Townes-Brocks Syndrome: Detection of a SALL1 Mutation Hot Spot and Evidence for a Position Effect in One Patient

Size: px
Start display at page:

Download "Townes-Brocks Syndrome: Detection of a SALL1 Mutation Hot Spot and Evidence for a Position Effect in One Patient"

Transcription

1 HUMAN MUTATION 14: (1999) RESEARCH ARTICLE Townes-Brocks Syndrome: Detection of a SALL1 Mutation Hot Spot and Evidence for a Position Effect in One Patient Sandrine Marlin, 1 Stéphane Blanchard, 1 Rima Slim, 1 Didier Lacombe, 2 Françoise Denoyelle, 1,3 Jean-Louis Alessandri, 4 Elisa Calzolari, 5 Valérie Drouin-Garraud, 6 F.G. Ferraz, 7 Alain Fourmaintraux, 8 Nicole Philip, 9 Jean-Edmond Toublanc, 10 and Christine Petit 1 * 1 Unité de Génétique des Déficits Sensoriels, Institut Pasteur, Paris, France 2 Pédiatrie & Génétique Médicale, Hôpital Pellegrin-Enfants, Bordeaux, France 3 Service ORL, Hôpital d Enfants Armand-Trousseau, Paris, France 4 Service de Néonatologie, Hôpital Félix Guyon, St Denis, La Réunion 5 Istituto di Genetica Medica, Universita degli Studi Ferrara, Ferrara, Italy 6 Unité de Génétique Clinique, Hôpital Charles Nicolle, Rouen, France 7 Department of Genetics, Pediatric Hospital D. Estefania, Lisbon, Portugal 8 Unité de Néonatologie, Centre Hospitalier, St Pierre, La Réunion 9 Centre de Génétique Médicale, Hôpital Timone-Enfants, Marseille, France 10 Service Consultations, Hôpital Saint-Vincent de Paul, Paris, France Communicated by Jean-Louis Mandel Townes-Brocks syndrome (TBS) is an autosomal dominant developmental disorder characterized by anal and thumb malformations and by ear anomalies that can affect the three compartments and usually lead to hearing loss. The gene underlying TBS, SALL1, is a human homolog of the Drosophila spalt gene which encodes a transcription factor. A search for SALL1 mutations undertaken in 11 unrelated affected individuals (five familial and six sporadic cases) led to the detection of mutations in nine of them. One nonsense and six different novel frameshift mutations, all located in the second exon, were identified. Together with the previously reported mutations [Kohlhase et al., 1999], they establish that TBS results from haploinsufficiency. The finding of de novo mutations in the sporadic cases is consistent with the proposed complete penetrance of the disease. Moreover, the occurrence of the same 826C>T transition in a CG dimer, in three sporadic cases from the present series and three sporadic cases from the other series [Kohlhase et al., 1999] (i.e., six of the eight mutations identified in sporadic cases), reveals the existence of a mutation hotspot. Six different SALL1 polymorphisms were identified in the course of the present study, three of which are clustered in a particular region of the gene that encodes a stretch of serine residues. Finally, the chromosome 16 breakpoint of a t(5;16)(p15.3;q12.1) translocation carried by a TBS-affected individual was mapped at least 180 kb telomeric to SALL1, thus indicating that a position effect underlies the disease in this individual. Hum Mutat 14: , Wiley-Liss, Inc. KEY WORDS: Townes-Brocks syndrome; mutation; position effect INTRODUCTION In 1972, Townes and Brocks [1972] described a syndrome comprising an imperforate anus, triphalangeal thumbs, external ear anomalies ( satyr ears ) and sensorineural deafness, and which showed an autosomal dominant mode of transmission. The prevalence of Townes-Brocks syndrome (TBS; Received 27 May 1999; accepted revised manuscript 11 August *Correspondence to: Christine Petit, Unité de Génétique des Déficits Sensoriels, CNRS URA 1968, Institut Pasteur, 25 rue du Dr Roux, Paris Cedex 15, France. Grant sponsor: Association Française contre les Myopathies (France). Present address for Rima Slim: Department of Biochemistry, American University, Beirut, Lebanon WILEY-LISS, INC.

