization of Galleria sericin genes is the first step in the elucidation of their physiological significance and in the deciphering of their evolutionary relationship to their Bombyx homologues. MATERIALS AND METHODS 1. Insects and Tissue Preparation. Culture of the waxmoth, Galleria mellonella L. (Lepidoptera, Pyralidae), was maintained at 30 C on a semiartificial diet. 13 The posterior (PSG) and the middle (MSG) parts of the silk glands were dissected from water-anesthetized penultimate or last instar larvae whose age was measured in days from the preceding ecdysis. Dissected tissues and body carcasses without silk glands were rapidly frozen in liquid nitrogen and stored at 80 C or used freshly after dissection. 2. Isolation of the cdnas and Genomic Clones. Total RNA was isolated from homogenized PSG, MSG or body carcass without silk glands using the TRIzol Reagent (Invitrogen, Carlsbad, CA). The RNA was further purified by NucleoSpin RNA II kit (Macherey-Nagel, Duren, Germany) including on-column digestion step with rdnase I. A total of 1 μg of total RNA was reverse transcribed at 42 C using oligo(dt) 17 and SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, CA). Galleria mellonella silk gland specific cdna library in λgt10 and the genomic library in λgem12 phage vector were described previously. 9 Both libraries were screened using hybridization with specific cdna probes under these conditions: hybridization at 65 C in 5 SSPE, 5 Denhardt s solution, and 0.5% SDS, with two subsequent washings in 2 SSPE, 0.1% SDS, and two washings in l SSC and 0.1% SDS, as described previously Northern Blotting. Aliquots of 5 μg total RNA were analyzed by agarose electrophoresis, blotted from the gel onto a nylon membrane (Hybond N) and hybridized to the cdna probes labeled with α- 32 P[dATP] under high stringency conditions described in the preceding paragraph regarding library screening. Northern blot signals were detected on X-ray film and quantified by densitometry using Image Quant software (Molecular Dynamics). 4. Rapid Isolation of cdna Ends by RACE PCR. The 5 end of MG-1 cdna was isolated with the aid of the 5 RACE kit (Life Technologies, cat# ) that included 5 forward primers AAP (Abridged Anchor Primer) and AUAP (Abridged Universal Amplification Primer). Three reverse MG-1 specific primers GSP1, GSP2, and GSP3 (Supporting Information, Table 1) were designed from the unique MG-1 sequence 8 located about 200 bp upstream from the poly(a) tail attachment. First strand cdna was synthesized from 3 μg total RNA in 25 μl reaction mixture using GSP1 primer. First of the two PCR reactions was performed using the Expand Long Template PCR system (Roche) with the GSP2 and AAP primers. The cycling conditions were 94 C, 2 min; 10 cycles 94 C, 10 s; 63 C, 30 s; 68 C, 8 s; 15 cycles 94 C, 10 s; 63 C, 30 s; 68 C, 8 s + 20 s/ cycle; 68 C, 7 min. For the second PCR reaction, we diluted previous PCR reaction mix 100 and used 5 μl for the nested PCR performed under the same conditions with primers GSP3 and AUAP. The 3 end of MG-3 was isolated by 3 RACE using an oligo(dt) adapter primer Trikant(T) (Supporting Information, Table 1). 14 The reverse transcription reaction was carried out at 42 C for 50 min followed by heat inactivation at 70 C for 15 min. The cdna product was diluted 10-fold, and 50 ng aliquots were used as templates for PCR amplification of the partial MG-3 sequence. The PCR procedure included 1 min at 94 C, 35 cycles of 30 s at 94 C, 25 s at 53 C, and 90 s at 72 C, followed by 10 min at 72 C for a final extension. The forward primers MG3Ex4F and MG3term2A were derived from the MG-3 sequence and Trikant adapter without the poly(t) tail was used as the reverse primer (Supporting Information, Table 1). 5. Real-Time RT-PCR. The qpcr was performed using the HOT FIREPol EvaGreen qpcr Mix Plus (Solis BioDyne, Tartu, Estonia). The PCR reaction volume of 20 μl contained 5 μl of diluted cdna and 250 nm primers. The amplification was carried out on the Illumina Eco Real-Time PCR System for 45 cycles (95 C for 15 s; annealing temperature adjusted to the primer pair for 30 s; 72 C for 20 s) following an initial denaturation/pol activation step (95 C for 15 min). Each sample was analyzed in triplicate. The primers (Supporting Information, Table 2) were designed with Lasergene PrimerSelect Software (DNASTAR, Madison, U.S.A.) to ensure that each amplicon was specific. The product size was confirmed by gel electrophoresis. The resultant data were analyzed and quantified utilizing Illumina EcoStudy software. Relative values were normalized to the actin and rp49 mrnas. Primer sequences were deduced from the Galleria actin gene, 15 from the highly conserved regions of the Drosophila rp49 gene 16 (GenBank No. NT_033777), and from Galleria sericin genes (Supporting Information, Table 2). 6. Localization of the Transcription Starts. The exact transcription start of the MG-2 gene was determined by primer extension. Synthetic oligonucleotide MG2PE complementary to the first exon (TTCACTGTAGCTCTTCTGG) was labeled at the 5 end with γ- 32 P[ATP]. This probe was hybridized to 10 μg of total RNA for 16 h at 32 C. The following extension reaction was carried out with murine leukemia virus reverse transcriptase (Invitrogen) for 2 h at 42 C. The prediction of the transcription start in MG-1, was performed in silico by using Promoter Prediction software at the Web site 7. Inverse PCR. We used the ipcr protocol according to Ochman et al. 17 Genomic DNA (300 ng) was cut with EcoRI (EcoRI restriction site resides in the first MG-1 intron) in 25 μl reaction mixture. An aliquot of 2.5 μl was diluted to 100 μl and used for ligation. PCR was performed with primers REX1 and Int1F (Supporting Information, Table 1) as follows: 35 cycles 94 C, 10 s; 63 C, 30 s; and 72 C, 60 s. The PCR reaction mix was subsequently diluted 50 and 5 μl aliquot was used for the nested PCR that was run under the same cycling conditions with REX1 primer and nested forward primer SINE (Supporting Information, Table 1). 8. DNA Mapping and Sequencing. Selected genomic and cdna clones were characterized with restrictases and the restriction fragments were subcloned in pbluescript SK(±) (Stratagene). PCR products were ligated into the pgem T-easy vector (Promega). Part of the nonrepetitive region was sequenced by primer walking. The templates were sequenced on the DNA sequencer ABI 310 (PerkinElmer Life Sciences) with the ABI Dye Terminator Cycle Sequencing Kit (Applied Biosystems). The DNA sequences were deposited in the GenBank with Accession No. KC for MG-1 and Accession No. KC for the MG-2 and MG-3 contigs. RESULTS 1. Structure of MG-1 Gene. A partial MG-1 cdna clone was isolated previously as a 510 nt fragment truncated at the 5 end and containing a poly(a) tract at the 3 end. 8 It hybridized with four mrnas (1.9, 4.2, 7, and 10 kb), suggesting that the MG-1 gene was large and its transcript underwent alternative splicing. In the present study we screened the silk gland specific cdna library from G. mellonella and isolated several partial MG-1 clones. They were all shorter than 1 kb, had a repetitive 1860

