Wolbachia uses a host microrna to regulate transcripts of a methyltransferase, contributing to dengue virus inhibition in Aedes aegypti
|
|
- Ursula Newton
- 8 years ago
- Views:
Transcription
1 Wolchi uses host microrna to regulte trnscripts of methyltrnsferse, contriuting to dengue virus inhiition in Aedes egypti Gungmei Zhng, Mzhr Hussin, Scott L. O Neill,c, nd Sssn Asgri,1 Austrlin Infectious Disese Reserch Centre, School of iologicl Sciences, University of Queenslnd, St. Luci, QLD 4072, Austrli; School of iologicl Sciences, Monsh University, Clyton, VIC 3800, Austrli; nd c Institute of Moleculr iosciences, University of Queenslnd, St. Luci, QLD 4072, Austrli Edited y Nncy A. Morn, Yle University, West Hven, CT, nd pproved My 7, 2013 (received for review Ferury 25, 2013) The endosymiont Wolchi is common mong insects nd known for the reproductive mnipultions it exerts on hosts s well s inhiition of virus repliction in their hosts. Recently, we showed tht Wolchi uses host micrornas to mnipulte host gene expression for its efficient mintennce in the dengue mosquito vector, Aedes egypti. Cytosine methyltion is medited y group of proteins clled DNA (cytosine-5) methyltrnsferses, which re structurlly nd functionlly conserved from prokryotes to eukryotes. The iologicl functions of cytosine methyltion include host defense, genome stility, gene regultion, developmentl promotion of orgns, nd lifespn regultion. Ae. egypti hs only one DNA methyltrnsferse gene (ADnmt2) elonging to the cytosine methyltrnsferse fmily 2, which is the most deeply conserved nd widely distriuted gene mong metzons. Here, we show tht in mosquitoes the introduced endosymiont, Wolchi, significntly suppresses expression of ADnmt2, ut dengue virus induces expression of ADnmt2. Interestingly, we found tht e-mir-2940 microrna, which is exclusively expressed in Wolchi-infected mosquitoes, down-regultes the expression of ADnmt2. Reversely, overexpression of ADnmt2 in mosquito cells led to inhiition of Wolchi repliction, ut significntly promoted repliction of dengue virus, suggesting cusl link etween this Wolchi mnipultion nd the locking of dengue repliction in Wolchiinfected mosquitoes. In ddition, our findings provide n explntion for hypomethyltion of the genome in Wolchi-infected Ae. egypti. endosymiosis Wolchi pipientis Dengue is endemic in more thn 110 tropicl countries, with illion people living t risk for infection. Ech yer, it is reported to infect more thn 50 million people worldwide (1). Dengue virus (DENV) from the genus Flvivirus is positive-strnd RNA virus, which is primrily trnsmitted to humns y femle Aedes mosquitoes. ecuse there re currently neither specific ntivirl drugs nor pproved vccines ginst DENV, insect vector control is still considered the est pproch to prevent dengue trnsmission. In recent yers, Wolchi infections of mosquitoes hve een proposed s novel pproch for re-wide dengue control tht is inexpensive to implement nd self-sustining (2, 3). Wolchi, mternlly inherited Grm-negtive endosymiotic cteri, re estimted to occur nturlly in more thn 40% of ll insect species nd 28% of surveyed mosquito species (4, 5). However, with some exceptions, they hve not een found in importnt species tht re the vectors of humn pthogens such s dengue nd mlri. Recently, severl strins of Wolchi hve een successfully introduced into Aedes egypti (6, 7). Mosquitoes with wmelpop strin trnsinfection showed out 50% reduction in dult femle lifespn (8). Interestingly, Ae. egypti infected with Wolchi induces very strong resistnce to severl roviruses including DENV, yellow fever, nd Chikunguny viruses, Plsmodium, nd filril nemtodes (9 12). MicroRNAs (mirnas) re n evolutionrily conserved clss of smll 22 nucleotides noncoding RNAs tht regulte gene expression vi prtilly or completely mtching to their trget genes (13). They ply importnt roles in cellulr processes including development, differentition, poptosis, nd immunity. Until now, more thn 25,000 mirna sequences hve een identified from different orgnisms including protozons, plnts, nimls, nd viruses (mirse v19) (14). It hs een reported tht the expression levels of cellulr mirnas drmticlly chnge in response to cteril nd virl infections in nimls nd plnts (15 20). In humn, liver-specific mirna, mir-122, cn trget the 5 UTR of heptitis C virus to enhnce virl repliction (21). Hung et l. (2007) (17) reported tht HIV lso uses host mirnas to trget its genes to its own dvntge. Recently, we reported differentil expression of severl mirnas in Wolchi-infected Ae. egypti mosquitoes with n mirna, e-mir-2940, which is exclusively expressed in Wolchi-infected mosquitoes. y using the host e-mir-2940, Wolchi up-regultes the expression of host metlloprotese gene, metlloprotese m41 ftsh, which is essentil for the endosymiont s mintennce (18). In this study, we identified nother trget gene of e-mir- 2940, ADnmt2. ADnmt2 elongs to cytosine methyltrnsferse fmily 2, which is the only DNA methyltrnsferse found in Dipter. In Drosophil, ddnmt2 is primrily loclized in the cytoplsm nd much less in the nucleus nd could medite oth DNA nd RNA methyltions (22, 23). Here, we imed to investigte the impct of Wolchi nd consequently up-regultion of e-mir-2940 on ADnmt2. In ddition, we investigted the possile impct of regultion of the trget gene on DENV repliction. Our results suggest tht ADnmt2 plys n importnt role not only in the mintennce of Wolchi infection in mosquito cells, ut lso in the resistnce of mosquito cells to DENV infection. Results Expression Profile of ADnmt2 in Ae. Aegypti. y using Ntionl Center for iotechnology Informtion (NCI) LAST, RNA- Hyrid, nd RNA22 softwre, puttive 5-cytosine DNA methyltrnsferse (ADnmt2, Gennk ID: XM_ ) from Ae. egypti ws identified s nother trget of differentilly expressed mirna, e-mir-2940, which ws previously shown to up-regulte the trnscript levels of metlloprotese gene in Wolchi-infected mosquitoes (18). Further nlysis of the sequence showed tht ADnmt2 is homolog of pmt1 from fission Author contriutions: G.Z., M.H., nd S.A. designed reserch; G.Z. nd M.H. performed reserch; S.L.O. nd S.A. contriuted new regents/nlytic tools; G.Z. nd S.A. nlyzed dt; nd G.Z., M.H., S.L.O., nd S.A. wrote the pper. The uthors declre no conflict of interest. This rticle is PNAS Direct Sumission. 1 To whom correspondence should e ddressed. E-mil: s.sgri@uq.edu.u. This rticle contins supporting informtion online t /pns /-/DCSupplementl PNAS June 18, 2013 vol. 110 no. 25
2 yest (24) nd Dnmt2 from humn, Drosophil, nd other orgnisms (25 27). ADnmt2 is 344- protein with 47% identity to the Drosophil Dnmt2 protein. Like other Dnmt2 proteins, ADnmt2 contins ll 10 dignostic nd ctlytic motifs of ctive DNA methyltrnsferses. In ddition, similr to Drosophil, there is only one Dnmt gene present in Ae. egypti genome. In Drosophil, humn, nd zerfish, the expression of Dnmt2 is developmentlly nd tissue-specificlly regulted (22, 23, 25, 28). In this study, we investigted the expression pttern of ADnmt2 in Ae. egypti y RT-PCR using ADnmt2 gene specific primers. We found tht the trnscript levels of ADnmt2 gene were not detectle in ny of the lrvl stges, ut could e detected in dults (Fig. 1A). The trnscript levels of ADnmt2 were lower in 1-d-old dults compred with 4-d-old dults (Fig. 1A). We lso found tht ADnmt2 is minly expressed in the domen of oth mle nd femle mosquitoes, which suggests tht ADnmt2 could e specificlly expressed in some orgns in the domen (Fig. 1). Tissue-specific RT-quntittive PCR (qpcr) nlysis of four tissues (ovry, slivry glnds, midgut, nd thorcic muscles) from Ae. egypti femles t 4 nd 12 d fter emergence confirmed tht the highest trnscript levels of AeDnmt2 were found in the ovries (see elow). Ae. egypti is the host nd vector of n importnt humn pthogen, DENV. Recently, the insect endosymiont Wolchi ws successfully introduced into Ae. egypti nd found to inhiit the ility of pthogens such s DENV to infect this mosquito species (10, 11). sed on this, we investigted the expression profile of ADnmt2 in mosquitoes infected with Wolchi or DENV. In Wolchi-infected mosquitoes t 4 d fter emergence, ADnmt2 ws not detected y RT-PCR, ut it could e detected in its tetrcycline-cured (tet-cured) counterprt mosquitoes (Fig. 2A). ADnmt2 ws minly expressed in the domen of tetcured mosquitoes (Fig. 2). Interestingly, in 3-d-old femles infected with Wolchi, ADnmt2 could not e detected in either the hed nd thorx or the domen (Fig. 2). Consistently, when specific tissues from 4- nd 12-d-old femle mosquitoes were nlyzed using RT-qPCR, in generl, out twofold less AeDnmt2 trnscripts were found in Wolchi-infected mosquito tissues (Fig. 3). In tet-cured mosquitoes infected with DENV, RT-PCR results showed tht ADnmt2 ws expressed t much higher levels compred with the