Griffith s Experiment. Griffith & Transformation. Molecular Genetics DNA, RNA & Protein Synthesis. Avery. 1928, studying bacterium S.

Size: px

Start display at page:

Download "Griffith s Experiment. Griffith & Transformation. Molecular Genetics DNA, RNA & Protein Synthesis. Avery. 1928, studying bacterium S."

Magnus Briggs
7 years ago
Views:

3; CLE 3210.4.2; CLE 3210.4.1; CLE 3210.Inq.

pneumonia in mammals Develop vaccine against

causes pneumonia : virulent R strain does not

Transformation Heredity material from the heat

the R strain of bacteria into the S strain

DNA was released R bacteria incorporated this

Hershey Chase Experiment 1952 Martha Chase &

1 Molecular Genetics DNA, RNA & Protein Synthesis CP Biology CLE 3210.Inq.1; CLE 3210.T/E.3; CLE ; CLE ; CLE 3210.Inq.3; SPI 3210.Inq.7; SPI ; SPI 3210.Inq.3; SPI 3210.Inq.4; SPI 3210.T/E.2; SPI 3210.Math.1; SPI Griffith s Experiment 1928, studying bacterium S. pneumoniae Some strains cause lung disease pneumonia in mammals Develop vaccine against virulent (disease causing) strain S strain causes pneumonia : virulent R strain does not cause pneumonia : non virulent Griffith & Transformation Heredity material from the heat killed S cells transform R cells. The transformed R cells kill the mouse. Avery Identified the molecule that transformed the R strain of bacteria into the S strain Concluded that when the S cells were killed, DNA was released R bacteria incorporated this DNA into their cells and changed into S cells. Hershey Chase Experiment 1952 Martha Chase & Alfred Hershey DNA or protein that carries heredity material? Used radioactive labeling to trace the DNA and protein bacteriophages 1

$diffraction Watson & Crick$ Connection between Genes

2 Rosalind Franklin X-ray diffraction Watson & Crick Connection between Genes and Proteins Beadle and Tatum One gene one enzyme hypothesis Study of metabolic defects provided evidence that genes specify proteins We now know that one gene codes for one polypeptide. Deoxyribose sugar Phosphate group Nitrogen base Organic ring structure that contains one or more atoms of nitrogen Components of DNA DNA (Deoxyribonucleic acid) nucleic acid polymer made up of smaller subunits of nucleic acid called nucleotides four possible DNA (Deoxyribonucleic acid) The Nitrogen Bases Purines (double-ring, larger) Double helix two twisted strands of nucleotides The order of nucleotides in the DNA strands differentiates one organism from another Guanine Adenine 2

The Nitrogen Bases Pyrimidines (single ring, smaller)

separate Bases pair with free nucleotide Form two

Replication clip Molecular Genetics Transcription and

Transcription RNA synthesizes Protein: Translation

bases Cytosine (C) Guanine (G) Adnine (A) Uracil (U)

Carries info from DNA in nucleus out into the

enzymes to bond amino acids during protein synthesis

3 The Nitrogen Bases Pyrimidines (single ring, smaller) Thymine Cytosine Two strands of the double helix separate Bases pair with free nucleotide Form two molecules identical to original molecule DNA Replication clip Molecular Genetics Transcription and Translation: Two Main Processes DNA synthesizes RNA: Transcription RNA synthesizes Protein: Translation RNA Ribonucleic Acid Contains ribose sugar Nitrogen bases Cytosine (C) Guanine (G) Adnine (A) Uracil (U) Single strand only Types of RNA mrna messenger RNA Carries info from DNA in nucleus out into the cytoplasm to the ribosomes rrna ribosomal RNA Produce enzymes to bond amino acids during protein synthesis trna transfer RNA Transfers the amino acids to the ribosomes for protein assembly 3

Transcription to RNA Making a single copy of a DNA strand Codon DNA

) DNA Strand 5 TGCCTAAGGACCTTATCGAACCTCCTTTAAA 3 3

UGCCUAAGGUCCUUAUCGCAACCUCCUUUAAA 3 RNA Strand The Genetic Code

length to allow translation of all 20 amino acids Codon Table 3 Steps

trna, and the two ribosomal subunits together Elongation: three step

4 Transcription to RNA Making a single copy of a DNA strand Codon DNA code; set of three bases coding for an amino acid (AAA, CGC, etc.) DNA Strand 5 TGCCTAAGGACCTTATCGAACCTCCTTTAAA 3 3 ACGGATTCCTGGAATAGCTTGGAGGAAATTT 5 (Glenco, 2009) 5 UGCCUAAGGUCCUUAUCGCAACCUCCUUUAAA 3 RNA Strand The Genetic Code Triplet sequence of nucleotides codon smallest units of uniform length to allow translation of all 20 amino acids Codon Table 3 Steps to Building a Polypeptide (Translation) Initiation: brings mrna, trna, and the two ribosomal subunits together Elongation: three step cycle that adds amino acids one by one to the initial amino acid Termination: release of the polypeptide chain from the complex. 4