2 378 MARLIN ET AL. MIM# ) is unknown. To date, 113 cases have been reported worldwide, 93 of which are familial; the intrafamilial phenotypic expression is variable (for review, see Allanson [1995], and Marlin, in preparation). The typical clinical signs are malformations of the anus (80% of the cases), radial axis (50% of the cases, mainly preaxial polydactyly), and outer ear (65% of the cases) which are often associated with hearing loss (40% of the cases). The hearing loss can be sensorineural, conductive, or mixed [Rossmiller and Pasic, 1994]. Additional anomalies have been reported [for review, see Powell and Michaelis, 1999], namely, renal (19%) [Kurnit et al., 1978; Newman et al., 1997], urogenital (15%) [de Vries-Van der Weerd et al., 1988], skeletal (28%, mainly foot malformations) [Green et al., 1996], and cardiac (15%) [Barakat et al., 1988] anomalies. The diverse anomalies associated with TBS suggest a developmental defect taking place during the organogenesis period, i.e., between embryonic weeks 5 and 10. The gene responsible for TBS has been identified as SALL1 (MIM# ) by the detection of a single basepair deletion and a nonsense mutation in two affected families [Kohlhase et al., 1998]. SALL1 is one of two identified human homologs [Kohlhase et al., 1996] of the Drosophila developmental gene spalt which encodes a transcription factor [Kühnlein et al., 1994]. Spalt mutants exhibit homeotic head and tail transformations [Jürgens, 1988]. Partial or complete cdna sequences of spalt homologs from several species have been characterized, namely msal-1 in mouse [Ott et al., 1996], spalt in medaka fish [Köster et al., 1997], and Xsal-1 in Xenopus [Hollemann et al., 1996]. They encode proteins which contain the typical eight amino acids SAL-box (FTTK- GNLK) [Kühnlein et al., 1994] and a variable number of zinc finger motifs. Patients from 12 unrelated families (five familial cases and seven sporadic cases) who upon careful clinical examination were recognized as presenting the most prominent features for TBS were studied. We report on the molecular analysis of the SALL1 gene, which led us to detect the causative mutations in nine of them. Moreover, the characterization of the chromosome 16 breakpoint present in a TBSaffected individual carrying a 5p16q translocation allowed us to propose that a position effect is responsible for the disease in this patient. Patients SUBJECTS AND METHODS The diagnosis of TBS was based on the occurrence of anal and thumb malformations and ear anomalies. Families TB3, TB4, TB5, TB8, TB11, and TB10 [case report in Marlin et al., 1998] were from France, TB1 and TB9 from Île de la Réunion (Indian Ocean), TB2 from Spain, TB6 from Portugal [case report in Ferraz et al., 1989], and TB7 from Italy [case report in Baldi et al., 1995]. Individual TB12, carrying a t(5;16)(p15.3;q12.1) translocation, was described in Serville et al. [1993]. Informed consent for the molecular analysis was obtained from all families. DNA was prepared from whole blood samples by standard phenol/chloroform extraction and ethanol precipitation. Molecular analysis was performed in the propositus and both nonaffected parents of families TB6, TB7, TB8, and TB9, in the propositus and affected mother of families TB1, TB3, and TB4, in the propositus and affected father of family TB5, and only in the propositus of families TB2, TB10, TB11, and TB12. TABLE 1. Primers for PCR Amplification and Sequencing of the SALL1 Exons Amplification Sequencing primers Exon primers Forward (5 3 ) Reverse (5 3 ) 1 Ex1a pex1 a 32 tttattctgccccagctgatg aattacgccgagtggaag 2 TF1 TR2 b gtcctggccccttttctaatc b 414 GCCGCTGCCGCTTTTGTTAG 323 TGGACTGCAGCGACCTTT 862 GGGAACTTAGCGTGGACA 682 GCCCTCATGGAACAACTC 1,242 TCTGCAGTTGTTCCGATGTT 1,102 CCAGCGGTCTCATCATCGTC 1,619 CTGGTGACTGGCTTCTCTGG TF2 TR5 b 1,492 CGCCACAAAGAGAAATACCC 2,015 GCCTTGAACTGCTCGGACAT 1,844 CCACTCTGCCACCCTCTG 2,415 GGACTCAGAGTAGCTGTC 2,255 ACTACAGTGTCCATCGTG 2,780 TGCATGGAAGAGGTAGAC 2,654 TGAAGTCAGTGGAGAATG 3,240 CGAGTTGGCGGGAATCAC 3,098 TTTGCAATCGTGGCTTTTCC ggacagggttgatggagcag b 3 TF5 TR5.1 b gttgccttcactgtcgtcac b tctgaacaggaatgaatgctatg b Primers located in introns and untranslated regions are in lower case, their positions are indicated in italics. a See primer sequences in Subjects and Methods. b Primers reported by Kohlhase et al. [1998].

3 SALL1 MUTATIONS IN TOWNES-BROCKS SYNDROME 379 PCR Amplification and Sequencing of the SALL1 Exons The PCR amplification and sequencing of doublestranded DNA templates (dideoxy chain terminator method using fluorescent dideoxynucleotides) were performed under the same conditions as in Lévy et al. [1997]. For exon 1 amplification, the primers used were EX1a (starting in the noncoding part of this exon, 32 bp 5 from the ATG initiation codon) and pex1 (starting 143 bp 3 from the donor splice site of this exon) (Table 1). PCR amplification of exon 2 was carried out in two parts, using primer pairs TF1 TR2 (5 side, 1.5 kb amplicon) and TF2 TR5 (3 side, 2.2 kb amplicon), and that of exon 3, using primer pair TF5 TR5.1 according to Kohlhase et al. [1998]. The primers used for sequencing are listed in Table 1. In patient TB5, PCR amplification using primers TF2 (within exon 2) and TR5 (within intron 2) resulted in the normal 2.2 kb band and an additional 1.1 kb band. The latter was separated from the normal one by agarose gel electrophoresis and sequenced. Southern Blot Analysis Ten µg of HindIII-digested genomic DNA were run on a 0.8% agarose gel and blotted onto N+- Hybond filters (Amersham, Arlington Hts., IL). Blots were hybridized in Church buffer overnight at 65 C. Membranes were washed in 0.2x SSC, 0.1% SDS at 65 C. The probes used to analyze each of the SALL1 exons were derived by PCR amplification using the primer pairs EX1A pex1 for exon 1 (see above), TF1 TR5 or TF2 TR5 for exon 2, and TF5 TR5.1 for exon 3 [Kohlhase et al., 1998]. Construction of l Phage Libraries of PAC 4645 and YAC 438H5, and Sequencing DNA from P1 phage artificial chromosome (PAC) 4645 and yeast artificial chromosome (YAC) 438H5 was partially digested with Sau 3AI, and run on a 0.6% agarose gel. Fragments in the kb range were eluted, ligated to λ pgem11 vector (Promega, Madison, WI), and packaged in E. coli KW251 using the Promega Packaging system extract. To construct a contig of λ clones covering PAC 4645 and YAC 438H5, the extremities of this PAC, this YAC, and each subsequently selected λ subclone were sequenced and used as probes (after PCR amplification) to get overlapping new λ clones from the library. The clones covering the entire PAC 4645 and the telomeric 100 kb of YAC 438H5 were sequenced. FIGURE 1. Pedigrees of the five families affected by TBS. The propositus is indicated by an asterisk.