mosquitoes without DENV (Fig. 2C). e-mir-2940 Down-regultes the Expression of ADnmt2. The trget sequences of e-mir-2940 were predicted in the coding region of ADnmt2 (nucleotides ) with significnt complementrity to e-mir-2940 (Fig. 4A). In Ae. egypti Ag2 cells s well s wmelpop-cla infected Ag2 cells (g2.wmelpop-cla), ADnmt2 trnscripts could not e detected (Fig. 2). The reson for lck of detection of ADnmt2 in Ag2 cells, compred with Wolchi-free mosquitoes (Fig. 2), is the expression of e-mir in noninfected mosquito cell lines compred with whole mosquitoes, lthough t lower level compred with Wolchiinfected cells (18). To confirm this, the Dicer-1 gene ws silenced in Ag2 cells using RNAi. After confirming gene silencing, RT- PCR results showed tht the trnscript levels of ADnmt2 were considerly higher compred with mock-trnsfected Ag2 cells (Fig. 4), which confirmed tht inhiition of ADnmt2 expression in Ag2 cells is medited y mirnas. To further confirm tht emir-2940 contriutes in this inhiition, we trnsfected Ae. egypti Ag2 cells with synthetic e-mir-2940 specific nd e-mir- 2940* specific inhiitors, respectively. RT-PCR results showed incresed trnscript levels of ADnmt2 in cells trnsfected with e-mir-2940 specific inhiitor compred with cells trnsfected with control e-mir-2940* specific inhiitor nd mock-trnsfected cells (Fig. 4). These results suggest tht e-mir-2940 downregultes the trnscript levels of ADnmt2, which is consistent with the expression pttern of ADnmt2 gene in mosquitoes with or without Wolchi (Figs. 2 A nd nd 3). ADnmt2 Suppresses Wolchi Repliction. In previous study, we reported tht e-mir-2940 up-regultes the trnscript levels of the host metlloprotese, which is required for Wolchi repliction nd mintennce in mosquito cells (18). Considering tht e-mir-2940 down-regultes the trnscript levels of ADnmt2, we investigted whether ADnmt2 hs ny effect on Wolchi repliction. For this, ADnmt2 ws overexpressed in g2.wmelpop- CLA cells nd the density of Wolchi ws nlyzed y PCR. Twodifferentmountsof/ADnmt2wereusedtotrnsfect g2.wmelpop-cla cells resulting in one line expressing the gene t higher level (L1) compred with the other (L2) (Fig. 5A). PCR results with wsp gene specific primers reveled tht Wolchi density ws considerly lower in cells trnsfected with the /ADnmt2 vector compred with cells trnsfected with the empty vector () (Fig. 5). This effect ws found to e dose-dependent ecuse PCR results showed tht Wolchi density ws much lower in L1, where ADnmt2 is expressed t higher level compred with L2, the lower overexpressing ADnmt2 line (Fig. 5). However, Wolchi density ws lower in L2 compred with empty vector trnsfected cells (Fig. 5). A qpcr nlysis further confirmed tht overexpression of ADnmt2 leds to lower Wolchi density (Fig. 5C). These results suggest tht ADnmt2 suppresses Wolchi repliction in the cell line nd the suppression is concentrtion-dependent, which is consistent with the expression profile tht ADnmt2 is detected t considerly lower levels in Wolchi-infected mosquitoes compred with tetrcycline-cured counterprt mosquitoes (Figs. 2A nd 3). ADnmt2 Enhnces DENV Repliction. In oth Ae. egypti nd mosquito cell lines, Wolchi ws found to limit repliction of DENV (10, 11), which could e due to mnipultion of the host genes expression vi mirnas y Wolchi. To explore the effect of ADnmt2 on DENV repliction, we overexpressed ADnmt2 in Ag2 cells tht were susequently infected with DENV. Totl RNA t 72 h fter virl infection ws isolted nd nlyzed y RT-PCR with DENV-specific primers. The results showed tht the reltive undnce of DENV ws significntly higher in the cells overexpressing ADnmt2 compred with cells trnsfected with the empty vector (Fig. 6A). This result ws lso confirmed y RT-qPCR (Fig. 6). These results suggest tht ADnmt2 enhnces repliction of DENV in cells, which is consistent with the expression profile tht ADnmt2 trnscripts levels were induced in mosquitoes infected with DENV (Fig. 2C). However, when MICROIOLOGY A ADnmt2 Lrve 1st 2nd 3rd 4th Adults 1 d 4 d 4d 4d HT A HT A ADnmt2 Fig. 1. ADnmt2 expression profile. (A) RT-PCR nlysis ws performed using the totl RNA smples from Ae. egypti mosquito lrve nd dults. () RT-PCR nlysis ws performed with hed + thorx (HT) nd domen (A) of mosquito femles nd mles. gene ws used s control to show the integrity of RNA., positive control using Ag2 genomic DNA (gdna);, RT-PCR control rections in which reverse trnscriptse ws not dded. Zhng et l. PNAS June 18, 2013 vol. 110 no
3 A Wol - Wol Hed+thorx 2 d 3 d domen 2 d 3 d ADnmt2 Wol C ADnmt2 Mock DENV Wol Fig. 2. ADnmt2 expression profile in Wolchi or DENV-infected mosquitoes. (A) RT-PCR nlysis ws performed using totl RNA smples from 4-d-old Wolchi-infected (Wol+) nd uninfected (Wol ) femle mosquitoes. () RT-PCR nlysis ws performed using totl RNA smples from Wol+ nd Wol hed + thorx (HT) nd domen (A) of femle mosquitoes t 2 nd 3 d fter emergence. (C ) RT-PCR nlysis ws performed using totl RNA smples from 3-d DENV-infected nd uninfected mosquitoes (without Wolchi). gene ws used s control to show the integrity of RNA. ina serves s positive control for C ecuse the rections were done t the sme time. g2.wmelpop-cla cells were trnsfected with /ADnmt2 ndtheninfectedwithdenv,virusreplictionwsnotenhncedyadnmt2compredwithcellstrnsfectedwiththe empty vector (Fig. 6C). Consistently, when wmelpop-cla cells were trnsfected with e-mir-2940 specific inhiitornd susequently infected with DENV, virus repliction incresed over time compred with wmelpop-cla cells trnsfected with Reltive trnscript levels of ADnmt2 Ovry 4d-Wol Midgut Slivry Muscle Ovry Midgut Slivry Muscle 4d+Wol 4 dys -Wol 4 dys +Wol 12 dys -Wol Ovry c 12d-Wol 12d+Wol 1.20E E E-04 Ovry Midgut Slivry Muscle 4d-Wol 4d+Wol 12 dys +Wol Slivry glnds 12d-Wol 12d+Wol Fig. 3. Tissue-specific expression of AeDnmt2 in femle Ae. egypti mosquitoes. RT-qPCR nlysis of AeDnmt2 trnscript levels in the ovry, midgut, slivry glnds, nd thorcic muscle tissues (muscle) of 4- nd 12-d-old Wol+ nd Wol femle mosquitoes. Trnscript levels of AeDnmt2 were lso compred in the ovries nd slivry glnds in the smples (ottom two grphs). There re sttisticlly significnt differences etween groups with different letters t P < (one-wy ANOVA with Tukey s post-hoc test). the control inhiitor; however, the effect ws moderte (1.5 timest72h)ndnotsttisticllysignificnt (P > 0.05; Fig. 7). The moderte effect could e due to regultion of AeDnmt2 trnscripts y more thn one mirna; therefore, when emir-2940 is specificlly inhiited, nother mirna my still down-regulte AeDnmt2 trnscript levels leding to only prtil up-regultion of AeDnmt2 trnscript levels resulting from emir-2940 inhiition. In fct, when Dicer-1 ws silenced in Ag2 cells, which ffects mirna iogenesis in generl, considerly more AeDnmt2 trnscripts were mplified compred with when e-mir-2940 ws specificlly inhiited using the mirna-specific inhiitor (Fig. 4; compre Dicer 1 RNAi with 2940 inhiitor), which further supports the ssumption. It hs lredy een shown tht one mrna cn e trget of more thn one mirna (29 31). Our preliminry ioinformtics serch showed tht numer of other Ae. egypti mirnas (Fig. S1), which re differentilly expressed in Wolchi-infected mosquitoes (18), could potentilly trget AeDnmt2; however, their interctions with AeDnmt2 need to e experimentlly vlidted. Discussion In recent study, we reported tht wmelpop strin of Wolchi ltered the expression of numer of host mirnas, including e-mir-2940 in the host mosquito Ae. egypti (18). In turn, emir-2940 up-regulted the trnscript levels of trget gene, metlloprotese ftsh. Metlloprotese ws found to e crucil for efficient repliction nd mintennce of the endosymiont in Ae. egypti (18). However, the role of induced mirnas in the immune response to DENV nd other microorgnisms hs not een explored. The present study identified ADnmt2, methyltrnsferse, s nother trget gene of e-mir-2940 in Ae. egypti, which is highly expressed in the ovries. We found tht in the sence of the mirna, either y Dicer-1 silencing or specificlly using synthetic inhiitor of e-mir-2940, AeDnmt2 ws upregulted, suggesting tht e-mir-2940 negtively regultes the trnscripts of AeDnmt2. In ddition, y investigting the expression ptterns, we found tht the trnscription levels of ADnmt2 were significntly suppressed y Wolchi in mosquitoes nd y e-mir-2940 in the mosquito cell line. This trend ws lso oserved in specific tissues of the mosquitoes tested. The trnscription levels of ADnmt2 were incresed y DENV infection in mosquitoes. Interestingly, overexpression of ADnmt2 in g2.wmelpop-cla cells resulted in significnt decline in Wolchi density. Overexpression nd coinfection with DENV in Ag2 cells showed significnt increse in DENV repliction, ut not in g2.wmelpop-cla cells. These results Zhng et l.
