Splinkerette Ligation Digest 1-3ug genomic DNA at 100ng/ul with enzyme of choice and heat inactivate.
|
|
- Terence Cooper
- 7 years ago
- Views:
Transcription
1 Cloning Insertion Sites by Splinkerette PCR - Updated June 2005 protocol based on Devon et al. (1995) Nucleic Acids Research 23: and Mikkers et al. (2002) Nature Genetics 32: for questions/suggestions Anthony Uren a.uren@nki.nl Splinkerette Ligation Digest 1-3ug genomic DNA at 100ng/ul with enzyme of choice and heat inactivate. 6 base cutter average length = 4096bp, 1ug DNA = 0.4 pmole 5 base cutter average length = 1024bp, 1ug DNA = 1.6 pmole 4 base cutter average length = 256bp, 1ug DNA = 6.4 pmole We cut for 12+ hours with more than the recommended number of units to ensure complete digestion. We normally use SauIIIA and Tsp509I, giving GATC or AATT lower strand 5 overhangs (SauIIIA we inactivate for 20minutes at 65, Tsp509I for 20 minutes at 85). Doing two ligations/pcrs using two different enzymes (eg. SauIIIA and Tsp509I) yields more insertions from each tumour than using just one enzyme. The amount of redundancy seen between two enzymes varies from tumour to tumour. Tsp509I seems to give us better results than SauIIA. Have not tested other 4 base cutters. 6 or 5 base cutters usually give a better distribution of fragment sizes over a gel but a 4 base cutter but will usually give more insertion sites overall. Splinkerette adaptor Top strand primer Splinklong 5 cga aga gta acc gtt gct agg aga gac cgt ggc tga atg aga ctg gtg tcg aca cta gtg g Lower strand primer/hairpin Splinkshort-GATC (has GATC overhang in this case) 5 gatccc act agt gtc gac acc agt ctc taa ttt ttt ttt tca aaa aaa Dilute and mix splinkerette adaptor oligos at highest concentration possible in 1x Boehringer RE buffer M (10mM TrisHCl, 10mM MgCl2 50mM NaCl ph7.5) Use thermal cycler to denature at 95 o C for 3 min followed by cooling to room temp at 1 o C per 15 sec (4 o C per min). Dilute annealed splinkerette to 4pmol/ul.
2 Ligation Immediately before setting up ligation, heat DNA to 60 o C and put on ice. This is supposed to melt annealed sticky so they are free for ligation. I haven t checked whether it really helps. Use 300ng cut DNA 6bp cutter = 0.12 pmole 5bp cutter = 0.48 pmole 4bp cutter = 1.92 pmole Mix ng cut DNA - 10x molar excess of splinkerette - 4U T4 ligase (Roche) - 4ul 10x buffer - H 2 O to 40ul Incubate overnight at 16 degrees. EcoRV Digestion Inactivate ligase at 65 degrees C for 20 minutes. Cut 40ul ligation with 10U EcoRV in 100ul for 3+ hours. Inactivate 20 mins at 65 degrees. This step prevents amplification of internal Moloney MuLV fragments from the internal U3 LTR sequence by cutting an EcoRV site 100 bases in from the internal U3 LTR. If your primers are in a sequence that is repeated internally (in this case the U3LTR) you will need to find an appropriate enzyme to prevent amplification of internal fragments i.e. any enzyme that is closer to your internal primer than the enzyme you are using for the splinkerette, in this case EcoRV is closer to the internal LTR than SauIIIA or Tsp509I.
3 Ligation cleanup Desalt/concentrate in Microcon YM-30 Some samples spin down much slower than others. Usually to keep volumes similar between samples we spin everything dry and add 50ul water, wait 10mins and then collect sample. For individual columns add 400ul H2O, microfuge ~ 10min at 14000RPM/20,000g. For 96 column retentate assembly add 150ul H2O, centrifuge ~ 20min at 4000RPM/3000g You can quantiate the DNA in the ligation or you can just proceed assuming 100% recovery of DNA from column. PCRs usually work OK when you assume 100% recovery. If quantitating, Microcon columns leave you with a high 260/280 ratio. Hoechst or Pico green quantitation is probably better than A260/A280. Residual linker may also affect quantiation but doesn t seem to influence PCR.