4 TABLE 2. Summary of the Clinical Features Presented by the TBS Patients Patient a Anal malformations Thumb anomalies Ear malformations Hearing loss Other features TB1 (F) Imperforate Bifid thumbs Preauricular tags Sensorineural Bilateral renal hypoplasia mild Persistent ductus arteriosus Foot malformations + abnormal toes TB2 (F) Imperforate Triphalangeal thumbs Preauricular tags Mixed Normal renal ultrasonography Severe Bifid toes TB3 (F) Imperforate Triphalangeal thumbs Microtia Sensorineural Normal renal ultrasonography Perineal fistula Moderate Foot malformation Arachnodactyly TB4 (F) Stenosis Broad thumbs Microtia Unknown Unknown Antepositioned Low set ears TB5 (F) Imperforate Bifid thumbs Preauricular tags Unknown Unilateral renal agenesis Abnormal helix Metacarpal anomalies Low set ears Growth delay TB6 b (S) Imperforate Hexadactyly Satyr ears Mixed Normal renal ultrasonography Perineal fistula Triphalangeal thumb Preauricular tags Mild Uterovaginal hypoplasia Ventricular septal defect Hand syndactylies TB7 c (S) Imperforate Hexadactyly External auditory atresia Sensorineural Bilateral renal hypoplasia Perineal fistula Triphalangeal thumbs Microtia Profound Preauricular tags + pits TB8 (S) Imperforate Hexadactyly External auditory atresia Mixed Renal failure Triphalangeal thumbs Microtia Profound Foot malformations Retinal maculopathy Angioedema d TB9 (S) Vulvar anus Hexadactyly No No Normal renal ultrasonography TB10 e (S) Imperforate Triphalangeal thumbs No No Normal renal ultrasonography Pubertal delay TB11 (S) Imperforate No External ear aplasia Mixed Normal renal ultrasonography Mild Hand + foot syndactylies TB12 f (S) Imperforate Triphalangeal thumbs Preauricular tags No Normal renal ultrasonography Antepositioned Overfolded helix No a F = familial case; S = sporadic case. b The mutation identified in this patient [described in Ferraz et al., 1989], was not detected in either of her parents, thus leading to the conclusion that the deafness and other mild symptoms affecting the grandfather (and his own grandfather and granduncle) [see pedigree in Ferraz et al., 1989] cannot be ascribed to TBS. c Described in Baldi et al. [1995]. d A mutation in the gene coding for the C1 inhibitor has been identified in this individual and other family members who suffered from angioedema [Verpy et al., 1996]; none of the latter presented with TBS anomalies. e Described in Marlin et al. [1998]. f Described in Serville et al. [1993]. This patient carries a t(5;16)(p15.3;q12.1) chromosomal translocation. 380 MARLIN ET AL.

5 SALL1 MUTATIONS IN TOWNES-BROCKS SYNDROME 381 Fluorescence In Situ Hybridization (FISH) Analysis Metaphase chromosome spreads from individual TB12 (t(5;16)(p15.3;q12.1)) were prepared and hybridized, as described previously [Vincent et al., 1994], with probes corresponding to the entire YAC 438H5, the entire PAC 4645, and each of its λ subclones. RESULTS Search for SALL1 Mutations in TBS Affected Individuals The cdna sequence corresponding to SALL1 first exon, obtained as a result of 5 RACE-PCR (not shown) (GenBank accession number AF074949), and the genomic structure that we established in parallel were entirely consistent with those reported in the meantime [Kohlhase et al., 1999] (GenBank accession number Y18265). Eleven unrelated individuals affected by TBS, without any detectable karyotypic anomaly, were studied. They consist of five familial (families TB1 to TB5, pedigrees in Fig. 1) and six sporadic (individuals TB6 to TB11) cases. The clinical features of the patients are described in Table 2 and Figure 1. The three SALL1 coding exons were PCR-amplified and sequenced in the proband and in both parents whenever possible. For that purpose, specific primer pairs were designed for the first two exons (see Table 1), whereas the previously described primers were used to explore the third exon [Kohlhase et al., 1998]. Mutations were identified in nine patients. They consist of seven different mutations: one nonsense mutation, three microdeletions, two microinsertions, and one large complex deletion (Table 3a, and see Figs. 2 and 3). All are located in the second exon and result in premature protein truncation. No SALL1 mutation was detected in patients TB10 and TB11; Southern blot analysis, using probes corresponding to each of the three SALL1 exons, failed to detect any gross DNA rearrangement in these patients either (see Fig. 3; and data not shown). In addition to the aforementioned mutations, six nucleotide changes were identified, of which two are silent polymorphisms, two lead to an amino acid change (S159G, G1265E), and two result in the insertion (S ins) or deletion (S164del) of a serine residue (Table 3b). The latter four mutations were considered as asymptomatic polymorphisms since three of them were present in both the propositus and an unaffected parent or relative, and the remaining one (S ins, in family TB4) was present simultaneously with the 1565delC frameshift mutation (Table 3a), supposed to be responsible for the disease in this family. Characterization of the Chromosome 16 Breakpoint in a TBS Individual Carrying a 5p;16q Translocation: Evidence for a Position Effect The occurrence of a balanced translocation t(5;16)(p15.3;q12.1) in a TBS-affected child (TB12) has permitted the assignment of the causative gene to 16q12.1 [Serville et al., 1993]. No SALL1 modification was detected in TB12, either by DNA sequencing or by Southern blot analysis (Fig. 3). A PAC library and a YAC library were screened with sequence tagged sites (STSs) of the paracentromeric region of chromosome 16. The clones so selected were characterized by FISH on the patient s chromosomes. We thereby identified PAC 4645, encompassing the 16q breakpoint, and YAC 438H5 (180 kb, located centromeric to the breakpoint) (not shown). PAC 4645 (Fig. 4a) was subcloned into λ phages which were ordered into a contig (see Subjects and Methods). The λ 12.6 subclone spanning the breakpoint was identified by FISH (Fig. 4b). According to the contig map, λ 12.6 was located at approximately 40 kb from the centromeric end of PAC Since sequencing of this PAC as well as PCR amplification of the TABLE 3. Nucleotide Changes in SALL1 and Predicted Modifications of the Protein (a) Nucleotide Amino acid Patient* change change TB1 (F) delCA frameshift TB2 (F) insA frameshift TB3 (F) insAG frameshift TB4 (F) 1565delC frameshift TB5 (F) 1487del562 frameshift 2056del588 TB6, TB7, TB8 (S) 826C>T** R276X TB9 (S) 1966del10 frameshift (b) Nucleotide Amino acid Exon change change 2 475A>G** S159G insAGC** S ins delAGC S164del G>A no T>C no G>A G1265E (a) Mutations in TBS affected patients. *F = familial, S = sporadic. In patient TB5, PCR amplification of the 3 part of exon 2 revealed a band of the expected size (2.2 kb), and a smaller additional band (1.1 kb) which was sequenced (not shown). This allowed us to identify a 1.1 kb complex deletion within which a short segment of 6 bp was preserved. This deletion predicts the loss of a HindIII restriction site in exon 2 which was performed by Southern blot analysis (see Fig. 3). (b) Polymorphisms. **These nucleotide changes have also been reported in Kohlhase et al. [1999]. Nomenclature according to Beaudet and Tsui [1993] modified by Antonarakis [1998].