4 A ADnmt2 mrna 5 Coding region t Trget 5' G UUAUUU 3' CUCG GAUGAGAUGGACUG GAGC CUAUUCUAUUUGGU mirna 3' CG UGU 5' ADnmt2 Fig. 4. ADnmt2 trnscription is down-regulted y e-mir (A) Schemtic digrm showing ADnmt2 mrna nd its trget sequences with complete complementrity of e-mir-2940 seed region (old nd underlined) with the sequences. () RT-PCR nlysis of RNA extrcted from mock-trnsfected Ag2 nd g2.wmelpop-cla (Pop) cells, nd Ag2 cells trnsfected with Dicer-1 dsrna, e-mir-2940, nd e-mir-2940* (control) synthetic inhiitors. gene ws used s control to show the integrity of RNA. suggest tht y inducing the expression of e-mir-2940, Wolchi could down-regulte ADnmt2, which in turn inhiits repliction of DENV. This descries potentil mechnism of suppression of DENV repliction y Wolchi. Insects use vriety of immune responses such s RNA interference, the Jnus kinse (JAK)-signl trnsducer nd ctivtor of trnscription (STAT) (JAK/STAT), Toll, nd Immune Deficiency (IMD) pthwys nd utophgy to contin virl infections (32 36). In their originl host Drosophil, some strins of Wolchi could induce resistnce to vrious viruses such s Drosophil C virus, cricket prlysis virus, Nor virus, flock house virus, nd West Nile virus (37 39). Drosophil synergisticlly uses severl pthwys to control virl infections (40 42). Recently, some strins of Wolchi were successfully introduced into vrious mosquito species such s Ae. egypti, Aedes lopictus, nd Anopheles gmie (somtic infection) in n effort to limit repliction nd spred of vrious vector-orne pthogens such s DENV nd mlri (6, 7, 43). Wolchi effectively suppress DENV, Chikunguny virus, yellow fever virus, nd Plsmodium in their new hosts (9 12, 43, 44). Studies hve shown tht in Ae. egypti, the symionts up-regulte the expression of lrge numer of host immune genes such s defensins, cecropins, JAK-STAT, nd Toll pthwy genes (10, 33, 35, 43, 44). These suggest tht similr to Drosophil, Wolchi-infected Ae. egypti my lso use multiple pthwys ctivted y Wolchi to control pthogen infections. ADnmt2 down-regultion might e used synergisticlly to suppress DENV y Ae. egypti. Reductions in ADnmt2, the only methyltrnsferse in Ae. egypti, y Wolchi vi induction of e-mir-2940, would imply hypomethyltion of the genome in Wolchi-infected mosquitoes, which hs significnt implictions in epigenetic regultion of gene expression. Role of mirnas in regultion of methyltion vi controlling DNA methyltrnsferses hs een documented. For exmple, mir-148 down-regultes Dnmt3 in humn HeL cells y trgeting its trnscripts in the coding region (45) nd Dnmt1 in oth humn cholngiocrcinom nd systemic lupus erythemtosus cell lines y trgeting either 3 UTR or the coding region (46, 47). Overexpression of mir-148 decresed Dnmt1, which in turn promoted DNA hypomethyltion nd enhnced the expression of vrious methyltion-sensitive genes. Considering sustntil chnges in the trnscriptome profile of Wolchi-infected mosquitoes reltive to noninfected ones (12), it is conceivle tht some of these chnges re due to differentil/hypo methyltion of the mosquito genome. Indeed, recent report demonstrted tht in wmelpop-infected Ae. egypti mosquitoes the pttern of cytosine methyltion of the genome is widely disrupted leding to n overll hypomethyltion of the genome in Wolchi-infected mosquitoes compred with noninfected mosquitoes (48). Tken together, our studies suggest tht e-mir-2940 plys n importnt role not only in the mintennce of Wolchi infection in mosquito cells, ut lso contriutes to the resistnce to DENV infection in mosquito cells. Our findings descrie mechnism for Wolchi to regulte host gene expression y ffecting methyltion nd limit DENV infection y using host mirnas in Ae. egypti. Our results demonstrted criticl functionl link etween Wolchi, mirnas, nd DENV, which furthers our understnding of Wolchi virus mosquito interctions. MICROIOLOGY A /ADnmt2 L1 L2 C ADnmt2 Wolchi /ADnmt2 L1 L2 /ADnmt2 Fig. 5. ADnmt2 reduces Wolchi repliction. (A) RT-PCR nlysis ws performed to confirm tht ADnmt2 ws overexpressed in /ADnmt2 plsmidtrnsfected g2.wmelpop-cla cells. L1 nd L2 refer to two trnsfected lines estlished using two different concentrtions of /AeDnmt2; L1 reflects concentrtion of 2 μg; L2 concentrtion of 1 μg. primers were used s control to show the integrity of RNA. () PCR nlysis of Wolchi density 72 h fter trnsfection with or /ADnmt2 plsmid in L1 nd L2 (s in A) in g2.wmelpop-cla cells using primers specific tothewolchi wsp gene. primers were used s control to show the integrity of DNA. (C) qpcr nlysis of DNA extrcted from g2.wmelpop-cla cells 72 h fter trnsfection with or /ADnmt2. Three iologicl with three technicl replictes were crried out for ech trnsfection. Asterisks indicte significnt difference etween mock nd ADnmt2 trnsfections (P < 0.001; t test). Zhng et l. PNAS June 18, 2013 vol. 110 no
5 A C ns DENV /ADnmt2 /ADnmt2 Fig. 6. ADnmt2 enhnces DENV repliction in cells without Wolchi. (A) RT-PCR nlysis of RNA using DENV-specific primers 72 h fter trnsfection with or /ADnmt2 in Ag2 cells., primers to the gene showing the integrity of RNA. () RT-qPCR nlysis of DENV undnce 72 h fter trnsfection with or /ADnmt2 in Ag2 cells. (C) RT-qPCR nlysis of RNA using DENV-specific primers in g2.wmelpop-cla cells 72 h fter trnsfection with or /ADnmt2. For nd C, three iologicl replictes with three technicl replictes were crried out for ech trnsfection. Asterisks indicte significnt difference etween mock nd ADnmt2 trnsfections (P < 0.001; t test); NS indictes no significnt differences etween mock nd /ADnmt2 trnsfections (P > 0.05; t test). Mterils nd Methods Mosquitoes, Insect Cell Lines, nd DENV Infection. Ae. egypti infected with wmelpop-cla strin of Wolchi (Wol+) nd Wolchi-free strin, tetcured line (Wol ), were the stocks s previously descried (7). Adults nd lrve were rered t 25 C with 80% reltive humidity nd 12-h light regimen. Lrve were mintined with fish food pellets (Tetrmin, Tetr) t density of 50 lrve per liter of wter in flt trys; dults were offered 10% (wt/vol) sucrose solution, d liitum. Ae. egypti Ag2 cells nd those infected with Wolchi (denoted s g2.wmelpop-cla) (49) were mintined in medi with 1:1 mixture of Mitsuhsgi-Mrmorosch nd Schneider s insect medi (Invitrogen) supplemented with 10% FS. RNA Extrction, cdna Synthesis, nd PCR. Totl RNA from mosquitoes nd cell lines ws isolted using Tri-Regent (Amion Inc.), nd susequently treted with DNse I efore eing used for reverse trnscription. The first-strnd cdna for ADnmt2 ws synthesized y RT with ADnmt2 gene-specific primers (forwrd: 5 -ATGAGTGCTACCGACGTA-3 ; reverse: 5 -TCACCAGTC- CATCTCATC-3 ). In ech RT rection, 2 μg of totl RNA ws used s templte in totl volume of 20 μl. Amplifiction following cdna synthesis ws crried out in totl rection volume of 25 μl with 2 μl of RT products. The mplifiction ws performed t 94 C for 3 min, followed y 35 cycles of 94 C for 30 s, 56 C for 30 s, 68 C for 1 min, nd finl extension t 68 C for 10 min. The riosoml protein S17 (RPS17) gene ws used for normlizing dt s descried previously (18). Quntittive PCR of Wolchi Density. Totl genomic DNA ws extrcted from cells s descried previously (50). Wolchi density in cells ws determined y qpcr using the wsp gene-specific primers s descried previously (18). qpcr ws performed using Pltinum SYR Green Mix (Invitrogen) with 20 ng of totl genomic DNA in Rotor-Gene therml cycler (Qigen) under the following conditions: 95 C hold for 30 s, then 40 cycles of 95 C for 15 s, 50 C for 15 s, nd 72 C for 20 s, following y the melting curve (68 95 C). For this experiment, three iologicl replictes with three technicl replictes were nlyzed. The RPS17 gene ws used for normliztion of DNA templtes. The Student t test ws used to compre the differences in mens etween different tretments. qrt-pcr. Totl RNA ws extrcted nd reverse trnscried s descried previously using specific reverse primer to DENV (reverse, CCATCCCGTACCAG- CATCCG). Following