4 Amplification 1 o PCR - 100ng ligated DNA (about 1/3 of total ligation) - 200nM each primer (Splink1 and LTR#5) - 200uM dntps - 1-4U Pfu Turbo hotstart (Stratagene) - 1x Pfu Turbo buffer (with 2.0mM MgCl2 included) - H2O to 50 ul 4U Pfu Turbo seems best but this is expensive. Can also use - 1U Pfu Turbo in 2mM MgCl2-1U Expand High Fidelity Plus (Roche) in 1.75mM MgCl2-1U of Finnzymes Phu Phusion with 1.5mM MgCl2. Volume of reaction can also be reduced to cut enzyme costs. Using PTC 100 Perkin Elmer 3min 94 o x 1 15sec 94 o, 30sec 68 o, 5min 72 o x 2 15sec 94 o, 30sec 66 o, 5min 72 o x 27 5min 72 o x 1 Can shorten extension time to 3min 30sec but 5 min is slightly better (at least for Pfu). Other higher processivity or less thermo stable enzymes might require shorter extensions times. 2o PCR - 2ul of 1 o PCR as template (0.5-2ul works just as well) - 200nM each primer (Splink2 and LTR#3 or LTR#1) - 25ul Qiagen Multiplex PCR kit mix - H2O to 50ul Qiagen Multiplex gives slightly better signal for larger fragments and for fainter bands but is more expensive. Can also lower the volume to 25ul or use 1U Taq (Invitrogen) with 1.75mM MgCl2, 200nM dntps. Using PTC 100 Perkin Elmer 15min* 94 o x 1 15sec 94 o, 30sec 60 o, 3min 72 o x 25 5min 72 o x 1 *15min start step is only required for Qiagen enzyme. For Taq use 3min.
5 To look at PCRs Running PCR on 3-4% agarose gel should (depending on the DNA) give you a ladder of fragments ranging from 50bp to 1500bp. Can use FAM labeled 2 o PCR primers and run 2ul on capillary sequencer along with size marker to give a better estimate of fragment sizes. Bands can be cut from a 4% agarose gel and in some cases sequenced directly or in other cases reamplified/subcloned and then sequenced. For better separation of bands use radiolabelled PCRs run on a polyacrylamide gel. Radioactive amplification (taken from Harald Mikkers protocol) 1 o PCR - Label primer with 32P-gamma using PNK. Use 10pmol of radioactively labeled primer. Fragments are separated on a 3.5% denaturing acrylamide gel (separation of 100bps-1000 bps). Dry gel, expose to a film and excise radioactive fragments. Put the samples into 100 ul TE and heat the excised fragments for 15 at 94 o C. Use 1:100 of this mixture for a nested cold reaction or if a tumor contains a lot of integrations a second radioactive PCR might be required. 2 o PCR - Similar as previously described except for the number of cycles. Use 1 pmol of radioactively labeled primer. Fragments are separated on a 3.5% denaturing acrylamide gel (separation of 100bps bps). Dry gel, expose to a film and excise radioactive fragments. Put the excised fragments into 100 ul TE and heat for 15 at 94 o C. Use 1:100 of this mixture for a cold reaction.