3 sequence at the 5 end and contained 3 end with a short poly(a) track. However, 5 RACE-PCR yielded a full-length cdna. Its 5 end included a putative methionine codon followed by a long ORF. The whole cdna was 1775 bp long and with a poly(a) tail it corresponded to the 1.9 kb mrna hybridizing with the MG-1 cdna probe. Subsequent attempts to isolate full lengths of the 4.2 kb and larger cdnas by 5 RACE failed but we detected an 0.5 kb splicing variant, designated MG1 7 that had escaped detection in our previous work (Figure 2). 8 The entire cdna sequence was amplified by PCR in order to confirm the ORF size (designated MG-1C in Figure 2). genomic sequence was 5461 bp (GenBank Accession No KC478777) and included the entire MG-1 gene (Figure 2). The MG-1 gene spanned 4623 bp and contained four exons, of which the first and the second contained 75 and 34 bp, respectively. The third exon included in the 1.9 kb mrna, contained 1651 bp and its part present in the 0.5 kb mrna encompassed 231 bp. This short mrna was produced by splicing exon three at a cryptic 3 splice site GTGGAG/ TTCCTGG that was similar to the splicing acceptor of exon 4 CCGCAG/TTCCGGA. The fourth exon of 206 bp included 46 bp coding sequence and 160 bp long 3 UTR with a poly(a) addition signal 18 nt upstream from the poly(a) attachment. ORF was characterized by a long repetitive region that began with a higher frequency of certain codons. Distinct repeats of 36 nt (TCAAGTAGTAACAATGGATCAAGCGGCAG- CAGTGGC) started with nucleotide 358 from the transcription start and continued up to nucleotide In the central part of the repetitive region, these repeats alternated with 39 nt repeats The introns were relatively long (1610, 235, and 832 nt, respectively) and the first and third contained a transposable element of about 300 nt. 2. Structure of the MG-2 Gene. A partial, 1.7 kb long cdna clone MG-2αβ (Figure 3), which had been isolated Figure 2. Restriction map and organization of the MG-1 gene. Exons (E1 E4) are represented as boxes: filled regions indicate coding parts, alternatively spliced part of exon 3 is shown in gray and the 3 UTR is indicated as an empty box. Restriction sites were mapped with enzymes EcoRI (R), EcoRV (V), and HindIII (H). Analyzed genomic clones (Gm8, Gm9, Gm10) and cdnas (MG1A, MG1C, MG1 7) are aligned below the gene map. Triangles depict the positions of transposons. To obtain genomic sequence of the MG-1 gene, we amplified two overlapping genomic DNA fragments by PCR with unique primers derived from the cdna (Supporting Information, Table 1). Combination of the sense primer MG1PE matching the very 5 end of the cdna with the antisense primer MG1XR derived from the nonrepetitive coding region, generated a 2000 bp PCR product called Gm8 (Figure 2). Its sequencing and comparison with cdna revealed that it included exons 1 and 2, two introns and the beginning of a third exon of the MG-l gene. The rest of the gene was amplified as a 2.7 kb long fragment Gm9 with the forward primer MG1F derived from the unique 5 end of the third exon and a reverse primer MG1R from the unique 3 UTR (Figure 2). The sequencing of Gm9 showed that it contained parts of the last two exons and the intercalated intron. Inverse PCR with reverse primer REX1 derived from the 5 end of the cdna, forward primer Int1F and nested forward primer SINE (Supporting Information, Table 1), yielded a single PCR product of 1.1 kb that contained 300 bp known from the genomic clone analysis and additional 800 bp that covered 5 end of the MG-1 gene and adjacent upstream region. The transcription start of MG-1 was predicted using the Neural Network Promoter Prediction software to be just 20 bp upstream from the 5 end determined by RACE PCR. The total length of 5 UTR (leader) sequence was 41 bp. Putative TATA box (TATATATA) was identified at position 30 to 23 from the transcription start. The total length of the identified Figure 3. Restriction map and organization of the MG-3 and MG-2 genes. Exons are represented as boxes: filled regions indicate the sequenced coding parts (unsequenced areas are hatched) and 3 UTRs are indicated by empty boxes. Only the penultimate (PE) and last exon (LE) of MG-3 and all four exons (E1 E4) of MG-2 were identified. Restriction sites included BamHI (B), EcoRV (V) and HindIII (H). Genomic clones Gm11 and Gm12, and the cdnas MG3E, MG2FL, and MG2αβ are aligned below the gene map. previously, 8 was used to screen our silk gland-specific cdna library. One of the detected cdna clones was almost 3 kb long and contained at its 5 end initiation codon of an ORF. A forward primer derived from the 5 end was used to prepare MG-2FL cdna (Figure 3) based on a fresh sample of silk gland RNA. MG-2FL included an initiation codon followed by a stretch of codons predicted to encode a signal peptide. The ORF continued at the 3 end of MG-2FL with serine-rich repeats typical for the MG-2 cdna found earlier. The sequence of kb in the central part of the repetitive region was not resolved. The length of the sequenced part of cdna was 3.5 kb and together with the unsequenced gap region and the poly(a) tail corresponded to the 4.2 kb MG-2 transcript. The MG-2αβ probe was also used to screen the genomic library of G. mellonella. A total of 12 hybridizing plaques were rehybridized with an MG-1 cdna fragment. Interestingly, phage clone named Gm11 gave a strong signal with both probes. Restriction digestion of the phage DNA revealed that the probes hybridized with different restriction fragments -5 end fragments hybridized with the MG-1 probe, while 1861