6 382 MARLIN ET AL. adjacent YAC 438H5 failed to detect any SALL1 sequence within this interval, we undertook a physical mapping of this chromosomal region. We first selected a bacterial artificial chromosome (BAC 230e15) containing the three SALL1 exons. The distal end of YAC 438H5 was found to overlap approximately 30 kb of PAC 4645, and its proximal end about 10 kb of BAC 230e15 (Fig. 4a; FIGURE 2. Electrophoretograms showing the mutations in six TBS individuals. In each case, the corresponding normal graph (wt) is presented in parallel. For three mutations, the sequence of the DNA strand which is presented is complementary to that of the cdna, and the direct sequence has been added on top of the normal electrophoretogram.

7 SALL1 MUTATIONS IN TOWNES-BROCKS SYNDROME 383 FIGURE 3. Southern blot analysis of SALL1 exon 2 in TBS individuals. HindIII-digested genomic DNA from BAC 230e15 (lane 1), patients TB12 (t(5;16)(p15.3;q12.1)) (lane 2), TB10 (lane 3) and TB11 (lane 6) (two sporadic TBS cases with no detected point mutation), TB5 (1.1 kb deletion) (lane 4), and one control individual (lane 5) were hybridized with a PCR product obtained using primers TF2 TR5, corresponding to the 3 part of exon 2 (see Subjects and Methods). This probe detects two SALL1 specific bands (2.5 kb and 3 kb) in all individuals except TB5 (lane 4), who carries a heterozygous 1.1 kb deletion which results in the loss of an HindIII restriction site and gives rise to the additional 4 kb band. The two other bands detected by this probe are indicative of a yet-unidentified SAL gene or pseudogene. see Subjects and Methods). These results show that the chromosomal breakpoint in TB12 is located at a minimal distance of 180 kb from SALL1. The present data establish that TBS in this patient results from a position effect [for review, see Kleinjan and van Heyningen 1998], the mechanism of which awaits further characterization. In particular, in the absence so far of characterization of the SALL1 regulatory elements, the disruption of a remote one should be considered. DISCUSSION In this series, the causative mutations or chromosomal rearrangement were detected in 10 out of 12 unrelated TBS-affected individuals. No SALL1 mutation or karyotypic anomaly was detected in patients TB10 and TB11. The possibility of a misdiagnosis for these patients seems unlikely, as they both present with classical clinical features of TBS (see Table 2). As there is no evidence for genetic heterogeneity in TBS, TB10, and TB11 presumably carry a mutation in the unexplored regions of SALL1, i.e., the promoter, introns, and 5 and 3 untranslated regions. Alternatively, TBS in these patients might result from a position effect associated with a chromosomal rearrangement undetected by the karyotypic analysis. None of the four mutations identified in the sporadic cases (TB6, TB7, TB8, and TB9) was detected in either of the parents, demonstrating that these mutations occurred de novo. Together with the four de novo mutations from the other series [Kohlhase et al., 1998, 1999], the present results bring the total number of de novo mutations to 8 out of 20 identified SALL1 mutations. Assuming the absence of a recruitment bias in the two series of patients, this indicates that a high proportion of TBS cases are due to de novo mutations. The finding of de novo mutations in sporadic cases is consistent with the proposed full penetrance of the disease [Arroyo Carrera et al., 1996]. So far, only one phenotypically normal individual was found to carry a SALL1 mutation. In this case, however, the likely mosaic state of the mutation would account for the absence of TBS features [Kohlhase et al., 1999]. The six novel SALL1 mutations from the present study together with the seven reported by Kohlhase et al. [1998, 1999], make a total of 15 different identified mutations in TBS. All are located in the second exon (see Fig. 5) and predicted to lead to a truncated protein. So far, only one mutation, namely the C to T transition at position 826, has been detected in several unrelated patients (Table 3a, Fig. 5). In the present series, this mutation was detected in three out of four sporadic cases with identified SALL1 mutations. The same mutation has been observed in three out of four sporadic cases with identified mutations in the other series [Kohlhase et al., 1999]. The CG dimer where this transition occurs thus represents a hotspot of mutations that can be attributed to uncorrected spontaneous deamination of a methylcytosine [Duncan and Miller, 1980]. This mechanism has been proposed to represent the most frequent source of mutations in humans [Barker et al., 1984]. It is noteworthy that the 826C>T nonsense mutation, which largely accounts for the observed high proportion of de novo mutations in TBS, has never been found in familial cases. It is therefore tempting to speculate that this particular mutation does not allow fertility. This hypothesis could not be put to the test so far because the three affected females of the present

8 384 MARLIN ET AL. FIGURE 4. Analysis of the breakpoint present in a TBS-affected individual. A: Physical map of the TBS region. BAC 230e15 contains the entire SALL1 coding sequence. The 3 5 orientation of SALL1 with regard to YAC 438H5 (180 kb) was not determined. PAC 4645 encompasses the translocation breakpoint in patient TB12. B: FISH analysis of individual TB12 carrying the t(5;16)(p15.3;q12.1) translocation. Metaphase chromosome spreads were hybridized with a probe derived from the λ 12.6 subclone of PAC 4645 (see A). A signal is detected on the normal chromosome 16 and on both the der5 and der16 translocated chromosomes. study are still too young and the age of the three affected males from the report by Kohlhase et al. [1999] was not mentioned. Among the six sequence polymorphisms identified in the present study, three, namely S159G, S ins, and S164del, deserve further comment. These polymorphisms are located in a particular region of SALL1 (amino acid residues 150 to 166) which is characterized by a stretch of 10 serine residues, encoded by an (AGC)10 repeat, followed by four glycine residues encoded by a (GGC)4 repeat and three serine residues, the first of which (S164) is also encoded by an AGC codon. The S159G mutation is located at the last position of the stretch of 10 serine residues, S ins is located in the same stretch of serine residues, and S164del involves the serine immediately following the glycine repeat. These mutations