RT, qpcr with DENV gene-specific primers (forwrd, GTGGTGGTGACTGAGGACTG) ws performed to determine DENV density in cells. This mplified 138-nt frgment from nucleotides of the DENV genome. Pltinum SYR Green Mix (Invitrogen) ws used for qpcr with 1 μl of RT products s descried previously. For this experiment, three iologicl replictes with three technicl replictes were nlyzed. The RPS17 gene ws used for normliztion of RNA templtes. The Student t test ws used to compre the differences in mens. For tissue-specific nlysis of ADnmt2 trnscript levels, totl RNA ws extrcted from ovries, thorcic muscle tissue, slivry glnds, nd midgut dissected from 4- nd 12-d-old Wol+ nd Wol femle mosquitoes s descried previously. RT-qPCR rections were crried out s descried previously using primers specific to ADnmt2 gene (forwrd, GTAGTATCAGCAATTGA- CATCA; reverse, TGGGGGTGACATGAGAATAAG). Similrly, three iologicl replictes with three technicl replictes were nlyzed for ech tissue nd mosquito type. Ech iologicl replicte consisted of pull of totl RNA extrcted from specific tissues of five mosquitoes. The RPS17 gene ws lso used for normliztion of RNA templtes. Overexpression of ADnmt2 in Insect Cell Lines. The cdna of ADnmt2 gene (Gennk ccession no. XM_ ) ws synthesized y RT-PCR using genespecific primers with KpnI nd ScII restriction sites (forwrd: 5 -GGTAC- CATGGGGAGTGCTACCGACGTA-3 ; reverse: 5 -CCGCGGCCAGTCCATCTCATC-3 ; restriction sites re underlined). ADnmt2 ws cloned into /V5-His vector contining n insect-specific promoter (Life Technologies). Two microgrms of the produced plsmid with ADnmt2 gene ws trnsfected into Ag2 or g2.wmelpop-cla cell lines using Cellfectin (Life Technologies) s trnsfection regent. Cells trnsfected with the empty /V5-His vector were used s controls. Cells were collected t 72 h fter trnsfection, nd totl RNA ws isolted nd nlyzed y RT-PCR nd/or RT-qPCR with gene-specific primers s required. Inhiition of e-mir-2940 in Wolchi-Infected Cells. e-mir-2940 (5 - GCCUCGACAGAUAAGAUAAACCA-3 ) nd e-mir-2940* (5 -AGUGAUUUAU- CUCCCUGUCGAC-3, s control) inhiitors were synthesized y Genephrm. A ns ns Fig. 7. Effect of inhiition of e-mir-2940 on DENV repliction. g2.wmelpop-cla cells were trnsfected with synthetic e-mir-2940 inhiitor (2940In) nd control inhiitor (Inhiitor-C) 48 h efore infection with DENV. RNA smples were extrcted from cells t (A) 24 h nd () 72 h fter infection nd nlyzed y RT-qPCR using specific primers to DENV. Three iologicl with three technicl replictes were crried out for ech trnsfection. NS, no significnt differences etween Inhiitor-C nd 2940In (P > 0.05; t test) Zhng et l.
6 In this experiment, 100 ng of the e-mir-2940 nd e-mir-2940* inhiitors were trnsfected into g2.wmelpop-cla cells using the Cellfectin trnsfection regent. Cells were collected t 72 h fter trnsfections, totl RNA ws extrcted, nd RT-PCR nlyses were performed with ADnmt2 gene specific primers s previously. RNA-Medited Gene Silencing. For RNAi-sed experiments, dsrna ws synthesized in vitro y using the T7 Megscript trnscription kit ccording to the mnufcturer s instructions (Amion Inc.). T7 promoter sequences (TAA- TACGACTCACTATAGGG) were incorported in oth forwrd nd reverse primers designed to mplify 450 p of the Ae. egypti Dicer-1 gene (forwrd: 5 -CCCGGACCAAGTCCTAGTA-3 ; reverse:5 -CAACTCTTTCGGCACGTAA-3 ). Aout 1 μg of the PCR product ws used in 4-h incution t 37 C for dsrna synthesis. After DNse tretment, RNA ws precipitted y lithium chloride. Aout 500 ng of dsrna ws used for trnsfection of Ag2 cells, which were trnsfected gin t 48 h fter the first trnsfection. Cells were collected for RNA isoltion for nlysis 48 h fter the second trnsfection. Gene silencing ws confirmed y RT-qPCR with Dicer-1 specific primers. Prediction of Cellulr Trgets of e-mir NCI LAST, RNAHyrid, nd RNA22 softwre were used to identify the potentil trgets of e-mir tlastn ws performed to serch for homologous sequences. The ioedit progrm ws used to lign sequences nd to clculte the identities nd similrities of sequences. ACKNOWLEDGMENTS. We thnk Gungjin Lu from rin Ky s lortory (Queenslnd Institute of Medicl Reserch) for providing mosquito lrvl smples. This work ws supported y Austrlin Reserch Council Discovery Grnt DP (to S.A.), Austrlin Reserch Council Discovery Erly Creer Resercher Awrd fellowship DE (to M.H.), nd grnt from the Foundtion of the Ntionl Institutes of Helth through the Grnd Chllenges in Glol Helth inititive of the ill nd Melind Gtes Foundtion (to S.L.O.). 1. WHO (2009) Dengue nd Dengue Hemorrhgic Fever. Fct Sheet No (World Helth Orgniztion, Genev). 2. Hoffmnn AA, et l. (2011) Successful estlishment of Wolchi in Aedes popultions to suppress dengue trnsmission. Nture 476(7361): Wlker T, et l. (2011) The wmel Wolchi strin locks dengue nd invdes cged Aedes egypti popultions. Nture 476(7361): Zug R, Hmmerstein P (2012) Still host of hosts for Wolchi: Anlysis of recent dt suggests tht 40% of terrestril rthropod species re infected. PLoS ONE 7: e Jeyprksh A, Hoy MA (2000) Long PCR improves Wolchi DNA mplifiction: wsp sequences found in 76% of sixty-three rthropod species. Insect Mol iol 9(4): Xi ZY, Khoo CCH, Doson SL (2005) Wolchi estlishment nd invsion in n Aedes egypti lortory popultion. Science 310(5746): McMenimn CJ, et l. (2009) Stle introduction of life-shortening Wolchi infection into the mosquito Aedes egypti. Science 323(5910): Moreir LA, et l. (2009) Humn proing ehvior of Aedes egypti when infected with life-shortening strin of Wolchi. PLoS Negl Trop Dis 3(12):e vn den Hurk AF, et l. (2012) Impct of Wolchi on infection with chikunguny nd yellow fever viruses in the mosquito vector Aedes egypti. PLoS Negl Trop Dis 6(11):e Moreir LA, et l. (2009) A Wolchi symiont in Aedes egypti limits infection with dengue, Chikunguny, nd Plsmodium. Cell 139(7): in G, Xu Y, Lu P, Xie Y, Xi Z (2010) The endosymiotic cterium Wolchi induces resistnce to dengue virus in Aedes egypti. PLoS Pthog 6(4):e Kmris Z, Cook PE, Phuc HK, Sinkins SP (2009) Immune ctivtion y life-shortening Wolchi nd reduced filril competence in mosquitoes. Science 326(5949): Asgri S (2013) MicroRNA functions in insects. Insect iochem Mol iol 43(4): Griffiths-Jones S, Sini HK, vn Dongen S, Enright AJ (2008) mirse: Tools for microrna genomics. Nucleic Acids Res 36(Dtse issue):d154 D Fssi Fehri L, et l. (2010) Helicocter pylori induces mir-155 in T cells in camp- Foxp3-dependent mnner. PLoS ONE 5(3):e Go CP, et l. (2010) Reduced microrna-218 expression is ssocited with high nucler fctor kpp ctivtion in gstric cncer. Cncer 116(1): Hung JL, et l. (2007) Cellulr micrornas contriute to HIV-1 ltency in resting primry CD4+ T lymphocytes. Nt Med 13(10): Hussin M, Frentiu FD, Moreir LA, O Neill SL, Asgri S (2011) Wolchi uses host micrornas to mnipulte host gene expression nd fcilitte coloniztion of the dengue vector Aedes egypti. Proc Ntl Acd Sci USA 108(22): Lu F, et l. (2008) Epstein-rr virus-induced mir-155 ttenutes NF-kpp signling nd stilizes ltent virus persistence. J Virol 82(21): Tili E, et l. (2007) Modultion of mir-155 nd mir-125 levels following lipopolyscchride/tnf-lph stimultion nd their possile roles in regulting the response to endotoxin shock. J Immunol 179(8): Jopling CL (2008) Regultion of heptitis C virus y microrna-122. iochem Soc Trns 36(Pt 6): Kunert N, Mrhold J, Stnke J, Stch D, Lyko F (2003) A Dnmt2-like protein medites DNA methyltion in Drosophil. Development 130(21): Schefer M, Steringer JP, Lyko F (2008) The Drosophil cytosine-5 methyltrnsferse Dnmt2 is ssocited with the nucler mtrix nd cn ccess DNA during mitosis. PLoS ONE 3(1):e Wilkinson CRM, rtlett R, Nurse P, ird AP (1995) The fission yest gene pmt1+ encodes DNA methyltrnsferse homologue. Nucleic Acids Res 23(2): Okno M, Xie SP, Li E (1998) Dnmt2 is not required for de novo nd mintennce methyltion of virl DNA in emryonic stem cells. Nucleic Acids Res 26(11): Tweedie S, et l. (1999) Vestiges