4 fragments derived from the 3 end of the Gm11 clone hybridized to the MG-2αβ and also MG-2FL cdnas. Sequencing confirmed that Gm11 contained DNA matching the MG-2 cdnas, including the serine-rich repetitive sequences. The clone ended with a nonrepetitive region close to the 3 end of the original 1.7 kb MG-2αβ cdna 8 lacking only a short part of the ORF encoding 49 C-terminal amino acids and the 3 UTR. The missing part of the gene was PCRamplified (fragment named Gm12) from the genomic DNA with primers MG2_3F and MG2βR2 that were derived from the 3 end of the Gm11 clone and from the 3 UTR (Supporting Information, Table 1) present in the MG-2αβ cdna (Figure 3). Primer extension was performed to detect the transcription start of the MG-2 gene. As shown in Figure 4, transcription Figure 4. Determination of the MG-2 transcription start site by primer extension analysis. The probe was hybridized to 10 μg of total RNA for 16 h at 32 C. The following extension reaction was carried out with murine leukemia virus reverse transcriptase (Invitrogen) for 2 h at 42 C. The template RNA was prepared from the middle section of silk glands taken from larvae 4 days after ecdysis into the last instar (lane 2). Yeast RNA was used as a control (lane 1). Primer extension products were analyzed in sequencing gel (8% polyacrylamide, 7 M urea) along with the C, T, A, and G Sanger sequencing reactions of the EcoRI-EcorV genomic subclone that was sequenced with the same primer. Band position corresponding to transcription start was marked as +1. started 27 nt upstream from the ATG codon (5 bp from the 5 end of MG-2FL cdna). The sequence upstream of the transcription start represented a promoter with the canonical TATA box (position 30 to 24). The entire MG-2 gene spanned almost 5300 bp (GenBank Accession No. KC478778) and contained four exons (Figure 3). General gene organization was similar to the MG-1 gene. The first exon of MG-2 contained 60 bp of which 27 represented 5 UTR and 33 belonged to the ORF. The second exon encompassed 34 nt, the third one about 2700 nt, and the fourth exon 614 nt, of which the last 202 represented the 3 UTR. The central repetitive sequence of the third exon was not fully resolved. A gap of about kb in the known sequence was flanked on either side with the same kind of repeats and it was therefore justified to assume that they continued through the nonsequenced area. Typical repeats had 27 nt (TCAAACAACGCCAGTAGTG- GAAGCAGC) but versions without the terminal AGC codon or with an additional AGC codon were also common. The introns 1 3 occupied 1244, 352, and 180 bp, respectively. All of the splice donor and acceptor sites complied with the GT/ AG rule for nucleotides immediately flanking exon borders. 18 The 3 untranslated region of 202 nt was AT-rich and contained a putative polyadenylation signal. 3. Detection of a Partial MG-3 Sequence. Detailed mapping and sequencing of the Gm11 genomic clone, which contained the MG-2 gene, showed that this clone also included a sequence similar to but nevertheless distinct from the MG-1 gene (Figure 3). Most of the sequence was composed of 18 nt repeats which were more than 80% identical to the repeats of MG-1 (see Discussion). Sequencing of the repetitive region caused considerable problems and approximately 1.2 kb gap remained unresolved. Because the repeats on both sides of the gap were very similar, we concluded that the missing part also contained this type of repeats and that we found another sericin gene that was named MG-3. To prove that MG-3 was a functional gene and to find out more about its structure we probed Galleria silk gland cdna library with the genomic MG-3 fragment, but all detected clones were partial cdnas of MG-1 (data not shown). Our attempts to use 5 RACE-PCR also failed because of lack of unique sequences close to the 5 end of the known MG-3 region. However, unique sequences flanking the 3 end of the MG-3 repeats were suitable for the 3 RACE-PCR employing oligo(dt) primer with an adapter for reverse transcription. The desired cdna was amplified with the forward MG-3 specific primer MG3Ex4F (derived from the putative MG-3 coding region) and an adapter primer without the poly(dt) tail (Supporting Information, Table 1). We received a 0.9 kb PCR fragment containing a short poly(a) tail and a sequence homologous to the known MG-3 genomic sequence, except for a 86 bp track that was missing in the amplified fragment. This deletion corresponded to an intron specified in the genomic sequence by the canonical GT-AG junction dinucleotides. Further sequence analysis confirmed that the cdna matched parts of the last two exons of the MG-3 gene. Most of the ORF consisted of repeats such as AATGGTTCAAGTAGCAGC, which were similar to the MG-1 repeats. The sequence of MG- 3 was deposited in GenBank under Accession No. KC It must be mentioned that the 3 end primed with the oligo(dt) primer in the reverse transcription reaction yielded a product with a short poly(a) tail. We found a 12 nt poly(a) track in the same position in the genomic sequence 559 nt downstream of the termination codon. This finding suggests that the real polyadenylation site of MG-3 was further downstream and that the oligo(dt) primer hybridized with a poly(a) track inside the 3 UTR of MG-3. We cannot exclude that the MG-3 mrnas has a longer 3 UTR than 559 nt. 4. MG-1, MG-2, and MG-3 Specific Transcripts. Northern blot analysis of fresh RNA isolated from three different MSG compartments of the mixed last instar larvae (Figure 5A) and from the PSG, MSG, and remaining carcass of the feeding last instar larvae (Figure 5B) confirmed our previous findings. 8,12 Three mrnas of about 1.9, 4.2, and 7 kb (weak band) hybridized in MSG with the MG-1 probe (Figure 5A); the 0.5 kb transcript was not visible but was detected in younger larvae of the last instar (Figure 5B). Hybridization with the MG-3 cdna produced identical pattern of transcripts as the MG-1 probe, except for the 7.2 kb band which was more visible with the MG-3 probe (Figure 5A). The MG-2 probe hybridized strongly with a band that represented the 3.5 kb MG-2 mrna (Figure 5B). 1862