9 SALL1 MUTATIONS IN TOWNES-BROCKS SYNDROME 385 FIGURE 5. Schematic representation of the human SALL1 protein and localization of the mutations identified thus far. The protein comprises five zinc finger domains (dotted rectangles), including a vertebrate-specific C 2 HC motif, three double C 2 H 2 motifs, plus an additional one [Kohlhase et al., 1996]. The stretch of serine residues (aa ) is indicated by a stippled rectangle. The two exon intron limits are indicated by gray triangles. The sites of the mutations so far identified in TBS patients are indicated by arrows. The 826C>T transition has been detected in six sporadic cases (three from each series) and therefore represents a mutation hot spot. define a particularly unstable region prone to DNA modifications, most of which are likely to result from DNA polymerase slippage. Such a mechanism would also account for the S150del polymorphism reported by Kohlhase et al. [1999]. All the mutations detected so far [Kohlhase et al., 1998, 1999; this study] indicate that TBS results from SALL1 haploinsufficiency. This syndrome is to be added to the long list of dominant developmental diseases that are caused by haploinsufficiency of a gene encoding a transcription factor, such as aniridia (PAX6 [Fantes et al., 1995]), Waardenburg syndrome types I and II (PAX3 and MITF, respectively [reviewed in Read and Newton, 1997]), Pallister-Hall and Greig syndromes (GLI3 [Kang et al., 1997]), a form of Rieger syndrome (RIEG [Flomen et al., 1998]). In such diseases, different threshold levels of the protein are believed to be critical for each of the associated developmental processes, which likely accounts for the variable phenotypic expressivity [for review, see Fisher and Scambler, 1994]. Accordingly, considerable variability of the clinical features was noted among the TBS-affected patients in our series (see Table 2), even within a given family (see Fig. 1). The molecular diagnosis of TBS by direct sequencing on genomic DNA is simple, as there are only three SALL1 coding exons to be analyzed, and it allows the detection of a high proportion of the mutations (i.e., in 9 out of 11 patients analyzed in the present study). This test should prove potentially helpful in medical practice since the clinical features of TBS are sometimes difficult to distinguish from those of other syndromes [for reviews, see Kotzot et al., 1992; Allanson, 1995] (Marlin, unpublished observations); in particular, the VACTERL association (MIM# ) [Khoury et al., 1983]. In addition, the present characterization of a normal SALL1 coding sequence in a TBS patient carrying a 16q12 chromosomal rearrangement indicates performing a karyotype, in case a typical TBS with no SALL1 mutation is identified. An improvement in genetic counseling for TBS-affected families is expected from these genetic investigations. ACKNOWLEDGMENTS We thank the families for participation in this study. We thank Dominique Weil for helpful advice, Michel Salmon for preliminary physical mapping, Jean-Pierre Hardelin, Viki Kalatzis, and Jacqueline Levilliers for contributions to the writing and for critical reading of the manuscript, and Ana Baroncini (Ferrara) for clinical examination of patient TB7. The technical assistance of Fabienne Levi-Acobas in subcloning and of Stéphane Douglay in sequencing is acknowledged. REFERENCES Allanson J Genetic hearing loss associated with external ear abnormalities. In: Gorlin RJ, Toriello HV, Cohen MM, editors. Hereditary hearing loss and its syndromes, vol. 28. New York, Oxford: Oxford University Press. p Antonarakis SE, Nomenclature Working Group A suggested nomenclature for designating mutations. Hum Mutat 11:1 3. Arroyo Carrera I, Lopez Cuesta MJ, Garcia Garcia MJ, Lozano Rodriguez JA, Carretero Diaz V Sindrome de Townes- Brocks. An Esp Pediatr 44: Baldi F, Baroncini A, Ricci G, Specchia F, Tampieri M, Comellini L, Masi M Sindrome di Townes-Brocks: descrizione di un caso. Riv Ital Pediatr 21: Barakat A, Butler MG, Salter JE, Fogo A Townes-Brocks syndrome: report of three additional patients with previously undescribed renal and cardiac abnormalities. Dysmorphol Clin Genet 2: Barker D, Schafer M, White R Restriction sites containing CpG show a higher frequency of polymorphism in human DNA. Cell 36: Beaudet AL, Tsui L-C A suggested nomenclature for designating mutations. Hum Mutat 2: de Vries-Van der Weerd MA, Willems PJ, Mandema HM, ten Kate LP A new family with the Townes-Brocks syndrome. Clin Genet 34: Duncan BK, Miller JH Mutagenic deamination of cytosine residues in DNA. Nature 287: Fantes J, Redeker B, Breen M, Boyle S, Brown J, Fletcher J, Jones S, Bickmore W, Fukushima Y, Mannens M, Danes S, van Heyningen V, Hanson I Aniridia-associated cytogenetic rearrangements suggest that a position effect may cause the mutant phenotype. Hum Mol Genet 4:

10 386 MARLIN ET AL. Ferraz FG, Nunes L, Ferraz ME, Sousa JP, Santos M, Carvalho C, Maroteaux P Townes-Brocks syndrome. Report of a case and review of the literature. Ann Genet 32: Fisher E, Scambler P Human haploinsufficiency one for sorrow, two for joy. Nat Genet 7:5 7. Flomen RH, Vatcheva R, Gorman PA, Baptista PR, Groet J, Barisic I, Ligutic I, Nizetic D Construction and analysis of a sequence-ready map in 4q25: Rieger syndrome can be caused by haploinsufficiency of RIEG, but also by chromosome breaks approximately 90 kb upstream of this gene. Genomics 47: Green AJ, Sandford RN, Davison BCC An autosomal dominant syndrome of renal and anogenital malformations with syndactyly. J Med Genet 33: Hollemann T, Schuh R, Pieler T, Stick R Xenopus Xsal-1, a vertebrate homolog of the region specific homeotic gene spalt of Drosophila. Mech Dev 55: Jürgens G Head and tail development of the Drosophila embryo involves spalt, a novel homeotic gene. EMBO J 7: Kang S, Graham JMJ, Olney AH, Biesecker LG GLI3 frameshift mutations cause autosomal dominant Pallister-Hall syndrome. Nat Genet 15: Khoury MJ, Cordero JF, Greenberg F, James LM, Erickson JD A population study of the VACTERL association: evidence for its etiologic heterogeneity. Pediatrics 71: Kleinjan D-J, van Heyningen V Position effect in human genetic disease. Hum Mol Genet 7: Kohlhase J, Schuh R, Dowe G, Kühnlein RP, Jäckle H, Schroeder B, Schulz-Schaeffer W, Kretzschmar HA, Köhler A, Müller U, Raab-Vetter M, Burkhardt E, Engel W, Stick R Isolation, characterization, and organ-specific expression of two novel human zinc finger genes related to the Drosophila gene spalt. Genomics 38: Kohlhase J, Wischermann A, Reichenbach H, Froster U, Engel W Mutations in the SALL1 putative transcription factor gene cause Townes-Brocks syndrome. Nat Genet 18: Kohlhase J, Taschner PEM, Burfeind P, Pasche B, Newman B, Blanck C, Breuning MH, ten Kate LP, Maaswinkel-Mooy P, Mitulla B, Seidel J, Kirkpatrick SJ, Pauli RM, Wargowski DS, Devriendt K, Proesmans W, Gabrielli O, Coppa GV, Wesbyvan Swaay E, Trembath RC, Schinzel AA, Reardon W, Seemanova E, Engel W Molecular analysis of SALL1 mutations in Townes-Brocks syndrome. Am J Hum Genet 64: Köster R, Stick R, Loosli F, Wittbrodt J Medaka spalt acts as a target gene of hedgehog signaling. Development 124: Kotzot D, Lorenz P, Bieber A, Grobe H Townes-Brocks syndrome. Case report and review of the literature. Monatsschr Kinderheilkunde 140: Kühnlein RP, Frommer G, Friedrich M, Gonzalez-Gaitan M, Weber A, Wagner-Bernholz JF, Gehring WJ, Jäckle H, Schuh R spalt encodes an evolutionarily conserved zinc finger protein of novel structure which provides homeotic gene function in the head and tail region of the Drosophila embryo. EMBO J 13: Kurnit DM, Steele MW, Pinsky L, Dibbins A Autosomal dominant transmission of a syndrome of anal, ear, renal, and radial congenital malformations. J Pediatr 93: Lévy G, Levi-Acobas F, Blanchard S, Gerber S, Larget-Piet D, Chenal V, Liu X-Z, Newton V, Steel KP, Brown SDM, Munnich A, Kaplan J, Petit C, Weil D Myosin VIIA gene: heterogeneity of the mutations responsible for Usher syndrome type IB. Hum Mol Genet 6: Marlin S, Toublanc JE, Petit C Two cases of Townes-Brocks syndrome with previously undescribed anomalies. Clin Dysmorphol 7: Newman WG, Brunet MD, Donnai D Townes-Brocks syndrome presenting as end stage renal failure. Clin Dysmorphol 6: Ott T, Kaestner KH, Monaghan AP, Schutz G The mouse homolog of the region specific homeotic gene spalt of Drosophila is expressed in the developing nervous system and in mesoderm-derived structures. Mech Dev 56: Powell CM, Michaelis RC Townes-Brocks syndrome. J Med Genet 36: Read AP, Newton VE Waardenburg syndrome. J Med Genet 34: Rossmiller DR, Pasic TR Hearing loss in Townes-Brocks syndrome. Otolaryngol Head Neck Surg 111: Serville F, Lacombe D, Saura R, Billeaud C, Sergent MP Townes-Brocks syndrome in an infant with translocation t (5;16). Genet Couns 4: Townes PL, Brocks ER Hereditary syndrome of imperforate anus with hand, foot and ear anomalies. J Pediatr 81: Verpy E, Biasotto M, Brai M, Misiano G, Meo T, Tosi M Exhaustive mutation scanning by fluorescence-assisted mismatch analysis discloses new genotype-phenotype correlations in angioedema. Am J Hum Genet 59: Vincent C, Kalatzis V, Compain S, Levilliers J, Slim R, Graia F, Pereira MdL, Nivelon A, Croquette MF, Lacombe D, Vigneron J, Helias J, Broyer M, Callen DF, Haan EA, Weissenbach J, Lacroix B, Bellané-Chantelot C, Le Paslier D, Cohen D, Petit C A proposed new contiguous gene syndrome on 8q consists of Branchio-Oto-Renal (BOR) syndrome, Duane syndrome, a dominant form of hydrocephalus and trapeze aplasia; implications for the mapping of the BOR gene. Hum Mol Genet 3:

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA

CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA Cytogenetics is the study of chromosomes and their structure, inheritance, and abnormalities. Chromosome abnormalities occur in approximately:

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

Title: Genetics and Hearing Loss: Clinical and Molecular Characteristics

Title: Genetics and Hearing Loss: Clinical and Molecular Characteristics Session # : 46 Day/Time: Friday, May 1, 2015, 1:00 4:00 pm Title: Genetics and Hearing Loss: Clinical and Molecular Characteristics Presenter: Kathleen S. Arnos, PhD, Gallaudet University This presentation

More information

The following chapter is called "Preimplantation Genetic Diagnosis (PGD)".

The following chapter is called Preimplantation Genetic Diagnosis (PGD). Slide 1 Welcome to chapter 9. The following chapter is called "Preimplantation Genetic Diagnosis (PGD)". The author is Dr. Maria Lalioti. Slide 2 The learning objectives of this chapter are: To learn the

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

Biological Sciences Initiative. Human Genome

Biological Sciences Initiative. Human Genome Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.

More information

MUTATION, DNA REPAIR AND CANCER

MUTATION, DNA REPAIR AND CANCER MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

Overview of Genetic Testing and Screening

Overview of Genetic Testing and Screening Integrating Genetics into Your Practice Webinar Series Overview of Genetic Testing and Screening Genetic testing is an important tool in the screening and diagnosis of many conditions. New technology is

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Arabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham

Arabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham Arabidopsis A Practical Approach Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham OXPORD UNIVERSITY PRESS List of Contributors Abbreviations xv xvu

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

LECTURE 6 Gene Mutation (Chapter 16.1-16.2)

LECTURE 6 Gene Mutation (Chapter 16.1-16.2) LECTURE 6 Gene Mutation (Chapter 16.1-16.2) 1 Mutation: A permanent change in the genetic material that can be passed from parent to offspring. Mutant (genotype): An organism whose DNA differs from the

More information

NOVEL FOXC2 MISSENSE MUTATION IDENTIFIED IN PATIENT WITH LYMPHEDEMA-DISTICHIASIS SYNDROME AND REVIEW

NOVEL FOXC2 MISSENSE MUTATION IDENTIFIED IN PATIENT WITH LYMPHEDEMA-DISTICHIASIS SYNDROME AND REVIEW 98 Lymphology 41 (2008) 98-102 NOVEL FOXC2 MISSENSE MUTATION IDENTIFIED IN PATIENT WITH LYMPHEDEMA-DISTICHIASIS SYNDROME AND REVIEW M.T. Dellinger, K. Thome, M.J. Bernas, R.P. Erickson, M.H. Witte Departments