of DNA methyltion system in Drosophil melnogster? Nt Genet 23(4): Yoder JA, estor TH (1998) A cndidte mmmlin DNA methyltrnsferse relted to pmt1p of fission yest. Hum Mol Genet 7(2): Ri K, et l. (2007) Dnmt2 functions in the cytoplsm to promote liver, rin, nd retin development in zerfish. Genes Dev 21(3): Thomson DW, rcken CP, Goodll GJ (2011) Experimentl strtegies for microrna trget identifiction. Nucleic Acids Res 39(16): Vo NK, Dlton RP, Liu N, Olson EN, Goodmn RH (2010) Affinity purifiction of microrna-133 with the crdic trnscription fctor, Hnd2. Proc Ntl Acd Sci USA 107(45): Wu S, et l. (2010) Multiple micrornas modulte p21cip1/wf1 expression y directly trgeting its 3 untrnslted region. Oncogene 29(15): Ding S-W (2010) RNA-sed ntivirl immunity. Nt Rev Immunol 10(9): Pn X, et l. (2012) Wolchi induces rective oxygen species (ROS)-dependent ctivtion of the Toll pthwy to control dengue virus in the mosquito Aedes egypti. Proc Ntl Acd Sci USA 109(1):E23 E Sin LR, et l. (2009) Ars2 regultes oth mirna- nd sirna-dependent silencing nd suppresses RNA virus infection in Drosophil. Cell 138(2): Souz-Neto JA, Sim S, Dimopoulos G (2009) An evolutionry conserved function of the JAK-STAT pthwy in nti-dengue defense. Proc Ntl Acd Sci USA 106(42): Xi Z, Gvotte L, Xie Y, Doson SL (2008) Genome-wide nlysis of the interction etween the endosymiotic cterium Wolchi nd its Drosophil host. MC Genomics 9: Glser RL, Meol MA (2010) The ntive Wolchi endosymionts of Drosophil melnogster nd Culex quinquefscitus increse host resistnce to West Nile virus infection. PLoS ONE 5(8):e Hedges LM, rownlie JC, O Neill SL, Johnson KN (2008) Wolchi nd virus protection in insects. Science 322(5902): Teixeir L, Ferreir A, Ashurner M (2008) The cteril symiont Wolchi induces resistnce to RNA virl infections in Drosophil melnogster. PLoS iol 6(12):e Dostert C, et l. (2005) The Jk-STAT signling pthwy is required ut not sufficient for the ntivirl response of drosophil. Nt Immunol 6(9): Tnji T, Hu XD, Weer ANR, Ip YT (2007) Toll nd IMD pthwys synergisticlly ctivte n innte immune response in Drosophil melnogster. Mol Cell iol 27(12): Zmon RA, Nndkumr M, Vkhri VN, Wu LP (2005) The Toll pthwy is importnt for n ntivirl response in Drosophil. Proc Ntl Acd Sci USA 102(20): lgrove MSC, Aris-Goet C, Filloux A-, Sinkins SP (2012) Wolchi strin wmel induces cytoplsmic incomptiility nd locks dengue trnsmission in Aedes lopictus. Proc Ntl Acd Sci USA 109(1): Hughes GL, Kog R, Xue P, Fuktsu T, Rsgon JL (2011) Wolchi infections re virulent nd inhiit the humn mlri prsite Plsmodium flciprum in Anopheles gmie. PLoS Pthog 7(5):e Duursm AM, Kedde M, Schrier M, le Sge C, Agmi R (2008) mir-148 trgets humn DNMT3 protein coding region. RNA 14(5): rconi C, Hung N, Ptel T (2010) MicroRNA-dependent regultion of DNA methyltrnsferse-1 nd tumor suppressor gene expression y interleukin-6 in humn mlignnt cholngiocytes. Heptology 51(3): Pn W, et l. (2010) MicroRNA-21 nd microrna-148 contriute to DNA hypomethyltion in lupus CD4+ T cells y directly nd indirectly trgeting DNA methyltrnsferse 1. J Immunol 184(12): Ye YH, et l. (2013) Infection with virulent strin of Wolchi disrupts genome wide-ptterns of cytosine methyltion in the mosquito Aedes egypti. PLoS ONE, /journl.pone Frentiu FD, Roinson J, Young PR, McGrw EA, O Neill SL (2010) Wolchi-medited resistnce to dengue virus infection nd deth t the cellulr level. PLoS ONE 5(10): e Gltz R, et l. (2004) Lectin-induced hemocyte inctivtion in insects. J Insect Physiol 50(10): MICROIOLOGY Zhng et l. PNAS June 18, 2013 vol. 110 no
Treatment Spring Late Summer Fall 0.10 5.56 3.85 0.61 6.97 3.01 1.91 3.01 2.13 2.99 5.33 2.50 1.06 3.53 6.10 Mean = 1.33 Mean = 4.88 Mean = 3.
The nlysis of vrince (ANOVA) Although the t-test is one of the most commonly used sttisticl hypothesis tests, it hs limittions. The mjor limittion is tht the t-test cn be used to compre the mens of only
More informationSmall Businesses Decisions to Offer Health Insurance to Employees
Smll Businesses Decisions to Offer Helth Insurnce to Employees Ctherine McLughlin nd Adm Swinurn, June 2014 Employer-sponsored helth insurnce (ESI) is the dominnt source of coverge for nonelderly dults
More informationReasoning to Solve Equations and Inequalities
Lesson4 Resoning to Solve Equtions nd Inequlities In erlier work in this unit, you modeled situtions with severl vriles nd equtions. For exmple, suppose you were given usiness plns for concert showing
More informationUnit 29: Inference for Two-Way Tables
Unit 29: Inference for Two-Wy Tbles Prerequisites Unit 13, Two-Wy Tbles is prerequisite for this unit. In ddition, students need some bckground in significnce tests, which ws introduced in Unit 25. Additionl
More informationUtilization of Smoking Cessation Benefits in Medicaid Managed Care, 2009-2013
Utiliztion of Smoking Cesstion Benefits in Medicid Mnged Cre, 2009-2013 Office of Qulity nd Ptient Sfety New York Stte Deprtment of Helth Jnury 2015 Introduction According to the New York Stte Tocco Control
More informationJaERM Software-as-a-Solution Package
JERM Softwre-s--Solution Pckge Enterprise Risk Mngement ( ERM ) Public listed compnies nd orgnistions providing finncil services re required by Monetry Authority of Singpore ( MAS ) nd/or Singpore Stock
More information** Dpt. Chemical Engineering, Kasetsart University, Bangkok 10900, Thailand
Modelling nd Simultion of hemicl Processes in Multi Pulse TP Experiment P. Phnwdee* S.O. Shekhtmn +. Jrungmnorom** J.T. Gleves ++ * Dpt. hemicl Engineering, Ksetsrt University, Bngkok 10900, Thilnd + Dpt.hemicl
More informationQuantitative relationship of two viruses (MrNV and XSV) in white-tail disease of Macrobrachium rosenbergii
DISEASES OF AQUATIC ORGANISMS Vol. 71: 11 17, 26 Pulished July 11 Dis Aqut Org Quntittive reltionship of two viruses (MrNV nd XSV) in white-til disese of Mcrorchium rosenergii Hujun Zhng 1, Jinmin Wng
More informationModulation of human lymphocyte proliferation by salivary gland extracts of ixodid ticks (Acari: Ixodidae): effect of feeding stage and sex
FOLIA PARASITOLOGICA 5: 35 312, 3 Modultion of humn lymphocyte prolifertion y slivry glnd extrcts of ixodid ticks (Acri: Ixodide): effect of feeding stge nd sex Terézi Rolníková 1, Mári Kzimírová 1 nd
More informationRole of TRAIL and the pro-apoptotic Bcl-2 homolog Bim in acetaminophen-induced liver damage
Role of TRAIL nd the pro-poptotic Bcl-2 homolog Bim in cetminophen-induced liver dmge A Bdmnn 1, A Keough 2, T Kufmnn 3, P Bouillet 4, T Brunner",1,5,6 nd N Corzz",1,6 Acetminophen (N-cetyl-pr-minophenol
More informationBIENNIAL REPORT 2010-2011. Used Tire Management and Emergency Public Health Funds. Report to Governor Pat Quinn and the Illinois General Assembly
BIENNIL REPORT 2010-2011 Used Tire Mngement nd Emergency Public Helth Funds Report to Governor Pt Quinn nd the Illinois Generl ssembly Legisltive Mndte: To provide for reserch on disese vectors ssocited
More informationMateus et al. BMC Biology 2014, 12:97 http://www.biomedcentral.com/1741-7007/12/97
Mteus et l. BMC Biology 2014, 12:97 http://www.iomedcentrl.com/1741-7007/12/97 RESEARCH ARTICLE Open Access Adptive developmentl plsticity: Comprtmentlized responses to environmentl cues nd to corresponding
More informationCOVER CROP VARIETY AND SEEDING RATE EFFECTS ON WINTER WEED SEED PRODUCTION
COVER CROP VARIETY AND SEEDING RATE EFFECTS ON WINTER WEED SEED PRODUCTION Nthn S. Boyd nd Eric B. Brennn, USDA-ARS, Orgnic Reserch Progrm, 1636 E. Alisl Street, Slins, CA 93905 Astrct Weed mngement is
More informationAdenovirus Transduction is Required for the Correction of Diabetes Using Pdx-1 or Neurogenin-3 in the Liver
& The Americn Society of Gene Therpy originl rticle Adenovirus Trnsduction is Required for the Correction of Dietes Using Pdx-1 or Neurogenin-3 in the Liver Alfred Y Wng 1, Anj Ehrhrdt 2,3, Hui Xu 2 nd
More informationHow To Study The Effects Of Music Composition On Children