5 Figure 5. (A) Hybridization of MG-1 and MG-3 cdnas to 5 μg total RNA isolated from the anterior (lane A), central (lane B) and distal (lane C) sections of the middle silk gland region of the fully grown larvae. (B) Hybridization of MG-1 and MG-2 cdnas to 5 μg total RNA prepared from the posterior silk gland region (lane P), middle silk gland region (lane M) and body carcass without silk glands of feeding last instar larvae. Positions of RNA ladder are depicted by arrows. Based on our mapping and sequencing data described above we predicted that the MG-1 gene encoded 1.9 and 0.5 kb transcripts produced by alternative splicing and could not generate mrnas larger than 1.9 kb. However, the MG-3 gene could be responsible for the production of the larger transcripts, such as the 4.2 kb mrna. To get more insight into the expression profiles of the genes, quantitative reverse transcription real-time PCR was performed with gene-specific primer pairs that amplified a 150 nt fragment of MG-1, 211 nt of MG-2, and 416 nt of the MG-3 transcripts. Developmental changes in the contents of the MG-1 and MG-3 specific transcripts (Figure 6A) were compared with developmental profiles of the 1.9 and 4.2 kb mrnas (Figure 6B) detected earlier with the Northern analysis. 11 The Figures show that changes in the content of MG-1 transcripts from the penultimate larval instar until pupation were almost identical with the expression profile of the 1.9 kb transcript. Maximum content of the 1.9 kb mrna visualized on the Northern blots and maximum MG-1 expression determined by qpcr were observed at the beginning of the last larval instar (VII/1 = first day of the last, seventh instar). The content of this mrna declined in the postfeeding wandering larvae (VII/6) at the start of cocoon spinning (C1) and virtually disappeared in the prepupae (VII/7 and VII/8), that is, at the time (C2) or after cocoon completion (C3). In contrast to MG-1, the expression profile of MG-3 measured by qpcr (Figure 6A) and the intensity of Northern analysis of the 4.2 kb transcript (Figure 6B) reached their maxima after feeding termination at VII/6, that is, the early stage of cocoon spinning (C1). The 4.2 kb product was detectable until the silk glands began to disintegrate at VII/8 (= C3). These results demonstrated that the MG-1 gene generated the 1.9 kb mrna, while the 4.2 kb mrna was most probably derived from the MG-3 gene, and that the genes differed in the developmental profiles of their expressions. The expression of the 3.5 bp MG-2 mrna showed yet another pattern (Figure 6C). It was undetectable in the penultimate instar larvae, increased slowly during feeding and rapidly in the postfeeding last instar larvae, and rose abruptly to a peak in the early phase of cocoon spinning. 5. Putative MG-1, MG-2, and MG-3 Proteins. The MG-1 seems to be the smallest of the three Galleria sericin genes. Two MG-1 mrna variants were products of alternative splicing. The larger mrna contained an ORF encoding 567 amino acids that made up a 47.8 kda preprotein. The smaller 1863 Figure 6. (A, C) Developmental profiles of sericin genes expression determined by qpcr. Data were analyzed and quantified with Illumina EcoStudy software. Relative values were normalized to the actin and rp49 mrnas and are presented as means and SEM from 3 independent biological samples. (B) Expression profiles of 1.9 and 4.2 kb transcripts hybridizing with both MG-1 and MG-3 probes. Northern blot bands 8 were detected with autoradiography using X-ray film, scanned, and quantified using ImageQuant software (Molecular Dynamics). Developmental stages of silk gland donors: VI/3, day 3 of the VIth (penultimate) larval instar; VII/x, indicated days of the last instar; W, wandering period (ca. VII/5), C1 cocoon spinning (ca. VII/ 6); C2, late cocoon spinning (ca. VII/7); C3, cocoon completion (ca. VII/8). mrna encoded 138 residues of a 13.6 kda preprotein. Both preproteins had an identical N-terminus of 99 amino acid residues (Supporting Information, Figure 1). The signal peptide cleavage site was determined with Signal Pv1.1 software 19 between Gly and Val in positions 18 and 19 from the initial Met. In the 47.8 kda MG-1 protein, the nonrepetitive N-terminal region was followed by the long region built from simple GSS motif, which was in regular intervals extended to GSSS or GSSSS. The region of amino acid repeats began with SGVPGN and continued with slightly modified motifs such as SGSSGS, SGSSSN, or NGSSGS. These motifs made up 17 higher order repeats, each of 12 and exceptionally 13 amino acids NGSSGSSGSS(S)SN (Supporting Information, Figure 1). One Asn was missing in repeat number 30 and both in the last five repeats GSSGSSGSSGSS. Several degenerate GSS motifs could be recognized in the nonrepetitive C-terminus of 37 residues. The putative MG-1 protein lacked acidic amino acids and had an isoelectric point of 11.0 and a charge of 1.9 at ph 7.0. Major MG-1 amino acids were Ser 54.5%, Gly 23.1%,