6 Shotgun subcloning (less effort but more expensive) Prior to TA cloning PCR products can be cleaned up using Microspin S-300 HR columns (Amersham) for individual samples or GFX-96 PCR Purification columns (Amersham) for a 96 well plate full of samples. Freeze until ready to ligate Topo TA vector shotgun subcloning (Invitrogen) (Method from Invitrogen/Sanger) Put 1ul of PCR product in each tube. Dilute the salt solution provided with topo kit 1 in 4. Note: The use of ¼ strength salt solution allows the ligation to be incubated longer than without salt, but is dilute enough for electroporation of 1ul of ligation without arcing. Mix up the following: Per reaction: 1ul of dilute salt solution 3.9ul of H2O (from kit) 0.14ul Topo TA vector (i.e. 1/7 of recommended amount) Per 48 reactions: 50ul of dilute salt solution 195ul of H2O (from kit) 7ul of Topo TA vector (i.e. 1/7 of recommended amount) Add 5ul of master mix to each tube containing 1ul PCR product. Incubate 20 min at room temperature and stop reaction by freezing at -80 degrees. Note: Using only 1/10-1/7 of the recommended amount of vector means that the vector is limiting in the ligation and the PCR product is in excess. This means most ligations will yield similar numbers of transformants regardless of variability in the amount of DNA in the PCR product. Method used to transform the ligation will determine how much of it should be used. Using 1ul for electroporation (Invitrogen electromax DH10Bs or Topo10s) yields over 500 colonies. The number of clones which need to be sequenced to identify the majority of prominent bands in the PCR will depend on the complexity of the PCR. Doing a second splinkerette ligation/pcr using another restriction enzyme will usually yield more new sequences than just increasing numbers of clones sequenced for one PCR.
7 Primer sequences 1 o PCRs - Splink1 cga aga gta acc gtt gct agg aga gac c 2 o PCRs - Splink2 gtg gct gaa tga gac tgg tgt cga c Vector/virus primers will vary depending on what vector/virus you are retrieving. Test primers on infected and uninfected DNA to find ones which give the most acceptable combination of good signal vs. minimum amplification of endogenous virus like sequences (large amounts of the mouse genome consists of retrovirus/ltr like sequences). If you want to sequence from the PCR product itself it is good to have primers set back from the insertion site so you can see the exact base of integration. We find quality of the oligos can affect the results. Start by ordering a few separate batches from different suppliers. Each new batch of primer should be tested against an older batch which you know works. HPLC puried oligos aren t necessarily better than desalted ones, we just see large amounts of batch to batch variation.
8 Moloney U3LTR primers Have tried a range of Splinkerette and U3 LTR primers and changing these doesn t seem to matter too much so long as there is sufficient nesting (6bp or more). We use LTR#5 for the primary and LTR#3 or LTR#1 for the secondary. U3LTR#1 might be giving us the most signal for a secondary PCR. U3 LTR sequence EcoRV SauIIIA GATATCCTGTTTGGCCCATATTCAGCTGTTCCATCTGTTCCTGACCTTGATCTGAACTTCTCTATTCTCAGTTATG U3 LTR#8 TTCCTGACCTTGATCTGAACTTCTCTATTCTC U3 LTR#7 CCTGACCTTGATCTGAACTTCTCTATTCTCA U3 LTR#6 CTGACCTTGATCTGAACTTCTCTATTCTCAGTTAT TATTTTTCCATGCCTTGCAAAATGGCGTTACTTAAGCTAGCTTGCCAAACCTACAGGTGGGGTCTTTCATT -LTR end- U3 LTR#5 GCGTTACTTAAGCTAGCTTGCCAAACCTAC U3 LTR#4 CGTTACTTAAGCTAGCTTGCCAAACCTACA U3 LTR#3/AB949 GCTAGCTTGCCAAACCTACAGGTGG U3 LTR#2 TTGCCAAACCTACAGGTGGGGTCT HM001 GCCAAACCTACAGGTGGGGTCTTT U3 LTR#1 CCAAACCTACAGGTGGGGTCTTTC
Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation
BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.
More informationRT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
More informationDNA Sample preparation and Submission Guidelines
DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send
More informationpcas-guide System Validation in Genome Editing
pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible
More informationPCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,
Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic
More informationUpdated: July 2005. 5' End label RNA markers 18.113 (18mer) and 44.12 (24mer) with Kinase and 32P-gamma-ATP. Gel purify labeled markers.