Translation (The synthesis of proteins) trna Ribosomes Aminoacyl-tRNA

acid sequence of protein 45 different types About 80 nucleotides long

small ribosome subunit trna carrying methionine attaches to mrna codon

directed into the A site by an elongation factor Peptide bond forms

is moved to the P site mrna moves through the ribosome 5' 3' direction

to sequence Release factor separates polypeptide and trna Translation

5 Translation (The synthesis of proteins) trna Ribosomes Aminoacyl-tRNA synthases trna Interpreter between base sequence of mrna and amino acid sequence of protein 45 different types About 80 nucleotides long Anticodon base pairs with codon of mrna Initiation 5' cap attaches to small ribosome subunit trna carrying methionine attaches to mrna codon Large ribosomal subunit attaches Elongation Codon recognition: trna directed into the A site by an elongation factor Peptide bond forms between adjacent amino acids Translocation: amino acid in the A site is moved to the P site mrna moves through the ribosome 5' 3' direction Termination Termination sequence is encountered Release factor binds to sequence Release factor separates polypeptide and trna Translation to Protein Converting mrna sequence to amino acid sequence that makes up a protein 5

6 Typically a single mrna is used to make many copies of a polypeptide simultaneously. Multiple ribosomes, polyribosomes, may trail along the same mrna. A ribosome requires less than a minute to translate an average sized mrna into a polypeptide. Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings Protein Synthesis Types of Mutations Each gene in DNA can be transcribed repeatedly into many RNA molecules Each mrna can be translated into many polypeptides Let s Review (Glenco, page 346) Point Mutations Insertions or deletions: add or subtract base pair(s) May cause frameshift Mutations Point Mutations: substitutions Replacement of one base pair with another Types: silent conservative missense nonsense One wrong letter (8 ½ min) 6

Mutations in Chromosomes Changes happen to the chromosome itself Affect the distribution

left out Insertion a chromatid breaks off and attaches to sister chromatid Results in

chromosome breaks off and is reinserted backwards Translocation part of one chromosome

homologous chromosomes to separate properly during meiosis Trisomy A gamete with an extra

Down syndrome (Trisomy 21) Monosomy A gamete with a missing chromosome is fertilized by a

7 Mutations in Chromosomes Changes happen to the chromosome itself Affect the distribution of genes to gametes during meiosis Types of Mutations Deletion part of a chromosome is left out Insertion a chromatid breaks off and attaches to sister chromatid Results in duplication of genes on the same chromosome Types of Mutations Inversion part a chromosome breaks off and is reinserted backwards Translocation part of one chromosome breaks off and added to a different chromosome clip Nondisjunction The failure of homologous chromosomes to separate properly during meiosis Trisomy A gamete with an extra chromosome is fertilized by a normal gamete Zygote has an extra chromosome Ex. Down syndrome (Trisomy 21) Monosomy A gamete with a missing chromosome is fertilized by a normal gamete Zygote lacks a chromosome Ex. human females with only a single X- chromosome Extra chromosome Missing chromosome 7

Causes of mutation Spontaneous mutation mutations that occur at random Environmental Exposure

agents that cause mutations Radiation Base analogues Chemicals that mimic normal DNA bases

carcinogenic in the body http://users.rcn.com/jkimball.ma.ultranet/biologypages/a/amestest.

Some factors which can increase mutation rates, thus promoting cancer Ionizing Radiation:

tobacco smoke, certain dyes Virus Infection: Lymphoma, Papilloma viruses Hereditary

? If mutation occurs in gametes Leads to birth defects If mutation occurs in body (somatic)

Resource Griffiths, A., Miller, J., Suzuki,D., et al. (2000).

8 Causes of mutation Spontaneous mutation mutations that occur at random Environmental Exposure to X-rays, UV light, radioactive substances and other chemicals Mutagens Physical or chemical agents that cause mutations Radiation Base analogues Chemicals that mimic normal DNA bases Ames Test A test for determining if a chemical is a mutagen Certain chemicals become carcinogenic in the body Mutagen A factor that brings about a mutation Carcinogen Any agent that causes cancer Some factors which can increase mutation rates, thus promoting cancer Ionizing Radiation: X-rays, gamma rays particles from radioactive decay- breakdown of DNA strands Chemicals: tobacco smoke, certain dyes Virus Infection: Lymphoma, Papilloma viruses Hereditary predisposition genetic link Meiosis or Mitosis?? If mutation occurs in gametes Leads to birth defects If mutation occurs in body (somatic) cells Cancer The Human Sequences of nucleotide bases Genome Project for the human species Resource Griffiths, A., Miller, J., Suzuki,D., et al. (2000). An Introduction to Genetic Analysis. 7th edition. New York: W. H. Freeman and Company. Jones, M., Fosbery, R., Taylor, D., & Gregory, J. (2007). AS Level and A Level Biology, 2 nd ed. Cambridge, UK: Cambridge University Press. 8

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other