6 Table 1. Characteristic Features of the G. mellonella and B. mori Sericin Genes and Their Putative Products a Gene b No. of exons Exon 1 product Exon 2 product % amino acid residues (>5%) No. of repeats residues per repeat MG-1 4 MKFTLALVFVA AFVAVQGVPFP 54.5 S, 23.1 G, 11.1 N (13) MG-2 4 MKFTVALLVIA AFVAVQAAPRA 59.9 S, 17.5 N, 8.9 G 71 8 (9,10) MG-3 2?? 52.4 S, 14.6 N, 14.1 G 39 6 Ser1 9 MRFVLCCTLIALA ALSVKAFGHH 30.7 S, 10.8 G, 9.4 T, 7.1 D, 7.1 A, 5.0 N Ser2 13 MKIPYVLLFLV WAVAVVNLPNP 17.1 K, 15.1 S, 11.7 D, 11.1 E, 5.8 T, 5.6 P 44 15, 7 11 Ser3 3 MNCKVALFLIV AIVAVQALPC 43.6 S, 12.0 G, 6.7 N, 5.5 Q, 5.3 D 10 86, a Single letter abbreviations are used for amino acid residues. b Data were taken from following GenBank references: KC (MG-1), KC (MG-2 and MG-3), NM_ (Ser1), NM_ (Ser2), and NM_ (Ser3), respectively. Figure 7. Nucleotide sequence alignment of parts of the MG-1, MG-2, and MG-3 repetitive regions (numbers on the left refer to the positions in sequences deposited to the GenBank with Accession No. KC for MG-1 and KC for MG-2 and MG-3). and Asn 11.1%. In the shorter, 13.6 kda variant of MG-1, the N-terminal region (99 residues) identical to the one in the long preprotein, was followed by a unique sequence of 35 amino acids that were encoded by a shifted reading frame in the last exon. Short MG-1 protein had an isoelectric point of 8.6 and a charge of 0.9 at ph 7.0. The conceptual translation of the analyzed MG-2 ORF region (2775 bp) yielded an 84.5 kda protein, but since there was an unsequenced gap of bp, the entire putative MG-2 protein would probably be over 100 kda. Similar to the MG-1 preprotein, the N-terminal signal peptide was predicted to be 18-residues long (Supporting Information, Figure 1). Both ends of the mature protein were composed of nonrepetitive serine-rich sequences, whereas the major central region was made up of repeats. The nonrepetitive sequence following the signal peptide contained stretches of Ser (up to 10 residues long) that were intercalated with other residues, most often either hydrophobic (Leu, Ala, Iso) or charged (Asn, Gln, Glu). Regular motifs NSSGSS and SGSSSN began to appear in position 140 of the mature peptide. Higher order repeats such as NSSGSSSSNNSSGSSSSN were found in more than 30 iterations in the sequenced 5 end and in nearly 40 copies in the sequenced 3 end of the MG-2 cdna (Supporting Information, Figure 1). The repeats became irregular about 155 amino acid residues before the C-terminus and disappeared in the stretch of the last 124 residues. This nonrepetitive C-terminal region contained clusters of Ser (up to 13) separated by diverse residues. They included charged residues (Asp, Asn, Glu, Gln) similar to the C-terminal nonrepetitive region of MG-1. The analyzed part of the putative MG-2 protein contained in total 59.9% Ser, 17.5% Asn, and 8.9% Gly. The net charge at ph 7 was +9.1 and the isoelectric point was 4.0. MG-2 contained 14 putative N-glycosylation sites. The size of the deduced MG-3 translational product was not established; 1230 bp of the ORF and 795 bp of the untranslated 3 end of this gene were analyzed, whereas about 1200 bp from the central repetitive region and up to 900 bp of the 5 region remained unknown. The sequenced region of the MG-3 gene probably represented about 37% of the estimated size of the 4.2 kb MG-3 transcript. The repetitive structure of the putative MG-3 protein was reminiscent of MG-1 due to the presence of GSSSSN, NGSSGS, SGSSSS and similar motifs that formed higher order repeats such as NGSSSSSGSSSS (Supporting Information, Figure 1). However, the repeats of MG-3 often contained larger amino acid residues, including Ile, Val, Arg, and Asp. Analyzed regions of MG-3 contained 52.4% Ser, 14.6% Asn, and 14.1% Gly; the representation of other amino acids was low. Predicted MG-3 protein had isoelectric point of 4.1 and a charge of 8.1 at ph 7.0. DISCUSSION 1. There Are at Least Three Sericin Genes in Galleria mellonella. In our previous study we isolated partial cdna 1864

7 clones derived from two Galleria sericin genes designated MG- 1 and MG-2. They were distinguished by differential hybridization and seemed to represent the most abundant class of MSG-specific transcripts. 8 The MG-1 probe hybridized in Northern blots with 1.9 and 4.2 kb transcripts, and in the larvae of the wandering stage we could detect weaker bands of 7.2 kb and approximately 10 kb. The MG-2 probe hybridized strongly with a 3.5 kb and in the last instar larvae also faintly with a 5.2 kb transcript. Despite the multiple hybridizing bands in the genomic Southern blots it was concluded that MG-1 and MG-2 were large single copy genes with multiple exons, 8 like the Bombyx genes Ser1 and Ser2. 20,21 In the present study we demonstrate that MG-1 is a relatively small gene producing the 1.9 kb mrna and also a previously undetected 0.5 kb mrna. We also provide evidence that there is another closely related sericin gene, designated MG-3, that cross-hybridizes with MG-1 and which is responsible for the production of the 4.2 kb mrna. The MG-3 may also generate the larger mrnas (7.2 and 10 kb) that cannot be derived from the small MG-1 gene. These transcripts may represent less frequent alternatively spliced MG-3 mrnas or mrna products of a related and hitherto unknown sericin gene. Our recent analysis further confirms that the 3.5 kb, but not the 5.2 kb transcript, is derived from the MG-2 gene. The identity of the minor 5.2 kb transcript remains uncertain; it is detectable with the MG-2 probe, but it is larger than the predicted maximal size of the MG-2 mrna. It may be an incompletely spliced MG-2 product or product of a related, larger gene. 2. Relationship between the Sericin Genes of Galleria and Bombyx. The MG-1 and MG-2 (and presumably also MG-3) genes share a strikingly similar structural organization of four exons. Considerable parts of the MG-1 and MG-2 genes are occupied by long second intron, and each of the first two exons encodes 11 amino acids in sequences similar in the two genes (Table 1). The ORF extending over the large third and the medium-size fourth exons contains a very long repetitive region built of similar 36 and 18 nt repeats in MG-1 and MG-3, and related nt repeats in MG-2. The sequences of ORFs are remarkably similar (Figure 7). The repetitive sequences of MG-1 and MG-3 DNA show almost 80% identity in a stretch of 350 nt; MG-2 and MG-3 regions are 57% and those of MG-1 and MG-2 are 58% identical. In contrast, the three Bombyx sericin genes, Ser1, Ser2, and Ser3, are mutually diversified (Table 1). Except for some similarity in the first two short exons, the number and sizes of other exons as well as the characters of repeats are very different (Table 1). The Ser1 gene includes nine exons and generates four alternatively spliced mrnas. 22 The large exon 6, presumably containing repeats, has not been sequenced. The short exon 7 and the medium-length exon 8 encode repeats SSTSGGTSTYGYSSSHRGGSVSSTGSSSNTDSSTKNAG. 21 The gene Ser2 contains 11 exons, but some of them (notably exons 9 and 10) are partially duplicated. 20,23 Translation products of Ser2 include several types of repeats: KFENLDKDNVCE from exon 3, TEKAKPNDSSPSHKD from exon 8, and RSPSHKDTEKAKPND from exon 9. The Ser3 gene contains short exons 1 and 2 and a long exon 3 that encodes 10 repeats of 86 amino acid residues (45% is Ser) and 18.5 reiterations of a variable octapeptide motif SSSSKQAS. 24 It is obvious that none of the Bombyx sericin genes resembles the sericin genes of Galleria. We cannot exclude that there are more sericin genes in Bombyx and Galleria Their discovery could shine more light on the sericin gene evolution. Available data, notably the arrangement of the first two exons (Table 1), the expression in MSG, and the identical function suggest that sericin genes originated in a distant ancestor of both species but underwent profound species-specific diversification, which was accelerated by the presence of repetitive DNA regions. The diversification was faster in Bombyx sericin genes that are prone to rapid rearrangements. There is an especially high level of polymorphism in the number and size of exons in the Ser2 gene. 23 The conserved overall structure in Galleria sericin genes may result from the concerted evolution of this gene family and it may indicate their recent origin from a single ancestor gene. The second scenario would involve a duplication of sericin genes. 3. Importance of Differential Gene Expression and Splicing for Sericin Function. Major function of silk in most Lepidoptera is the formation of cocoon at the end of larval development, yet silk may fulfill other functions earlier in larval life. Galleria larvae live in bee colonies and may be attacked by bees. Their defense lies in the production of silk tubes in which they move without attracting attention of the bees. 13 They spin these extensible tubes (the larva must be able to turn around in a tube of a similar diameter as its body) from the beginning of the second larval instar until they stop feeding before pupation in the seventh instar. Later on, they produce sticky silk fiber for cocoon attachment and eventually spin the cocoon. Unlike spiders, which have several types of glands and produce functionally different types of fibers due to expression of different genes, 25 caterpillars possess a single pair of silk glands and the fibroin composition of the silk filaments is not flexible. Functional variability of lepidopteran silk is largely due to the composition of sericins. The expression profile and the splicing of sericin genes were shown to change during the transition from larval growth to metamorphosis in both Bombyx 22,26 and Galleria. 12 The timing and the site of secretion in MSG determine if the respective sericin will be deposited adjacent to the central fibroin filament (sericins produced early and/or in the distal section of MSG) or in the more external sericin layers (late secretion in the proximal MSG section). Ordered sericin layering was described in Bombyx, 22 and profound developmental changes in the pattern of MG transcripts indicate that it also occurs in Galleria. For example, the MG-1 gene expression stops at the end of feeding, so that the MG-1 protein products are unlikely to occur in the cocoon silk. On the other hand, the 4.2 and 7.2 kb MG-3 mrnas, as well as the 3.5 kb MG-2 transcripts, become very prominent in the postfeeding larvae at the start of cocoon spinning. In Bombyx, the major sericins of larval silk are highly adhesive 230 and 120 kda products of the Ser2 gene. They seem to be responsible for firm cocoon attachment to a substrate 23 and are not present in the cocoon silk Specific Features of Galleria Sericins. Galleria sericin proteins differ from other known silk proteins due to their very high proportion of Ser (more than 50%), Asn ( %), and Gly ( %) in the characteristic repeats. No similar proteins are known from animals and the similarities with proteins from other organisms reflect the high proportion of Ser rather than specific sequence features. Search in the GenBank identified 30% identity (6e 42 ) of MG-1 with a hypothetical membrane spanning protein of Bacillus cereus (Accession No. ZP ) and similar relationship of MG- 2 (48% identity, 5e 07 ) to the K7_05502p protein from Saccharomyces cerevisiae (Accession No. GAA ). Inter- 1865