RNA Cloning Method Flowchart Extract total RNA containing small RNAs. Check quality on denaturing gel with EtBr staining 5' End label RNA markers 18.113 (18mer) and 44.12 (24mer) with Kinase and 32P-gamma-ATP.
More informationGENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core
DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration
More informationThermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541
PRODUCT INFORMATION Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 Lot _ Store at -20 C Expiry Date _ www.thermoscientific.com/onebio CERTIFICATE OF ANALYSIS The Phusion Site-Directed Mutagenesis
More informationTIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
More informationNimbleGen DNA Methylation Microarrays and Services
NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the
More informationPCR* Kits For DNA Ladder Assay (Cat. #: APO-DNA1)
PCR* Kits For DNA Ladder Assay (Cat. #: APO-DNA1) INSTRUCTION MANUAL *The Polymerase Chain Reaction (PCR) process is covered by patents owned by Hoffman-LaRoche. Use of the PCR process requires a license.
More information1) Vector Preparation sg 1371 w/blp1 Ef1α puro t29 BFP (602 ng/ul)
1) Vector Preparation sg 1371 w/blp1 Ef1α puro t29 BFP (602 ng/ul) a) Digest 5 ug of vector with Thermo Scientific FastDigest BstX1 and Blp1 for 1h at 37ºC. Set up reaction as follows: 100 ul Reaction
More informationCloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems
Promega Notes Number 71, 1999, p. 10 Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems By Kimberly Knoche, Ph.D., and Dan Kephart, Ph.D. Promega Corporation Corresponding
More informationPrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationFirst Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
More informationWhole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform
Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 2 Sample Prep Workflow, 3 Best Practices, 4 DNA Input Recommendations, 6
More informationSERVICES CATALOGUE WITH SUBMISSION GUIDELINES
SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service
More informationReduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform
Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 3 Sample Prep Workflow, 4 Best Practices, 5 DNA Input Recommendations,
More informationDNA Sequencing Handbook
Genomics Core 147 Biotechnology Building Ithaca, New York 14853-2703 Phone: (607) 254-4857; Fax (607) 254-4847 Web: http://cores.lifesciences.cornell.edu/brcinfo/ Email: DNA_Services@cornell.edu DNA Sequencing
More informationPyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)
More informationTroubleshooting Sequencing Data
Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page
More informationTransformAid Bacterial Transformation Kit
Home Contacts Order Catalog Support Search Alphabetical Index Numerical Index Restriction Endonucleases Modifying Enzymes PCR Kits Markers Nucleic Acids Nucleotides & Oligonucleotides Media Transfection
More informationIntroduction. Preparation of Template DNA
Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;
More informationGENOTYPING ASSAYS AT ZIRC
GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed
More informationRNA Fragment DeepSeq Library Preparation Protocol
RNA Fragment DeepSeq Library Preparation Protocol I) LIGATION Recommended input: RNA between 0.05-2 pmol; must have 3' OH 1. Thaw 10X T4 RNA Ligase Reaction Buffer, 50% PEG8000, 20 mm DTT, 7 um App Adaptor
More informationImproved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix
CLONING & MAPPING DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix LIBRARY PREP FOR NET GEN SEQUENCING PROTEIN
More informationPreparing Samples for Sequencing Genomic DNA
Preparing Samples for Sequencing Genomic DNA FOR RESEARCH ONLY Topics 3 Introduction 5 Kit Contents and Equipment Checklist 7 Fragment the Genomic DNA 11 Perform End Repair 12 Add A Bases to the 3' End
More informationThe RNAi Consortium (TRC) Broad Institute
TRC Laboratory Protocols Protocol Title: One Step PCR Preparation of Samples for Illumina Sequencing Current Revision Date: 11/10/2012 RNAi Platform,, trc_info@broadinstitute.org Brief Description: This
More informationThermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
More informationBacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
More informationpcmv6-neo Vector Application Guide Contents
pcmv6-neo Vector Application Guide Contents Package Contents and Storage Conditions... 2 Product Description... 2 Introduction... 2 Production and Quality Assurance... 2 Methods... 3 Other required reagents...
