Alternative Start Codons & Novel ORFs
|
|
|
- Doreen Miles
- 7 years ago
- Views:
Transcription
1 Alternative Start Codons & Novel ORFs
2 You vs. The Brilliant Student Glimmer The Automated Gene Caller
3 The Automated Gene Caller (i.e., Glimmer) What does an Automated Gene Caller do? Scans all nucleotides in a genome. Looks for punctuation marks that determine where genes start and stop (i.e., regulatory sequences that define where genes begin and end).
4 The Brilliant Student (You) What will you do? Double check the work of the Gene Caller. Is there evidence supporting proposed start codon? Is there an alternative position possible for the start codon? Examine all six reading frames. Is there a novel open reading frame (ORF) missed by Gene Caller?
5 Let s get started with the first task: Verify the position for the Start codon
6 In the imgact Lab Notebook 1- Return to Gene Detail page Recall: You previously entered the DNA coordinates set by the automatic Gene Caller. This information was found on the Gene Detail page.
7 Gene Detail Page in img/edu Keep the Gene Detail page open in separate tab while working Scroll down
8 Click here
9 Select the region of interest: 100 bp upstream and downstream of the original ORF coordinates. +100bp ORF -100bp Let s look at the nucleotides that are around our gene of interest Use 80 amino acids as standard ORF size. Remember 3 nucleotides code for 1 amino acid! Click! The Graphics option will allow us to look at the actual sequence. This helps us complete the first task.
10 After you click submit, you will see something like this:
11 HOW AM I SUPPOSED TO READ THIS?? Deciphering Sequence Viewer in Graphics Mode This tells us about GC content in this part of the genome. The nucleotide sequence is highlighted in gray DNA coordinates forward strand reverse strand Orientation depends upon whether your gene is on the + or - strand
12 WHICH STRAND IS MY GENE ON? Example of plus strand gene orientation: Example of minus strand gene orientation:
13 HOW AM I SUPPOSED TO READ THIS?? Deciphering Sequence Viewer in Graphics Mode Review single letter codes for amino acids! Each row above (or below) designated DNA strand represents a different translational reading frame amino acids corresponding to codons in nucleotide sequence shifted by one base AA results from forward DNA strand (F1, F2, & F3) AA results from reverse DNA strand (F4, F5, & F6)
14 Helpful tools to keep handy while deciphering! Insert table of genetic code and table of single letter abbreviations for amino acids Initiation frequency in E. coli: AUG > GUG > UUG > CUG Stop codons: UAG, UAA, UGA
15 More on Deciphering Sequence Viewer in Graphics Mode Gene expression pathway: DNA RNA protein. We are interpreting the protein sequence directly from the DNA, rather than RNA. START CODON When you scroll over each nucleotide, the DNA coordinates for that position appear above or below the strand. * = STOP CODON On forward DNA strand: GREEN is flanking DNA (100 bp). BLACK is DNA sequence of original ORF. START and STOP CODONS determined by Gene Caller for the your gene are in red font (or located at green/black color font transition in DNA strand). Note they are both on the same DNA strand & polypeptide sequence.
16 More on Deciphering Sequence Viewer in Graphics Mode Yellow denotes possible alternative start codons. Cyan denotes candidate RBS (Shine-Dalgarno Sequences). Recall: Each row corresponds to the amino acid sequence derived from possible reading frames. RBS = Ribosome Binding Site = Shine-Dalgarno Sequence Always on SAME DNA STRAND AS THE START CODON
17 Remember: To initiate protein synthesis (translation), the ribosome interacts with the Shine-Dalgarno sequence in the mrna immediately upstream of the proper start codon Insert WebLogo of E. coli ribosome binding sites and start codons from Reference: Figure 1 in Schneider and Stephens (1990) Sequence logos: a new way to display consensus sequences. Nucleic Acids. Research 18:
18 Decision Tree The following slides contain a Decision Tree to aid in decision making as you proceed through the first task of this module. All of the steps provided in the tree will be elaborated upon throughout the presentation. The tree should act as an outline to help you map out your plan of attack!