8 estingly, Galleria fibroin also contains a high proportion of Ser residues: 18.1% compared to 12.1% and 11.3% in the fibroins of Bombyx mori and Antheraea pernyi, respectively. 9 Serine was shown to form intermolecular hydrogen bonding imposing β- sheet conformation in suitable silk protein regions. 28 It is possible that hydrogen bridges are formed between Ser residues present in the fibroin and those in the sericin proteins. If this is so, the proportion of serine residues and their combination with other amino acid residues in the repeats, might be driven by a coevolution of fibroins and sericins. CONCLUSIONS Silk produced by caterpillars consists of two core filaments made of three fibroin proteins secreted in the posterior region of the tubular silk glands, and of sericin proteins that seal the filaments into a single fiber, enable fiber attachment to substrates and glue fibers into a cocoon contexture. Three sericin genes were identified earlier in the silkworm, Bombyx mori. The Ser-1 and Ser-2 genes have 9 and 11 exons, respectively, and produce several mrnas by alternative splicing. The Ser-3 has only three exons and generates a single type of mrna. The protein products of all three genes contain regions composed of amino acid repeats. The size of proteins and the length and sequence of the repeats are specific for each of the three genes. On the basis of this information it seemed that a complex mix of proteins was required for sericin adhesiveness. However, this study demonstrates that the waxmoth, Galleria mellonella, contains three sericin genes like the silkworm but the gene structure and the composition of encoded proteins are very different in the two species. Galleria sericin genes MG-1 and MG-2 contain four exons (so far only two are known in MG-3); all three genes generate proteins composed largely of reiterations of short and extremely serinerich motifs, which include sequence variants such as NGSSGS, NSSGSS, GSSSSN, and SGSRSS. The genes are differentially expressed during development, suggesting that the composition of sericin secretion changes to meet specific needs of each developmental stage. In spite of the great diversification of the sericin genes and proteins between Galleria and Bombyx, both species use their sericins equally efficiently for silk fiber formation from two filaments and for cocoon construction from the fiber. ASSOCIATED CONTENT *S Supporting Information The sequences of primers used in this study and their positions in the respective genes, and deduced amino acid sequences encoded by the three sericin genes. This material is available free of charge via the Internet at AUTHOR INFORMATION Corresponding Author * Notes The authors declare no competing financial interest. ACKNOWLEDGMENTS The work was supported by Grant P502/10/2382 from the Czech Science Foundation. REFERENCES (1) Lucas, F.; Rudall, K. M., Extracellular fibrous proteins: The silks. In Comprehensive Biochemistry; Florkin, M., Slota, E.H., Eds.; Elsevier: Amsterdam, 1968; 26B, (2) Sehnal, F.; Zurovec, M. Biomacromolecules 2004, 5, (3) Sehnal, F.; Akai, H. Int. J. Insect Morphol. Embryol. 1990, 19, (4) Michaille, J. J.; Couble, P.; Prudhomme, J. C.; Garel, A. Biochimie 1986, 68, (5) Prudhomme, J. C.; Couble, P.; Garel, J. P.; Daillie, J. Silk synthesis. In Comprehensive Insect Physiology, Biochemistry and Pharmacology; Kerkut, G. A., Gilbert, L. I., Eds.; Pergamon Press: Oxford, 1985; Vol. 10, pp (6) Gamo, T.; Inokuchi, T.; Laufer, H. Insect Biochem. 1977, 7, (7) Takasu, Y.; Yamada, H.; Tsubouchi, K. Biosci. Biotechnol. Biochem. 2002, 66, (8) Zurovec, M.; Sehnal, F.; Scheller, K.; Kumaran, A. K. Insect Biochem. Mol. Biol. 1992, 22, (9) Zurovec, M.; Sehnal, F. J. Biol. Chem. 2002, 277, (10) Yonemura, N.; Sehnal, F. J. Mol. Evol. 2006, 63, (11) Collin, M. A.; Mita, K.; Sehnal, F.; Hayashi, C. Y. J. Mol. Evol. 2010, 70, (12) Yang, C. S.; Sehnal, F.; Scheller, K. Arch. Insect Biochem. Physiol. 1996, 32, (13) Sehnal, F. Z. Wiss. Zool., Abt. A 1966, 174, (14) Fedic, R.; Zǔrovec, M.; Sehnal, F. J. Biol. Chem. 2003, 278, (15) Clermont, A.; Wedde, M.; Seitz, V.; Podsiadlowski, L.; Lenze, D.; Hummel, M.; Vilcinskas, A. Biochem. J. 2004, 382, (16) Reese, M. G. Comput. Chem. 2001, 26, (17) Ochman, H.; Gerber, A. S.; Hartl, D. L. Genetics 1988, 120, (18) Mount, S. M.; Burks, C.; Hertz, G.; Stormo, G. D.; White, O.; Fields, C. Nucleic Acids Res. 1992, 20, (19) Nielsen, H.; Engelbrecht, J.; Brunak, S.; vonheijne, G. Protein Eng. 1997, 10, 1 6. (20) Michaille, J. J.; Garel, A.; Prudhomme, J. C. Gene 1990, 86, (21) Garel, A.; Deleage, G.; Prudhomme, J. C. Insect Biochem. Mol. Biol. 1997, 27, (22) Couble, P.; Michaille, J. J.; Garel, A.; Couble, M. L.; Prudhomme, J. C. Dev. Biol. 1987, 124, (23) Kludkiewicz, B.; Takasu, Y.; Fedic, R.; Tamura, T.; Sehnal, F.; Zurovec, M. Insect Biochem. Mol. Biol. 2009, 39, (24) Takasu, Y.; Yamada, H.; Tamura, T.; Sezutsu, H.; Mita, K.; Tsubouchi, K. Insect Biochem. Mol. Biol. 2007, 37, (25) Craig, C. L. Annu. Rev. Entomol. 1997, 42, (26) Ishikawa, E.; Suzuki, Y. Dev. Growth Differ. 1985, 27, (27) Takasu, Y.; Hata, T.; Uchino, K.; Zhang, Q. Insect Biochem. Mol. Biol. 2010, 40, (28) Huang, J.; Valluzzi, R.; Bini, E.; Vernaglia, B.; Kaplan, D. L. J. Biol. Chem. 2003, 278,