C-crcs Cognitive - Counselling Reserch & Conference Services (eissn: 2301-2358) Volume I Effects of Music Composition Intervention on Elementry School Children b M. Hogenes, B. Vn Oers, R. F. W. Diekstr,
More informationT he nucleus was once thought of as a non-structured amorphous
Visuliztion of gene ctivity in living cells rticles Toshiro Tsukmoto*, Noriyo Hshiguchi*, Susn M. Jnicki*, Tudorit Tumr, Andrew S. Belmont nd Dvid L. Spector* *Cold Spring Hror Lortory, One Bungtown Rod,
More informationClearPeaks Customer Care Guide. Business as Usual (BaU) Services Peace of mind for your BI Investment
ClerPeks Customer Cre Guide Business s Usul (BU) Services Pece of mind for your BI Investment ClerPeks Customer Cre Business s Usul Services Tble of Contents 1. Overview...3 Benefits of Choosing ClerPeks
More informationHow To Set Up A Network For Your Business
Why Network is n Essentil Productivity Tool for Any Smll Business TechAdvisory.org SME Reports sponsored by Effective technology is essentil for smll businesses looking to increse their productivity. Computer
More informationLump-Sum Distributions at Job Change, p. 2
Jnury 2009 Vol. 30, No. 1 Lump-Sum Distributions t Job Chnge, p. 2 E X E C U T I V E S U M M A R Y Lump-Sum Distributions t Job Chnge GROWING NUMBER OF WORKERS FACED WITH ASSET DECISIONS AT JOB CHANGE:
More information2 DIODE CLIPPING and CLAMPING CIRCUITS
2 DIODE CLIPPING nd CLAMPING CIRCUITS 2.1 Ojectives Understnding the operting principle of diode clipping circuit Understnding the operting principle of clmping circuit Understnding the wveform chnge of
More informationHillsborough Township Public Schools Mathematics Department Computer Programming 1
Essentil Unit 1 Introduction to Progrmming Pcing: 15 dys Common Unit Test Wht re the ethicl implictions for ming in tody s world? There re ethicl responsibilities to consider when writing computer s. Citizenship,
More informationAtypical regions in large genomic DNA sequences (DNA sequence analysis/markov chain/chromosome srcture)
Proc. Nti. cd. Sci. US Vol. 91, pp. 7134-7138, July 1994 Genetics typicl regions in lrge genomic DN sequences (DN sequence nlysis/mrkov chin/chromosome srcture) STEWRT SCHERER*t*, MRY SR MCPEEK, ND TERENCE
More information5 a LAN 6 a gateway 7 a modem
STARTER With the help of this digrm, try to descrie the function of these components of typicl network system: 1 file server 2 ridge 3 router 4 ckone 5 LAN 6 gtewy 7 modem Another Novell LAN Router Internet
More informationAntibody Screening. Antibody Screening in Pre-transfusion Testing and Antenatal Screening
Antiody Screening in Pre-trnsfusion Testing nd Antentl Screening Antiody Screening in Pre-trnsfusion Testing nd Antentl Screening Q. Wht re nturlly occurring or expected ntiodies? Q. Wht re typicl or unexpected
More informationReversing Medications That Cause Bleeding
Reversing Medictions Tht Cuse Bleeding Dine M. Birnbumer, M.D., FACEP Professor of Medicine University of Cliforni, Los Angeles Senior Fculty Deprtment of Emergency Medicine Hrbor-UCLA Medicl Center The
More informationAppendix D: Completing the Square and the Quadratic Formula. In Appendix A, two special cases of expanding brackets were considered:
Appendi D: Completing the Squre nd the Qudrtic Formul Fctoring qudrtic epressions such s: + 6 + 8 ws one of the topics introduced in Appendi C. Fctoring qudrtic epressions is useful skill tht cn help you
More informationMacmillan Publishers Limited. All rights reserved
doi:1.138/nture12799 Mycocteri mnipulte mcrophge recruitment through coordinted use of memrne lipids C. J. Cmier 1, Kevin K. Tkki 2, Ryn P. Lrson 1,3, Rfel E. Hernndez 4, Dvid M. Toin 2, Kevin B. Urdhl
More informationAdditional Protocol to the Convention on Human Rights and Biomedicine concerning Genetic Testing for Health Purposes
Council of Europe Trety Series - No. 203 Additionl Protocol to the Convention on Humn Rights nd Biomedicine concerning Genetic Testing for Helth Purposes Strsourg, 27.XI.2008 2 CETS 203 Humn Rights nd
More informationRecognition Scheme Forensic Science Content Within Educational Programmes
Recognition Scheme Forensic Science Content Within Eductionl Progrmmes one Introduction The Chrtered Society of Forensic Sciences (CSoFS) hs been ccrediting the forensic content of full degree courses
More informationTranscription control reprogramming in genetic backup circuits
Trnscription control reprogrmming in genetic ckup circuits Rn Kfri, Arren Br-Even & Yitzhk Pilpel A key question in moleculr genetics is why severe muttions often do not result in detectly norml phenotype.
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationAn Undergraduate Curriculum Evaluation with the Analytic Hierarchy Process
An Undergrdute Curriculum Evlution with the Anlytic Hierrchy Process Les Frir Jessic O. Mtson Jck E. Mtson Deprtment of Industril Engineering P.O. Box 870288 University of Albm Tuscloos, AL. 35487 Abstrct
More informationCorporate Compliance vs. Enterprise-Wide Risk Management
Corporte Complince vs. Enterprise-Wide Risk Mngement Brent Sunders, Prtner (973) 236-4682 November 2002 Agend Corporte Complince Progrms? Wht is Enterprise-Wide Risk Mngement? Key Differences Why Will
More informationOr more simply put, when adding or subtracting quantities, their uncertainties add.
Propgtion of Uncertint through Mthemticl Opertions Since the untit of interest in n eperiment is rrel otined mesuring tht untit directl, we must understnd how error propgtes when mthemticl opertions re
More informationClassical conditioning in Aplysia californica (associative learning/locomotion)
Proc. Ntl. Acd. Sci. USA Vol.76, No. 12, pp. 6675-6679, December 1979 Neurobiology Clssicl conditioning in Aplysi clifornic (ssocitive lerning/locomotion). T. WALTRS*, T. J. CARW*t, AND. R. KANDL*t *Division
More informationAntiSpyware Enterprise Module 8.5
AntiSpywre Enterprise Module 8.5 Product Guide Aout the AntiSpywre Enterprise Module The McAfee AntiSpywre Enterprise Module 8.5 is n dd-on to the VirusScn Enterprise 8.5i product tht extends its ility
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationCompromised CDK1 activity sensitizes BRCA-proficient cancers to PARP inhibition
r t i c l e s Compromised CDK ctivity sensitizes BRCA-proficient cncers to PARP inhiition Neil Johnson,2, Yu-Chen Li, Zndr E Wlton, Ktherine A Cheng, Dnn Li, Scott J Rodig 3,4, Lis A Moreu,6, Christine
More informationTHE EFFECTS OF INCREASED PROTEIN INTAKE ON KIDNEY SIZE AND FUNCTION
The Journl of Experimentl iology 21, 281 29 (1998) Printed in Gret ritin The Compny of iologists Limited 1998 JE1492 281 THE EFFECTS OF INCRESED PROTEIN INTKE ON KIDNEY SIZE ND FUNCTION KIMERLY. HMMOND
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationEnterprise Risk Management Software Buyer s Guide
Enterprise Risk Mngement Softwre Buyer s Guide 1. Wht is Enterprise Risk Mngement? 2. Gols of n ERM Progrm 3. Why Implement ERM 4. Steps to Implementing Successful ERM Progrm 5. Key Performnce Indictors
More informationRegular Sets and Expressions
Regulr Sets nd Expressions Finite utomt re importnt in science, mthemtics, nd engineering. Engineers like them ecuse they re super models for circuits (And, since the dvent of VLSI systems sometimes finite
More informationRate and Activation Energy of the Iodination of Acetone
nd Activtion Energ of the Iodintion of Acetone rl N. eer Dte of Eperiment: //00 Florence F. Ls (prtner) Abstrct: The rte, rte lw nd ctivtion energ of the iodintion of cetone re detered b observing the
More informationMorgan Stanley Ad Hoc Reporting Guide
spphire user guide Ferury 2015 Morgn Stnley Ad Hoc Reporting Guide An Overview For Spphire Users 1 Introduction The Ad Hoc Reporting tool is ville for your reporting needs outside of the Spphire stndrd
More informationEffects of Testosterone Replacement on Renal Function and Apoptosis on Mesangial and Renal Tubule Cells in Rats