19 Cyan denotes candidate RBS (Shine-Dalgarno Sequences). 10 bases apart Recall: Start codons should occur about 5-15 bases downstream of the Shine-Dalgarno sequence (RBS) OID
20 The DNA coordinates should have been recorded in your lab notebook as part of first module. Provide a comment in current module indicating the original coordinates are likely correct. In the same reading frame as the original start codon, is there an alternative start codon upstream of the original proposed start codon? Task #2 Continue to the next slide
21 Recording results in your Lab Notebook Scroll down
22 Recording results in your Lab Notebook 1- Enter original DNA coordinates with an explanatory comment OID
23 The DNA coordinates should have been recorded in your lab notebook as part of first module. Provide a comment in current module indicating the original coordinates are likely correct. In the same reading frame as the original start codon, is there an alternative start codon upstream of the original proposed start codon? Task #2 **Only inspect up to 100 bases upstream of the original start codon Continue to the next slide
24 Note there are NO stop codons between the original & proposed alternative start codon in F2 Possible alternative start codon in F2 with Shine-Dalgarno sequence 14 bases upstream Note Met is in same frame as original start codon Note Leu is in reading frame 2 OID Original start codon with NO Shine-Dalgarno sequence upstream Not highlighted red; Must examine green/black transition in DNA sequence
25 Is there an alternative start codon downstream of the original proposed start codon in the same reading frame? **Only inspect up to 100 bases downstream of the original start codon Continue with next slide.
26 Original start codon with NO Shine-Dalgarno sequence upstream Note Met is in reading frame 2 Note Leu is in same frame as original start codon OID Possible alternative start codon in F2 with Shine-Dalgarno sequence 10 bases upstream Note there are NO stop codons between the original & proposed alternative start codon in F2
27
28 For genes with possible alternative start codon It s time to BLAST! BLAST your results: Construct a revised protein sequence in FASTA format (add or subtract amino acid residues in proper reading frame to reflect new start codon position then copy/paste into lab notebook). Submit as query for a BLAST search of NCBI database (Genbank, SwisProt). Your results from BLAST: Compare results from original blast search with those from new blast search. Determine if statistics have improved. REMEMBER: higher bit score, lower e-value, higher % identity and/or longer alignment length are all good arguments that the alternative start codon is a better choice
29 Create new headings & boxes for entering amino acid sequence in FASTA format for ORF with alternate start codon 1- Add headings and box in lab notebook 2- Copy/paste modified protein sequence into box **NOTE highlighted portion was added to the original amino acid sequence since the alternative start codon (AUG) is located 26 residues upstream of the original start codon (UUG, which encodes Leucine) OID
30 NCBI BLAST can be accessed from lab notebook link
31 BLAST Results for ORF with original start codon (Gene Caller) Compare hits from same organism Are statistics improved for proposed ORF? If yes, enter data into notebook BLAST Results for ORF with alternative start codon proposed by student! OID
32 Recording results in your Lab Notebook Adjust DNA coordinates & base pairs Change section heading as shown 2- Copy/paste subheadings & field boxes from Sequence-based Similarity Data module. 3- Fill in with your results from BLAST search using ORF with alternate start codon for gene. OID
33 Are the BLAST results always better? NO! For example... **Recall that this gene had residues deleted from the original amino acid sequence since the alternative start codon (CUG, which encodes Leucine) is located 12 residues downstream of the original start codon (AUG) OID
34 BLAST Results for ORF with original start codon (Gene Caller) Compare hits from same organism Are statistics improved for proposed ORF? If no or not really, enter data into notebook anyway with a comment BLAST Results for ORF with alternative start codon proposed by student! OID
35 Recording results in your Lab Notebook Adjust DNA coordinates & base pairs Change section heading as shown 2- Copy/paste subheadings & field boxes from Sequence-based Similarity Data module. 3- Fill in with your results from BLAST search using ORF with alternate start codon for gene. OID
36 Why might an ORF lack a Shine- Dalgarno sequence?
37 WHY? WHY? WHY NOT?! Interpreting Your Negative Results (i.e., no Shine-Dalgarno, no alternative start codon, etc.) Maybe there is flexibility in the amount of sequence conservation needed in the Shine-Dalgarno (S-D) that allows ribosome binding Insert Figure 33.9 from Garret & Grisham Biochemistry (2 nd Ed.) Alignment of various Shine-Dalgarno sequences recognized by E. coli ribosomes.