More informationPicoMaxx High Fidelity PCR System
PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED
More informationqstar mirna qpcr Detection System
qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr
More informationReverse Transcription System
TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/
More informationTable of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3
Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA
More informationGenomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
More informationDNA Sequencing Setup and Troubleshooting
DNA Sequencing Setup and Troubleshooting Lara Cullen, PhD Scientific Applications Specialist Australia and New Zealand Reviewing Sequencing Data Review the Electropherogram Review the Raw Data (Signal
More informationApplication Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
More informationAPOT - Assay. Protocol for HPV16 and 18. Amplification of Papilloma Virus Oncogene Transcripts HPV. E6 E7 E1 Zelluläre DNA poly(a)
E5 E2 E1 APOT - Assay Amplification of Papilloma Virus Oncogene Transcripts URR E6 E7 L1 HPV L2 E4 E6 E7 E1 Zelluläre DNA poly(a) Protocol for HPV16 and 18 Brief summary of the APOT assay Fig.1A shows
More informationRevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
More informationTITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR
Page 1 of 5 Materials DNase digestion buffer [13 mm Tris-Cl, ph7,5 / 5 mm MgCl2 / 0,12 mm CaCl2] RSS plasmid ptr-uf11 SV40pA Forward primer (10µM) AGC AAT AGC ATC ACA AAT TTC ACA A SV40pA Reverse Primer
More informationTaq98 Hot Start 2X Master Mix
Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 lucigen@lucigen.com
More informationReal-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
More informationRecombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
More informationMolecular analyses of EGFR: mutation and amplification detection
Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens Outline presentation
More informationGene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204
Gene Synthesis 191 Mutagenesis 194 Gene Cloning 196 AccuGeneBlock Service 198 Gene Synthesis FAQs 201 User Protocol 204 Gene Synthesis Overview Gene synthesis is the most cost-effective way to enhance
More informationNimbleGen SeqCap EZ Library SR User s Guide Version 3.0
NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 For life science research only. Not for use in diagnostic procedures. Copyright 2011 Roche NimbleGen, Inc. All Rights Reserved. Editions Version
More informationSanger Sequencing: Sample Preparation Guide
Sanger Sequencing: Sample Preparation Guide Use this as a guide to prepare your samples for Sanger sequencing at AGRF CONTENTS 1 Overview... 2 1.1 Capillary Separation (CS) or electrophoretic separation
More informationGenScript BloodReady TM Multiplex PCR System
GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI
More informationCompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
More information1/12 Dideoxy DNA Sequencing
1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide
More informationDNA Core Facility: DNA Sequencing Guide
DNA Core Facility: DNA Sequencing Guide University of Missouri-Columbia 216 Life Sciences Center Columbia, MO 65211 http://biotech.missouri.edu/dnacore/ Table of Contents 1. Evaluating Sequencing Data..