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Mir-X mirna First-Strand Synthesis Kit User Manual

Mir-X mirna First-Strand Synthesis Kit User Manual User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

CompleteⅡ 1st strand cdna Synthesis Kit

CompleteⅡ 1st strand cdna Synthesis Kit Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:

More information

RevertAid Premium First Strand cdna Synthesis Kit

RevertAid Premium First Strand cdna Synthesis Kit RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent

More information

Real-time quantitative RT -PCR (Taqman)

Real-time quantitative RT -PCR (Taqman) Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR

More information

All in One First Strand cdna Synthesis Kit For reliable first strand cdna synthesis from all RNA sources

All in One First Strand cdna Synthesis Kit For reliable first strand cdna synthesis from all RNA sources All in One First Strand cdna Synthesis Kit For reliable first strand cdna synthesis from all RNA sources Cat. No. AORT 0020 Cat. No. AORT 0050 (20 synthesis reactions) (50 synthesis reactions) User Manual

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

AffinityScript QPCR cdna Synthesis Kit

AffinityScript QPCR cdna Synthesis Kit AffinityScript QPCR cdna Synthesis Kit INSTRUCTION MANUAL Catalog #600559 Revision C.01 For In Vitro Use Only 600559-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

Design of conditional gene targeting vectors - a recombineering approach

Design of conditional gene targeting vectors - a recombineering approach Recombineering protocol #4 Design of conditional gene targeting vectors - a recombineering approach Søren Warming, Ph.D. The purpose of this protocol is to help you in the gene targeting vector design

More information

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR BioTechniques 25:415-419 (September 1998) ABSTRACT The determination of unknown DNA sequences around

More information

Reverse Transcription System

Reverse Transcription System TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

PrimeSTAR HS DNA Polymerase

PrimeSTAR HS DNA Polymerase Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh

More information

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

All-in-One First-Strand cdna Synthesis Kit

All-in-One First-Strand cdna Synthesis Kit All-in-One First-Strand cdna Synthesis Kit For reliable first-strand cdna synthesis from all RNA sources Cat. No. AORT-0020 (20 synthesis reactions) Cat. No. AORT-0050 (50 synthesis reactions) User Manual

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination

More information

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

Path-ID Multiplex One-Step RT-PCR Kit

Path-ID Multiplex One-Step RT-PCR Kit USER GUIDE Path-ID Multiplex One-Step RT-PCR Kit TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets Catalog Numbers 4428206, 4428207, 4440022 Publication Part Number 4440907

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

Gene Expression Assays

Gene Expression Assays APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION

Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name sorbin and SH3 domain containing 2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORBS2 Human Arg and c-abl represent the mammalian

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

Validating Microarray Data Using RT 2 Real-Time PCR Products

Validating Microarray Data Using RT 2 Real-Time PCR Products Validating Microarray Data Using RT 2 Real-Time PCR Products Introduction: Real-time PCR monitors the amount of amplicon as the reaction occurs. Usually, the amount of product is directly related to the

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

Description: Molecular Biology Services and DNA Sequencing

Description: Molecular Biology Services and DNA Sequencing Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:

More information

Application Guide... 2

Application Guide... 2 Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied

More information

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Chapter 9 Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Q&A Interferons are species specific, so that interferons to be used in humans must be produced in human cells. Can you think

More information

Real-Time PCR Vs. Traditional PCR

Real-Time PCR Vs. Traditional PCR Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl

RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl

More information

QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.

QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency. QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise: HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone

More information

Lecture 4. Polypeptide Synthesis Overview

Lecture 4. Polypeptide Synthesis Overview Initiation of Protein Synthesis (4.1) Lecture 4 Polypeptide Synthesis Overview Polypeptide synthesis proceeds sequentially from N Terminus to C terminus. Amino acids are not pre-positioned on a template.

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS

STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS THESIS SUBMITTED FOR THE DEGREB OF DOCTOR OF PHILOSOPHY (SCIENCE) OF THE UNIVERSITY OF CALCUTTA 1996 NRISINHA DE, M.Sc DEPARTMENT OF BIOCHEMISTRY

More information

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc. New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System

More information

MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C

MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr

More information

Methods for Protein Analysis

Methods for Protein Analysis Methods for Protein Analysis 1. Protein Separation Methods The following is a quick review of some common methods used for protein separation: SDS-PAGE (SDS-polyacrylamide gel electrophoresis) separates

More information

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic

More information

A. 'Hypersensitive' peptide bonds and autodegradation of proteins

A. 'Hypersensitive' peptide bonds and autodegradation of proteins ABSTRACT A. 'Hypersensitive' peptide bonds and autodegradation of proteins Several pure proteins, which gave a single band on electrophoretic analysis, when stored for a long time, were found to be partially

More information

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory.

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory. BIOTECHNOLOGY Levels: 11-12 Units of Credit: 1.0 CIP Code: 51.1201 Prerequisite: Biology or Chemistry Skill Certificates: #708 COURSE DESCRIPTION is an exploratory course designed to create an awareness

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

Global MicroRNA Amplification Kit

Global MicroRNA Amplification Kit Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in

More information

Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes

Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium

More information

qstar mirna qpcr Detection System

qstar mirna qpcr Detection System qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Stephen B. Gruber, MD, PhD Division of Molecular Medicine and Genetics November 4, 2002 Learning Objectives Know the basics of gene structure, function and regulation. Be familiar

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

The world of non-coding RNA. Espen Enerly

The world of non-coding RNA. Espen Enerly The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often

More information

How is genome sequencing done?

How is genome sequencing done? How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step

More information

Protein Purification and Analysis

Protein Purification and Analysis Protein Purification and Analysis Numbers of genes: Humans ~40,000 genes Yeast ~6000 genes Bacteria ~3000 genes Solubility of proteins important for purification: 60-80% soluble, 20-40% membrane Some proteins

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Biotechnology and Recombinant DNA

Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Recombinant DNA procedures - an overview Biotechnology: The use of microorganisms, cells, or cell components to make a product. Foods, antibiotics, vitamins, enzymes Recombinant

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins

IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon A. Acid/Base properties 1. carboxyl group is proton donor! weak acid 2. amino group is proton acceptor! weak base 3. At physiological ph: H

More information

Competitive PCR Guide

Competitive PCR Guide Lit. # L0126 Rev. 8/99 Competitive PCR Guide Table of Contents I. What is Competitive PCR? A. Difficulties of Quantitative Analysis in Normal PCR... 2 B. Principle of Competitive PCR... 3 C. Competitive

More information

Recombinant DNA Unit Exam

Recombinant DNA Unit Exam Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the

More information

OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation

OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research

More information

DyNAmo cdna Synthesis Kit for qrt-pcr

DyNAmo cdna Synthesis Kit for qrt-pcr DyNAmo cdna Synthesis Kit for qrt-pcr Instruction manual F- 470S Sufficient for 20 cdna synthesis reactions (20 µl each) F- 470L Sufficient for 100 cdna synthesis reactions (20 µl each) Description...

More information

Materials and Methods. Blocking of Globin Reverse Transcription to Enhance Human Whole Blood Gene Expression Profiling

Materials and Methods. Blocking of Globin Reverse Transcription to Enhance Human Whole Blood Gene Expression Profiling Application Note Blocking of Globin Reverse Transcription to Enhance Human Whole Blood Gene Expression Profi ling Yasmin Beazer-Barclay, Doug Sinon, Christopher Morehouse, Mark Porter, and Mike Kuziora

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

Common Course Topics Biology 1414: Introduction to Biotechnology I

Common Course Topics Biology 1414: Introduction to Biotechnology I Common Course Topics Biology 1414: Introduction to Biotechnology I Assumptions Students may be enrolled in this course for several reasons; they are enrolled in the Biotechnology Program, they need a science

More information

Sanger Sequencing. Troubleshooting Guide. Failed sequence

Sanger Sequencing. Troubleshooting Guide. Failed sequence Sanger Sequencing Troubleshooting Guide Below are examples of the main problems experienced in ABI Sanger sequencing. Possible causes for failure and their solutions are listed below each example. The

More information

An Overview of DNA Sequencing

An Overview of DNA Sequencing An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure

More information

User Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse)

User Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse) User Manual/Hand book qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse) Kit Components Cat. No. MA003...Human Whole Genome mirna qpcr Profiling Kit (-20 C) The following components are sufficient

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

TIANquick Mini Purification Kit

TIANquick Mini Purification Kit TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer

More information

Activity 7.21 Transcription factors

Activity 7.21 Transcription factors Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation

More information

Troubleshooting Sequencing Data

Troubleshooting Sequencing Data Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page

More information

IDENTIFICATION AND CLONING OF A FEMALE ANTENNA-SPECIFIC ODORANT-BINDING PROTEIN IN THE MOSQUITO Culex quinquefasciatus

IDENTIFICATION AND CLONING OF A FEMALE ANTENNA-SPECIFIC ODORANT-BINDING PROTEIN IN THE MOSQUITO Culex quinquefasciatus Journal of Chemical Ecology, Vol. 28, No. 4, April 2002 ( C 2002) Originally published online February 14, 2002, Rapid Communications, pp. RC1 RC6 (http://www.kluweronline.com/issn/0098-0331) IDENTIFICATION

More information