Yongo Act medic 21;41:37 44 Effects of Testosterone Replcement on Renl Function nd Apoptosis on Mesngil nd Renl Tuule Cells in Rts Kuniysu Murok Deprtment of Urology nd First Deprtment of Pthology, Tottori
More informationHelicopter Theme and Variations
Helicopter Theme nd Vritions Or, Some Experimentl Designs Employing Pper Helicopters Some possible explntory vribles re: Who drops the helicopter The length of the rotor bldes The height from which the
More informationHow To Network A Smll Business
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationIntegrating Health and Prevention Services in Syringe Access Programs: A Strategy to Address Unmet Needs in a High-Risk Population
Service Integrtion Integrting Helth nd Prevention Services in Syringe Access Progrms: A Strtegy to Address Unmet Needs in High-Risk Popultion Crolyn K. Burr, EdD, RN Deorh S. Storm, MSN, PhD Mry Jo Hoyt,
More informationHumana Critical Illness/Cancer
Humn Criticl Illness/Cncer Criticl illness/cncer voluntry coverges py benefits however you wnt With our criticl illness nd cncer plns, you'll receive benefit fter serious illness or condition such s hert
More informationBasic Analysis of Autarky and Free Trade Models
Bsic Anlysis of Autrky nd Free Trde Models AUTARKY Autrky condition in prticulr commodity mrket refers to sitution in which country does not engge in ny trde in tht commodity with other countries. Consequently
More informationIn addition, the following elements form an integral part of the Agency strike prevention plan:
UNITED STTES DEPRTMENT OF GRICULTURE Wshington, DC 20250 Federl Grin Inspection Service FGIS Directive 4711.2 6/16/80 STRIKE PREVENTION ND STRIKE CONTINGENCY PLNS I PURPOSE This Instruction: Estlishes
More informationA multistep epigenetic switch enables the stable inheritance of DNA methylation states
27 Nture ublishing Group http://www.nture.com/nturegenetics A multistep epigenetic switch enbles the stble inheritnce of DNA methyltion sttes Hn N Lim,2 & Alexnder vn Oudenrden In mny prokryotes nd eukryotes,
More informationA COMPARISON OF ALCOHOL SCREENING INSTRUMENTS AMONG UNDER-AGED DRINKERS TREATED IN EMERGENCY DEPARTMENTS
Alcohol & Alcoholism Vol. 37, No. 5, pp. 444 450, 2002 A COMPARISON OF ALCOHOL SCREENING INSTRUMENTS AMONG UNDER-AGED DRINKERS TREATED IN EMERGENCY DEPARTMENTS THOMAS M. KELLY 1 *, JOHN E. DONOVAN 1, JANET
More informationARTICLE IN PRESS. i n t e r n a t i o n a l j o u r n a l o f m e d i c a l i n f o r m a t i c s x x x ( 2 0 1 2 ) xxx xxx
IJB-2938; No. of Pges 12 i n t e r n t i o n l j o u r n l o f m e d i c l i n f o r m t i c s x x x ( 2 0 1 2 ) xxx xxx j ourn l homepge: www.ijmijournl.com Description nd comprison of qulity of electronic
More informationGene Expression Programming: A New Adaptive Algorithm for Solving Problems
Gene Expression Progrmming: A New Adptive Algorithm for Solving Prolems Cândid Ferreir Deprtmento de Ciêncis Agráris Universidde dos Açores 9701-851 Terr-Chã Angr do Heroísmo, Portugl Complex Systems,
More informationNavy Asbestos Medical Surveillance Program 1990 1999: Demographic Features and Trends in Abnormal Radiographic Findings
MILITARY MEDICINE, 171, 8:717, 2006 Nvy Asbestos Medicl Surveillnce Progrm 1990 1999: Demogrphic Fetures nd Trends in Abnorml Rdiogrphic Findings Gurntor: Dnielle M. Dell, MPH Contributors: Dnielle M.
More informationHealth insurance marketplace What to expect in 2014
Helth insurnce mrketplce Wht to expect in 2014 33096VAEENBVA 06/13 The bsics of the mrketplce As prt of the Affordble Cre Act (ACA or helth cre reform lw), strting in 2014 ALL Americns must hve minimum
More informationThe LENA TM Language Environment Analysis System:
FOUNDATION The LENA TM Lnguge Environment Anlysis System: Audio Specifictions of the DLP-0121 Michel Ford, Chrles T. Ber, Dongxin Xu, Umit Ypnel, Shrmi Gry LENA Foundtion, Boulder, CO LTR-03-2 September
More informationSection 5.2, Commands for Configuring ISDN Protocols. Section 5.3, Configuring ISDN Signaling. Section 5.4, Configuring ISDN LAPD and Call Control
Chpter 5 Configurtion of ISDN Protocols This chpter provides instructions for configuring the ISDN protocols in the SP201 for signling conversion. Use the sections tht reflect the softwre you re configuring.
More informationThe Determinants of Private Medical Insurance Prevalence in England
The Determinnts of Privte Medicl Insurnce Prevlence in Englnd Derek R. King, Elis Mossilos LSE Helth nd Socil Cre, London School of Economics nd Politicl Science LSE Helth nd Socil Cre Discussion Pper
More informationIntroduction 1 From need to demand Solutions 1 a
Introduction 1 From need to demnd Solutions 1 Need Existence need Sfety need Socil need Esteem need Self-ctuliztion need Exmples Clothing, medicl cre, wrmth, sexulity Protection ginst threts, stility Belonging
More informationIntroducing Kashef for Application Monitoring
WextWise 2010 Introducing Kshef for Appliction The Cse for Rel-time monitoring of dtcenter helth is criticl IT process serving vriety of needs. Avilbility requirements of 6 nd 7 nines of tody SOA oriented
More informationDlNBVRGH + Sickness Absence Monitoring Report. Executive of the Council. Purpose of report
DlNBVRGH + + THE CITY OF EDINBURGH COUNCIL Sickness Absence Monitoring Report Executive of the Council 8fh My 4 I.I...3 Purpose of report This report quntifies the mount of working time lost s result of
More informationSurvival of Non-small Cell Lung Cancer Patients with Postoperative Recurrence at Distant Organs
Survivl of Non-smll Cell Cncer Ptients with Postopertive Recurrence t Distnt Orgns Ichiro Yoshino, MD, 1,2 Tomofumi Yohen, MD, 1 Mschik Kitjim, MD, 1 Chie Ushijim, MD, 1 Kenichi Nishiok, MD, 1 Yukito Ichinose,
More informationSimulation of operation modes of isochronous cyclotron by a new interative method
NUKLEONIKA 27;52(1):29 34 ORIGINAL PAPER Simultion of opertion modes of isochronous cyclotron y new intertive method Ryszrd Trszkiewicz, Mrek Tlch, Jcek Sulikowski, Henryk Doruch, Tdeusz Norys, Artur Srok,
More informationEQUATIONS OF LINES AND PLANES
EQUATIONS OF LINES AND PLANES MATH 195, SECTION 59 (VIPUL NAIK) Corresponding mteril in the ook: Section 12.5. Wht students should definitely get: Prmetric eqution of line given in point-direction nd twopoint
More informationStudy on enzyme-assisted aqueous extraction of oil from soybean
8 Journl Scientific & Industril Reserch J SCI IND RES VOL 69 NOVEMBER 2010 Vol. 69, November 2010, pp. 8-865 Study on enzyme-ssisted queous extrction oil from soyben Jun-Qing Qin*, De-Hui Qin, Xing-Mo
More informationEE247 Lecture 4. For simplicity, will start with all pole ladder type filters. Convert to integrator based form- example shown
EE247 Lecture 4 Ldder type filters For simplicity, will strt with ll pole ldder type filters Convert to integrtor bsed form exmple shown Then will ttend to high order ldder type filters incorporting zeros
More informationSyGEMe: Integrated Municipal Facilities Management of Water Ressources Swiss Geoscience Meeting, Neuchâtel, 21 novembre 2009 k
SyGEMe: Integrted Municipl Fcilities Mngement of Wter Ressources Tool presenttion, choice of technology, mn-mchine mchine interfce, business opportunities nd prospects 1. Introduction 2. Mn-mchine interfce
More informationModule 2. Analysis of Statically Indeterminate Structures by the Matrix Force Method. Version 2 CE IIT, Kharagpur
Module Anlysis of Stticlly Indeterminte Structures by the Mtrix Force Method Version CE IIT, Khrgpur esson 9 The Force Method of Anlysis: Bems (Continued) Version CE IIT, Khrgpur Instructionl Objectives
More informationSubjective health complaints and psychosocial work environment among university personnel
Occuptionl Medicine Advnce Access published November 8, 2012 Occuptionl Medicine doi:10.1093/occmed/kqs188 Subjective helth complints nd psychosocil work environment mong university personnel Bente E.