More information

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur

More information

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR BioTechniques 25:415-419 (September 1998) ABSTRACT The determination of unknown DNA sequences around

More information

Trasposable elements: P elements

Trasposable elements: P elements Trasposable elements: P elements In 1938 Marcus Rhodes provided the first genetic description of an unstable mutation, an allele of a gene required for the production of pigment in maize. This instability

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

Lecture 3: Mutations

Lecture 3: Mutations Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question. Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists

More information

Umm AL Qura University MUTATIONS. Dr Neda M Bogari

Umm AL Qura University MUTATIONS. Dr Neda M Bogari Umm AL Qura University MUTATIONS Dr Neda M Bogari CONTACTS www.bogari.net http://web.me.com/bogari/bogari.net/ From DNA to Mutations MUTATION Definition: Permanent change in nucleotide sequence. It can

More information

Objectives Role of Medical Genetics in Hearing Loss Evaluation. 5 y.o. boy with severe SNHL

Objectives Role of Medical Genetics in Hearing Loss Evaluation. 5 y.o. boy with severe SNHL Objectives Role of Medical Genetics in Hearing Loss Evaluation Millan Patel, MD UBC Dept. of Medical Genetics October 22, 2010 Case presentation to illustrate importance of defining syndromic hearing loss

More information

Design of conditional gene targeting vectors - a recombineering approach

Design of conditional gene targeting vectors - a recombineering approach Recombineering protocol #4 Design of conditional gene targeting vectors - a recombineering approach Søren Warming, Ph.D. The purpose of this protocol is to help you in the gene targeting vector design

More information

BioBoot Camp Genetics

BioBoot Camp Genetics BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before

More information

Jennifer A. Defant, M.S., C.G.C. Certified Genetic Counselor Division of Genetics and Metabolism University of Florida

Jennifer A. Defant, M.S., C.G.C. Certified Genetic Counselor Division of Genetics and Metabolism University of Florida Jennifer A. Defant, M.S., C.G.C. Certified Genetic Counselor Division of Genetics and Metabolism University of Florida 60% of childhood hearing loss is genetic Syndromic Nonsyndromic 40% of childhood hearing

More information

G. Shashidhar Pai, MD MUSC Children s Hospital Department of Pediatrics Division of Genetics

G. Shashidhar Pai, MD MUSC Children s Hospital Department of Pediatrics Division of Genetics G. Shashidhar Pai, MD MUSC Children s Hospital Department of Pediatrics Division of Genetics One of every 500 newborns has bilateral permanent sensorineural hearing loss 40 db which makes it the most common

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Stephen B. Gruber, MD, PhD Division of Molecular Medicine and Genetics November 4, 2002 Learning Objectives Know the basics of gene structure, function and regulation. Be familiar

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

MRC-Holland MLPA. Description version 12; 02-12-2012

MRC-Holland MLPA. Description version 12; 02-12-2012 SALSA MLPA probemix P083-C1 CDH1 Lot C1-0211. As compared to previous B1 version, new in version C1: two CDH1 probes and several reference probes have been replaced/added. In addition, the 88 and 96nt

More information

MRC-Holland MLPA. Related SALSA MLPA probemix P091 CFTR: contains probes for the CFTR gene, related to chronic pancreatitis.

MRC-Holland MLPA. Related SALSA MLPA probemix P091 CFTR: contains probes for the CFTR gene, related to chronic pancreatitis. SALSA MLPA probemix P242-B3 Pancreatitis Lot B3-0215. As compared to version B2 (lot B2-1212), one flanking probe has been removed and four reference probes have been replaced. Hereditary Pancreatitis

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine

More information

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh

More information

The Human Genome Project

The Human Genome Project The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

About The Causes of Hearing Loss

About The Causes of Hearing Loss About 1 in 500 infants is born with or develops hearing loss during early childhood. Hearing loss has many causes: some are genetic (that is, caused by a baby s genes) or non-genetic (such as certain infections

More information

Genetics 301 Sample Final Examination Spring 2003

Genetics 301 Sample Final Examination Spring 2003 Genetics 301 Sample Final Examination Spring 2003 50 Multiple Choice Questions-(Choose the best answer) 1. A cross between two true breeding lines one with dark blue flowers and one with bright white flowers

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

Recombinant DNA Unit Exam

Recombinant DNA Unit Exam Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

2006 7.012 Problem Set 3 KEY

2006 7.012 Problem Set 3 KEY 2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each

More information

Genetics Lecture Notes 7.03 2005. Lectures 1 2

Genetics Lecture Notes 7.03 2005. Lectures 1 2 Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several

More information

Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu

Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

Basic Concepts Recombinant DNA Use with Chapter 13, Section 13.2

Basic Concepts Recombinant DNA Use with Chapter 13, Section 13.2 Name Date lass Master 19 Basic oncepts Recombinant DN Use with hapter, Section.2 Formation of Recombinant DN ut leavage Splicing opyright lencoe/mcraw-hill, a division of he Mcraw-Hill ompanies, Inc. Bacterial

More information

The NF1-gene a hotspot for de novo Alu- and L1-insertion?

The NF1-gene a hotspot for de novo Alu- and L1-insertion? The NF1-gene a hotspot for de novo Alu- and L1-insertion? Katharina Wimmer Division Humangenetik, Medizinische Universität Innsbruck Molekulare Diagnostik 2013 Zürich, 1. März, 2013 2 Die im Vortrag vorgestellten

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Tools for human molecular diagnosis. Joris Vermeesch

Tools for human molecular diagnosis. Joris Vermeesch Tools for human molecular diagnosis Joris Vermeesch Chromosome > DNA Genetic Code Effect of point mutations/polymorphisms Effect of deletions/insertions Effect of splicing mutations IVS2-2A>G Normal splice

More information

Genetics Test Biology I

Genetics Test Biology I Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.