More informationGlobal MicroRNA Amplification Kit
Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in
More informationSequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website
Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, mbcore@nemours.org Katia Sol-Church, Ph.D., Director Jennifer Frenck
More informationTroubleshooting for PCR and multiplex PCR
Page 1 of 5 Page designed and maintained by Octavian Henegariu (Email: Tavi's Yale email or Tavi's Yahoo email). As I am currently pursuing a new junior faculty position, the Yale URL and email may change
More informationIntroduction to cloning
1 of 14 Introduction to cloning Aim The aim of this protocol is to serve as a general guideline to mainstream molecular cloning of Gene of Interest ( GOI ). Overview GOI Sequence Transformation into Bacteria
More informationTerra PCR Direct Polymerase Mix User Manual
Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain
More information10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)
TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain
More informationMolecular Cloning, Product Brochure
, Product Brochure Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a F NL +31 (0)26 326 44 51 F BE
More informationRNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr)
RNA Extraction and Quantification, Reverse Transcription, and Real-time Preparation of Samples Cells: o Remove media and wash cells 2X with cold PBS. (2 ml for 6 well plate or 3 ml for 6cm plate) Keep
More information(http://genomes.urv.es/caical) TUTORIAL. (July 2006)
(http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA
More informationDNA SEQUENCING (using an ABI automated sequencer)
DNA SEQUENCING (using an ABI automated sequencer) OBTECTIVE: To label and separate DNA fragments varying by single nucleotides, in order to determine the sequence of nucleotides. INTRODUCTION: Determination
More informationDNA ligase. ATP (or NAD+)
DNA Ligase enzyme catalysing formation of phosphodiesteric bound between group 3 -OH of one end of DNA molecule and group 5 -phosphate of the second end of DNA DNA ligase ATP (or NAD+) Ligase cofactors
More informationAmplicon Template Preparation and Sequencing
Please note: the shared protocols described herein may not have been validated by Pacific Biosciences and are provided as-is and without any warranty. Use of these protocols is offered to those customers
More informationSOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual
Toll Free: 866-252-7771 752A Lincoln Blvd. Phone: 732-469-7771 Fax: 732-469-7782 Middlesex, NJ 08846 Web: www.purebiotechllc.com SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual Product: SOLIDscript
More informationQUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.
QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and
More informationConstructing Normalized cdna Libraries
Constructing Normalized cdna Libraries The Center for Genomics and Bioinformatics Indiana University By: Zach Smith A. Introduction: In order to obtain high quality, low redundancy cdna libraries, it is
More informationTroubleshooting Guide for DNA Electrophoresis
Troubleshooting Guide for Electrophoresis. ELECTROPHORESIS Protocols and Recommendations for Electrophoresis electrophoresis problem 1 Low intensity of all or some bands 2 Smeared bands 3 Atypical banding
More informationSanger Sequencing. Troubleshooting Guide. Failed sequence
Sanger Sequencing Troubleshooting Guide Below are examples of the main problems experienced in ABI Sanger sequencing. Possible causes for failure and their solutions are listed below each example. The
More informationProcedures For DNA Sequencing
Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337
More informationTechnical Manual No. 0173 Update Date 10112010
TissueDirect TM Multiplex PCR System Technical Manual No. 0173 Update Date 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed
More informationHow To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent
SPARK DNA Sample Prep Kit Ion Torrent (SPK0002-V08) Frequently Asked Questions Under what circumstances would I use SPARK DNA Sample Prep Kit for Ion Torrent? Enzymatics SPARK DNA Sample Prep Kit for Ion
More informationRT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl
Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl
More informationNucleic Acid Chemistry Laboratory Automated DNA Sequencing Manual
Nucleic Acid Chemistry Laboratory Automated DNA Sequencing Manual To DNA Sequencers: This packet contains lots of information that will help you optimize your automated DNA sequencing samples. We have
More informationWelcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.
Introduction to SMRTbell Template Preparation 100 338 500 01 1. SMRTbell Template Preparation 1.1 Introduction to SMRTbell Template Preparation Welcome to Pacific Biosciences' Introduction to SMRTbell
More informationMICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA
Plasmid DNA Preparation MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA Introduction: I have always used the classic Alkaline Lysis miniprep method to isolate plasmid DNA. (See below) If
More informationPCR & DNA Sequencing. PCR= Polymerase Chain Reaction. PCR applications
PCR= Polymerase Chain Reaction PCR & DNA Sequencing Biology 224 Instructor: Tom Peavy March 20, 2006 DNA photocopier integral tool for molecular biologists work horse versatile (many applications) not
More informationHepatitis B Virus Genemer Mix
Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For
More informationQIAGEN Multiplex PCR Handbook
October 2010 QIAGEN Multiplex PCR Handbook For fast and efficient multiplex PCR without optimization Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative
More informationPlant Genomic DNA Extraction using CTAB
Plant Genomic DNA Extraction using CTAB Introduction The search for a more efficient means of extracting DNA of both higher quality and yield has lead to the development of a variety of protocols, however
More informationUNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet
1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.