More informationTest Management using Telelogic DOORS. Francisco López Telelogic DOORS Specialist
Test Mngement using Telelogic DOORS Frncisco López Telelogic DOORS Specilist Introduction Telelogic solution for Requirements Mngement DOORS Requirements mngement nd trcebility pltform for complex systems
More informationHealth insurance exchanges What to expect in 2014
Helth insurnce exchnges Wht to expect in 2014 33096CAEENABC 02/13 The bsics of exchnges As prt of the Affordble Cre Act (ACA or helth cre reform lw), strting in 2014 ALL Americns must hve minimum mount
More informationEffect of viscosity on C sugar in Beet sugar factories
ANNUAL TRANSACTIONS OF THE NORDIC RHEOLOGY SOCIETY, VOL. 16, 2008 Effect of on C sugr in Beet sugr fctories Mohmmd Hojjtoleslmy 1, Rez Shokrni 2 nd Ahmd Krsi 3 1 Deprtment of food technology, College of
More informationAPPLICATION NOTE Revision 3.0 MTD/PS-0534 August 13, 2008 KODAK IMAGE SENDORS COLOR CORRECTION FOR IMAGE SENSORS
APPLICATION NOTE Revision 3.0 MTD/PS-0534 August 13, 2008 KODAK IMAGE SENDORS COLOR CORRECTION FOR IMAGE SENSORS TABLE OF FIGURES Figure 1: Spectrl Response of CMOS Imge Sensor...3 Figure 2: Byer CFA Ptterns...4
More informationTHE PARAMETERS OF TRAPS IN K-FELDSPARS AND THE TL BLEACHING EFFICIENCY
GEOCHRONOMETRIA Vol. 2, pp 15-2, 21 Journl on Methods nd Applictions of Asolute Chronology THE PARAMETERS OF TRAPS IN K-FELDSPARS AND THE TL BLEACHING EFFICIENCY ALICJA CHRUŒCIÑSKA 1, HUBERT L. OCZKOWSKI
More informationAnswer, Key Homework 10 David McIntyre 1
Answer, Key Homework 10 Dvid McIntyre 1 This print-out should hve 22 questions, check tht it is complete. Multiple-choice questions my continue on the next column or pge: find ll choices efore mking your
More informationActive & Retiree Plan: Trustees of the Milwaukee Roofers Health Fund Coverage Period: 06/01/2015-05/31/2016 Summary of Benefits and Coverage:
Summry of Benefits nd Coverge: Wht this Pln Covers & Wht it Costs Coverge for: Single & Fmily Pln Type: NPOS This is only summry. If you wnt more detil bout your coverge nd costs, you cn get the complete
More informationImproving Library Users' Perceived Quality, Satisfaction and Loyalty: An Integrated Measurement and Management System
Improving Librry Users' Perceived Qulity, Stisfction nd Loylty: An Integrted Mesurement nd Mngement System by Anne Mrtensen nd Lrs Gr0nholdt This rticle describes the development nd ppliction of structurl
More informationBayesian Updating with Continuous Priors Class 13, 18.05, Spring 2014 Jeremy Orloff and Jonathan Bloom
Byesin Updting with Continuous Priors Clss 3, 8.05, Spring 04 Jeremy Orloff nd Jonthn Bloom Lerning Gols. Understnd prmeterized fmily of distriutions s representing continuous rnge of hypotheses for the
More informationINITIATION OF THERAPY Patient-specific considerations for initiation of apixaban therapy include the following:
UNC HEALTH CARE GUIDELINE Mngement of Apixn in Adults Apixn (Eliquis ) is n orl nticogulnt tht cts s fctor X inhiitor. It is pproved y the FDA for the prevention of stroke nd systemic emolism in ptients
More informationTwo hours UNIVERSITY OF MANCHESTER SCHOOL OF COMPUTER SCIENCE. Date: Friday 16 th May 2008. Time: 14:00 16:00
COMP20212 Two hours UNIVERSITY OF MANCHESTER SCHOOL OF COMPUTER SCIENCE Digitl Design Techniques Dte: Fridy 16 th My 2008 Time: 14:00 16:00 Plese nswer ny THREE Questions from the FOUR questions provided
More informationAccording to Webster s, the
dt modeling Universl Dt Models nd P tterns By Len Silversn According Webster s, term universl cn be defined s generlly pplicble s well s pplying whole. There re some very common ptterns tht cn be generlly
More informationSan Mateo County ACCEL Adult-Education College and Career Educational Leadership AB 86 Adult Education Consortium Project Management Plan 24, 2014 -
A Sn Mteo County ACCEL Adult-Eduction College nd Creer Eductionl Ledership AB 86 Adult Eduction Consortium Project Mngement Pln - Februry 24, 2014 - This project mngement pln presents ACCEL s process frmework
More informationJuly 2005, NCJ 209588 Substance Dependence, Abuse, and Treatment of Jail Inmates, 2002. Highlights. No dependence or abuse 53 47 32.
U.S. Deprtment of Justice Office of Justice Progrms Bureu of Justice Sttistics Specil Report By Jennifer C. Krerg nd Doris J. Jmes BJS Sttisticins In 2002 more thn two-thirds of jil inmtes were found to
More informationACCOUNTING FACULTY RESEARCH COLLABORATION: A STUDY OF RELATIONSHIP BENEFITS AND GENDER DIFFERENCES
Globl Perspectives on Accounting Eduction Volume 2, 2005, 19-36 ACCOUNTING FACULTY RESEARCH COLLABORATION: A STUDY OF RELATIONSHIP BENEFITS AND GENDER DIFFERENCES Mry Jenne Welsh L Slle University Phildelphi,
More informationQuick Reference Guide: One-time Account Update
Quick Reference Guide: One-time Account Updte How to complete The Quick Reference Guide shows wht existing SingPss users need to do when logging in to the enhnced SingPss service for the first time. 1)
More informationMEDICAL SURVEILLANCE MONTHLY REPORT
AUGUST 2015 Volume 22 Number 8 msmr MEDICAL SURVEILLANCE MONTHLY REPORT PAGE 2 PAGE 9 Updte: Routine screening for ntibodies to humn immunodeficiency virus, civilin pplicnts for U.S. militry service nd
More informationSource Code verification Using Logiscope and CodeReducer. Christophe Peron Principal Consultant Kalimetrix
Source Code verifiction Using Logiscope nd CodeReducer Christophe Peron Principl Consultnt Klimetrix Agend Introducing Logiscope: Improving confidence nd developer s productivity Bsed on stte-of-the-rt
More informationBiochar amendment to soils impairs developmental and reproductive performances of a major rice pest Nilaparvata lugens (Homopera: Delphacidae)
J. Appl. Entomol. ORIGINAL CONTRIBUTION Biochr mendment to soils impirs developmentl nd reproductive performnces of mjor rice pest Nilprvt lugens (Homoper: Delphcide) X. Hou 1, L. Meng 1,L.Li 2, G. Pn
More informationENHANCING CUSTOMER EXPERIENCE THROUGH BUSINESS PROCESS IMPROVEMENT: AN APPLICATION OF THE ENHANCED CUSTOMER EXPERIENCE FRAMEWORK (ECEF)
ENHNCING CUSTOMER EXPERIENCE THROUGH BUSINESS PROCESS IMPROVEMENT: N PPLICTION OF THE ENHNCED CUSTOMER EXPERIENCE FRMEWORK (ECEF) G.J. Both 1, P.S. Kruger 2 & M. de Vries 3 Deprtment of Industril nd Systems
More informationPolynomial Functions. Polynomial functions in one variable can be written in expanded form as ( )
Polynomil Functions Polynomil functions in one vrible cn be written in expnded form s n n 1 n 2 2 f x = x + x + x + + x + x+ n n 1 n 2 2 1 0 Exmples of polynomils in expnded form re nd 3 8 7 4 = 5 4 +
More informationInteraction between leukemic-cell VLA-4 and stromal fibronectin is a decisive factor for minimal residual disease of acute myelogenous leukemia
Interction etween leukemic-cell VLA-4 nd stroml fironectin is decisive fctor for miniml residul disese of cute myelogenous leukemi Tkuy Mtsung 1,5,Nofumi Tkemoto 1,5,Tsutomu Sto 1,Rishu Tkimoto 1, Ikut
More informationTreating Prostate Cancer
CHAPTER 4 Treting Prostte Cncer here is controversy bout the optiml tretment for cliniclly loclized prostte cncer (i.e., cncer tht ppers not to hve spred beyond the prostte bsed on informtion vilble without
More informationCHARACTERIZATION OF HASS AVOCADO PROLEPTIC AND SYLLEPTIC SHOOT PROPORTION IN VALPARAISO REGION, CHILE
Proceedings VI World Avocdo Congress (Acts VI Congreso Mundil del Agucte) 2007. Viñ Del Mr, Chile. 12 16 Nov. 2007. ISBN No 978-956-17-0413-8. CHARACTERIZATION OF HASS AVOCADO PROLEPTIC AND SYLLEPTIC SHOOT
More informationOperations with Polynomials
38 Chpter P Prerequisites P.4 Opertions with Polynomils Wht you should lern: Write polynomils in stndrd form nd identify the leding coefficients nd degrees of polynomils Add nd subtrct polynomils Multiply
More informationCombined Liability Insurance. Information and Communication Technology Proposal form
Comined Liility Insurnce Informtion nd Communiction Technology Proposl form Comined Liility Insurnce Informtion nd Communiction Technology - Proposl form This proposl form must e completed nd signed y
More informationT H E S E C U R E T R A N S M I S S I O N P R O T O C O L O F S E N S O R A D H O C N E T W O R K
Z E S Z Y T Y N A U K O W E A K A D E M I I M A R Y N A R K I W O J E N N E J S C I E N T I F I C J O U R N A L O F P O L I S H N A V A L A C A D E M Y 2015 (LVI) 4 (203) A n d r z e j M r c z k DOI: 10.5604/0860889X.1187607
More information