More information

Gene Expression Assays

Gene Expression Assays APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

GENOTYPING ASSAYS AT ZIRC

GENOTYPING ASSAYS AT ZIRC GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise: HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone

More information

Overview of Eukaryotic Gene Prediction

Overview of Eukaryotic Gene Prediction Overview of Eukaryotic Gene Prediction CBB 231 / COMPSCI 261 W.H. Majoros What is DNA? Nucleus Chromosome Telomere Centromere Cell Telomere base pairs histones DNA (double helix) DNA is a Double Helix

More information

RNA and Protein Synthesis

RNA and Protein Synthesis Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic

More information

Commonly Used STR Markers

Commonly Used STR Markers Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated

More information

MCB41: Second Midterm Spring 2009

MCB41: Second Midterm Spring 2009 MCB41: Second Midterm Spring 2009 Before you start, print your name and student identification number (S.I.D) at the top of each page. There are 7 pages including this page. You will have 50 minutes for

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Causes of Birth Defects

Causes of Birth Defects Causes of Birth Defects Some medical / genetic terms: congenital defects: visible defects present at birth (due to any cause (genetic, developmental error ). syndrome: the symptoms that characterize any

More information

Chromosomes, Mapping, and the Meiosis Inheritance Connection

Chromosomes, Mapping, and the Meiosis Inheritance Connection Chromosomes, Mapping, and the Meiosis Inheritance Connection Carl Correns 1900 Chapter 13 First suggests central role for chromosomes Rediscovery of Mendel s work Walter Sutton 1902 Chromosomal theory

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns

More information

Innovations in Molecular Epidemiology

Innovations in Molecular Epidemiology Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether

More information

Biology Final Exam Study Guide: Semester 2

Biology Final Exam Study Guide: Semester 2 Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Information leaflet. Centrum voor Medische Genetica. Version 1/20150504 Design by Ben Caljon, UZ Brussel. Universitair Ziekenhuis Brussel

Information leaflet. Centrum voor Medische Genetica. Version 1/20150504 Design by Ben Caljon, UZ Brussel. Universitair Ziekenhuis Brussel Information on genome-wide genetic testing Array Comparative Genomic Hybridization (array CGH) Single Nucleotide Polymorphism array (SNP array) Massive Parallel Sequencing (MPS) Version 120150504 Design

More information

Sequencing and microarrays for genome analysis: complementary rather than competing?

Sequencing and microarrays for genome analysis: complementary rather than competing? Sequencing and microarrays for genome analysis: complementary rather than competing? Simon Hughes, Richard Capper, Sandra Lam and Nicole Sparkes Introduction The human genome is comprised of more than

More information

Bio 102 Practice Problems Recombinant DNA and Biotechnology

Bio 102 Practice Problems Recombinant DNA and Biotechnology Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site

More information

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application

More information

Roberto Ciccone, Orsetta Zuffardi Università di Pavia

Roberto Ciccone, Orsetta Zuffardi Università di Pavia Roberto Ciccone, Orsetta Zuffardi Università di Pavia XIII Corso di Formazione Malformazioni Congenite dalla Diagnosi Prenatale alla Terapia Postnatale unipv.eu Carrara, 24 ottobre 2014 Legend:Bluebars

More information

Fluorescence in situ hybridisation (FISH)

Fluorescence in situ hybridisation (FISH) Fluorescence in situ hybridisation (FISH) rarechromo.org Fluorescence in situ hybridization (FISH) Chromosomes Chromosomes are structures that contain the genetic information (DNA) that tells the body

More information

somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive

somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive CHAPTER 6 MEIOSIS AND MENDEL Vocabulary Practice somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive CHAPTER 6 Meiosis and Mendel sex

More information

REI Pearls: Pitfalls of Genetic Testing in Miscarriage

REI Pearls: Pitfalls of Genetic Testing in Miscarriage The Skinny: Genetic testing of miscarriage tissue is controversial and some people question if testing is helpful or not. This summary will: 1) outline the arguments for and against genetic testing; 2)

More information

Chapter 5: Organization and Expression of Immunoglobulin Genes

Chapter 5: Organization and Expression of Immunoglobulin Genes Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed

More information

Breast cancer and the role of low penetrance alleles: a focus on ATM gene

Breast cancer and the role of low penetrance alleles: a focus on ATM gene Modena 18-19 novembre 2010 Breast cancer and the role of low penetrance alleles: a focus on ATM gene Dr. Laura La Paglia Breast Cancer genetic Other BC susceptibility genes TP53 PTEN STK11 CHEK2 BRCA1

More information

Genetics Review for USMLE (Part 2)

Genetics Review for USMLE (Part 2) Single Gene Disorders Genetics Review for USMLE (Part 2) Some Definitions Alleles variants of a given DNA sequence at a particular location (locus) in the genome. Often used more narrowly to describe alternative

More information

Chromosomes, Karyotyping, and Abnormalities (Learning Objectives) Learn the components and parts of a metaphase chromosome.

Chromosomes, Karyotyping, and Abnormalities (Learning Objectives) Learn the components and parts of a metaphase chromosome. Chromosomes, Karyotyping, and Abnormalities (Learning Objectives) Learn the components and parts of a metaphase chromosome. Define the terms karyotype, autosomal and sex chromosomes. Explain how many of

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing. Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,

More information

How to construct transgenic mice

How to construct transgenic mice How to construct transgenic mice Sandra Beer-Hammer Autumn School 2012 Bad Schandau Pharmakologie und Experimentelle Therapie (APET) Overview History Generation of embryonic stem (ES) cell lines Generation

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

Human Genome Organization: An Update. Genome Organization: An Update

Human Genome Organization: An Update. Genome Organization: An Update Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

Next Generation Sequencing. mapping mutations in congenital heart disease

Next Generation Sequencing. mapping mutations in congenital heart disease Next Generation Sequencing mapping mutations in congenital heart disease AV Postma PhD Academic Medical Center Amsterdam, the Netherlands Overview talk Congenital heart disease and genetics Next generation

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

The world of non-coding RNA. Espen Enerly

The world of non-coding RNA. Espen Enerly The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often

More information

STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS

STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS THESIS SUBMITTED FOR THE DEGREB OF DOCTOR OF PHILOSOPHY (SCIENCE) OF THE UNIVERSITY OF CALCUTTA 1996 NRISINHA DE, M.Sc DEPARTMENT OF BIOCHEMISTRY

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium

More information

Answer Key Problem Set 5

Answer Key Problem Set 5 7.03 Fall 2003 1 of 6 1. a) Genetic properties of gln2- and gln 3-: Answer Key Problem Set 5 Both are uninducible, as they give decreased glutamine synthetase (GS) activity. Both are recessive, as mating

More information

Human Genome and Human Genome Project. Louxin Zhang

Human Genome and Human Genome Project. Louxin Zhang Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular

More information