More informationHerculase Hotstart DNA Polymerase
Herculase Hotstart DNA Polymerase INSTRUCTION MANUAL Catalog #600310 (100 U), #600312 (500 U), and #600314 (1000 U) Revision A.01 For In Vitro Use Only 600310-12 LIMITED PRODUCT WARRANTY This warranty
More informationMLX BCG Buccal Cell Genomic DNA Extraction Kit. Performance Characteristics
MLX BCG Buccal Cell Genomic DNA Extraction Kit Performance Characteristics Monolythix, Inc. 4720 Calle Carga Camarillo, CA 93012 Tel: (805) 484-8478 monolythix.com Page 2 of 9 MLX BCG Buccal Cell Genomic
More informationSpeed Matters - Fast ways from template to result
qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges
More informationRapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR
Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR BioTechniques 25:415-419 (September 1998) ABSTRACT The determination of unknown DNA sequences around
More informationELUTION OF DNA FROM AGAROSE GELS
ELUTION OF DNA FROM AGAROSE GELS OBTECTIVE: To isolate specific bands or regions of agarose-separated DNA for use in subsequent experiments and/or procedures. INTRODUCTION: It is sometimes necessary to
More informationInverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project
Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Protocol for recovery of sequences flanking insertions in the Drosophila Gene Disruption
More information360 Master Mix. , and a supplementary 360 GC Enhancer.
Product Bulletin AmpliTaq Gold 360 Master Mix and 360 DNA Polymerase AmpliTaq Gold 360 Master Mix AmpliTaq Gold 360 DNA Polymerase 360 Coverage for a Full Range of Targets AmpliTaq Gold 360 Master Mix
More informationIntroduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
More informationEvent-specific Method for the Quantification of Maize MIR162 Using Real-time PCR. Protocol
Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR Protocol 31 January 2011 Joint Research Centre Institute for Health and Consumer Protection Molecular Biology and Genomics
More informationDNA: A Person s Ultimate Fingerprint
A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)
More informationTransformation Protocol
To make Glycerol Stocks of Plasmids ** To be done in the hood and use RNase/DNase free tips** 1. In a 10 ml sterile tube add 3 ml autoclaved LB broth and 1.5 ul antibiotic (@ 100 ug/ul) or 3 ul antibiotic
More informationSOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis
SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis The STORE processing methods were shown to be fit-for purpose for DNA, RNA and protein extraction
More informationPaired-End Sample Preparation Guide
Paired-End Sample Preparation Guide FOR RESEARCH USE ONLY Introduction 3 Sample Prep Workflow 4 Best Practices 5 DNA Input Recommendations 7 Kit Contents 9 Consumables and Equipment 11 Fragment DNA 13
More informationSupplementary Online Material for Morris et al. sirna-induced transcriptional gene
Supplementary Online Material for Morris et al. sirna-induced transcriptional gene silencing in human cells. Materials and Methods Lentiviral vector and sirnas. FIV vector pve-gfpwp was prepared as described
More informationTaqman TCID50 for AAV Vector Infectious Titer Determination
Page 1 of 8 Purpose: To determine the concentration of infectious particles in an AAV vector sample. This process involves serial dilution of the vector in a TCID50 format and endpoint determination through
More informationProtocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013)
Protocols Internal transcribed spacer region (ITS) region Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) The nuclear ribosomal RNA (rrna) genes (small subunit, large subunit and 5.8S) are
More informationptune Inducible Vector
ptune Inducible Vector Application Guide Table of Contents Package contents and Storage Conditions:...2 Related products:...2 Introduction...2 Figure 1. Schematic Diagrams of ptune Inducible vector...3
More informationLAB 7 DNA RESTRICTION for CLONING
BIOTECHNOLOGY I DNA RESTRICTION FOR CLONING LAB 7 DNA RESTRICTION for CLONING STUDENT GUIDE GOALS The goals of this lab are to provide the biotech student with experience in DNA digestion with restriction
More information