38 WHY? WHY? WHY NOT?! Interpreting Your Negative Results (i.e., no Shine-Dalgarno, no alternative start codon, etc.) Consider possible mutations in DNA sequence Remember draft genome problems? Consider a ribosome skid if your gene is part of an operon Maybe your gene is in the middle or at the end of an operon. And perhaps only the first gene in the operon has a S-D upstream of the start codon and has a stop codon within 5-15 nt of the start codon for the next gene in the operon. In this case, the genes may be close enough that the ribosome does not need to completely dissociate from the RNA transcript, instead it skids along and begins translation of the next gene in the operon without needing to bind a second S-D. Look at the ortholog neighborhood map! (Review Gene Context in HGT module)
39 Recording results in your Lab Notebook 1- Change the heading No change from original DNA coordinates recorded for first module: 2- Enter original DNA coordinates with an explanation
40 NOW for the second task: Hunting for Potential Novel Open Reading Frames (ORFs)
41 Return to the Gene Detail Page Scroll down
42 Click here again
43 Change output from Graphic to Text Keep parameters the same as first task. USE TEXT option to look for NOVEL open reading frames Click submit!
44 NOTE: Usually the result with the longest amino acid sequence length is your original ORF. HINT: A NOVEL ORF could be in a different reading frame from the original ORF We are interested in all ORFs with sequence length of at least 80 aa
45 Copy/paste the complete FASTA sequence into a BLAST query box
46 Most translations will not produce significant hits E-value too high!... Or will give no hits at all
47 What do I enter in my lab notebook? Create headings and boxes as indicated Enter No significant hits
48 If your BLAST search does produce a significant hit A potentially valid NOVEL ORF will give you a high % identity, low e-value, & high bit score. Create headings and boxes as indicated in your notebook Fill in boxes with result from BLAST search using sequence for NOVEL ORF
49 Module tasks complete Are you keeping up with your annotations? The 1 st of 3 imgact notebook checks will occur at the end of this week.
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown
1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Transcription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
Molecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets
http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct
Guide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
Protein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
RNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons
Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA
Gene Finding CMSC 423
Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher
The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
Analyzing A DNA Sequence Chromatogram
LESSON 9 HANDOUT Analyzing A DNA Sequence Chromatogram Student Researcher Background: DNA Analysis and FinchTV DNA sequence data can be used to answer many types of questions. Because DNA sequences differ
Searching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
The Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
13.2 Ribosomes & Protein Synthesis
13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).
ID of alternative translational initiation events. Description of gene function Reference of NCBI database access and relative literatures
Data resource: In this database, 650 alternatively translated variants assigned to a total of 300 genes are contained. These database records of alternative translational initiation have been collected
Vector NTI Advance 11 Quick Start Guide
Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.
Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled
Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino
Gene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
PRACTICE TEST QUESTIONS
PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.
LESSON 4. Using Bioinformatics to Analyze Protein Sequences. Introduction. Learning Objectives. Key Concepts
4 Using Bioinformatics to Analyze Protein Sequences Introduction In this lesson, students perform a paper exercise designed to reinforce the student understanding of the complementary nature of DNA and
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques
Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web
Module 10: Bioinformatics
Module 10: Bioinformatics 1.) Goal: To understand the general approaches for basic in silico (computer) analysis of DNA- and protein sequences. We are going to discuss sequence formatting required prior
(http://genomes.urv.es/caical) TUTORIAL. (July 2006)
(http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA
BCH401G Lecture 39 Andres
BCH401G Lecture 39 Andres Lecture Summary: Ribosome: Understand its role in translation and differences between translation in prokaryotes and eukaryotes. Translation: Understand the chemistry of this
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
Transcription in prokaryotes. Elongation and termination
Transcription in prokaryotes Elongation and termination After initiation the σ factor leaves the scene. Core polymerase is conducting the elongation of the chain. The core polymerase contains main nucleotide
DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Ms. Campbell Protein Synthesis Practice Questions Regents L.E.
Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide
Transcription: RNA Synthesis, Processing & Modification
Transcription: RNA Synthesis, Processing & Modification 1 Central dogma DNA RNA Protein Reverse transcription 2 Transcription The process of making RNA from DNA Produces all type of RNA mrna, trna, rrna,
Lab # 12: DNA and RNA
115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long
SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
AP BIOLOGY 2010 SCORING GUIDELINES (Form B)
AP BIOLOGY 2010 SCORING GUIDELINES (Form B) Question 2 Certain human genetic conditions, such as sickle cell anemia, result from single base-pair mutations in DNA. (a) Explain how a single base-pair mutation
LESSON 9. Analyzing DNA Sequences and DNA Barcoding. Introduction. Learning Objectives
9 Analyzing DNA Sequences and DNA Barcoding Introduction DNA sequencing is performed by scientists in many different fields of biology. Many bioinformatics programs are used during the process of analyzing
Activity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
From DNA to Protein
Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins
Pairwise Sequence Alignment
Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
Bioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
2006 7.012 Problem Set 3 KEY
2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each
Lecture 4. Polypeptide Synthesis Overview
Initiation of Protein Synthesis (4.1) Lecture 4 Polypeptide Synthesis Overview Polypeptide synthesis proceeds sequentially from N Terminus to C terminus. Amino acids are not pre-positioned on a template.
Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription
Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional
Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
Gene Switches Teacher Information
STO-143 Gene Switches Teacher Information Summary Kit contains How do bacteria turn on and turn off genes? Students model the action of the lac operon that regulates the expression of genes essential for
Exercises for the UCSC Genome Browser Introduction
Exercises for the UCSC Genome Browser Introduction 1) Find out if the mouse Brca1 gene has non-synonymous SNPs, color them blue, and get external data about a codon-changing SNP. Skills: basic text search;
Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011
Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear
When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
Basic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
Translation. Translation: Assembly of polypeptides on a ribosome
Translation Translation: Assembly of polypeptides on a ribosome Living cells devote more energy to the synthesis of proteins than to any other aspect of metabolism. About a third of the dry mass of a cell
Bob Jesberg. Boston, MA April 3, 2014
DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
GenBank: A Database of Genetic Sequence Data
GenBank: A Database of Genetic Sequence Data Computer Science 105 Boston University David G. Sullivan, Ph.D. An Explosion of Scientific Data Scientists are generating ever increasing amounts of data. Relevant
Concluding lesson. Student manual. What kind of protein are you? (Basic)
Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:
Name: Date: Period: DNA Unit: DNA Webquest
Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.
Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein
Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of
Biological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
DNA Sequencing Overview
DNA Sequencing Overview DNA sequencing involves the determination of the sequence of nucleotides in a sample of DNA. It is presently conducted using a modified PCR reaction where both normal and labeled
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
AP BIOLOGY 2009 SCORING GUIDELINES
AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following
Academic Nucleic Acids and Protein Synthesis Test
Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination
Chem 465 Biochemistry II
Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Formation of the ribosomal initiation complex for bacterial protein synthesis does not require: A) EF-Tu. B) formylmethionyl
Frequently Asked Questions Next Generation Sequencing
Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided
Multiple Sequence Alignment. Hot Topic 5/24/06 Kim Walker
Multiple Sequence Alignment Hot Topic 5/24/06 Kim Walker Outline Why are Multiple Sequence Alignments useful? What Tools are Available? Brief Introduction to ClustalX Tools to Edit and Add Features to
Sequencing the Human Genome
Revised and Updated Edvo-Kit #339 Sequencing the Human Genome 339 Experiment Objective: In this experiment, students will read DNA sequences obtained from automated DNA sequencing techniques. The data
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.
Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.
13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination
Overview of Eukaryotic Gene Prediction
Overview of Eukaryotic Gene Prediction CBB 231 / COMPSCI 261 W.H. Majoros What is DNA? Nucleus Chromosome Telomere Centromere Cell Telomere base pairs histones DNA (double helix) DNA is a Double Helix
MUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
BioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression
Clone Manager. Getting Started
Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software
Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes
Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding
Modeling DNA Replication and Protein Synthesis
Skills Practice Lab Modeling DNA Replication and Protein Synthesis OBJECTIVES Construct and analyze a model of DNA. Use a model to simulate the process of replication. Use a model to simulate the process
Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary
Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page
Multiple Choice Write the letter that best answers the question or completes the statement on the line provided.
Name lass Date hapter 12 DN and RN hapter Test Multiple hoice Write the letter that best answers the question or completes the statement on the line provided. Pearson Education, Inc. ll rights reserved.
Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects
Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
GENE REGULATION. Teacher Packet
AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures
Mitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
Lecture 3: Mutations
Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between
Lecture 5. 1. Transfer of proper aminoacyl-trna from cytoplasm to A-site of ribosome.
Elongation & Termination of Protein Synthesis (5.1) Lecture 5 1. INITIATION Assembly of active ribosome by placing the first mrna codon (AUG or START codon) near the P site and pairing it with initiation
Version 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com