Chapter 21: Genomes & Their Evolution
|
|
- Barnard Morris
- 7 years ago
- Views:
Transcription
1 Chapter 21: Genomes & Their Evolution 1. Sequencing & Analyzing Genomes 2. How Genomes Evolve
2 1. Sequencing & Analyzing Genomes Chapter Reading pp
3 Whole Genome Shotgun Sequencing 1 Cut the DNA into overlapping fragments short enough for sequencing. 2 Clone the fragments in plasmid or phage vectors. 3 Sequence each fragment. 4 Order the sequences into one overall sequence with computer software.
4 Bioinformatics Bioinformatics refers to application of statistics and computer analysis to DNA, protein sequence data. computer analysis can identify protein coding regions in DNA, determine amino acid sequences, compare sequences among species, etc
5 Relative Genome Size Genome size and gene number do not correlate at all with organism complexity. alternative splicing of genes and the repertoire of noncoding RNAs (e.g., mirna) may be a better indicator of sophistication or complexity in a species
6 Types of Human DNA Elements Most of the human genome (and that of many other species) does not code for any obvious gene products and has a function that is as yet unclear.
7 Repetitive DNA Elements Much of the human genome consists of repetitive DNA sequences that are thought to ultimately be of viral origin. Transposable Elements DNA segments that are duplicated and distributed throughout the genome Alu elements repetitive DNA sequences containing the Alu I restriction enzyme sites Short tandem repeats (STRs) very short sequences repeated over and over
8 Transposable Elements Barbara McClintock proposed the concept of jumping genes in the 1950s based on her studies of corn which was not taken seriously. Much later the existence of transposable elements that could jump in the genome validated her observations.
9 Transposons Transposon New copy of transposon DNA of genome Transposon is copied Insertion Mobile transposon Mobile DNA elements that can be copied & inserted Elsewhere in the genome. the transposon encodes the enzyme transposase which can copy transposon sequence and randomly insert elsewhere
10 Retrotransposons Retrotransposons are much like transposons except that they encode reverse transcriptase and have an RNA intermediate in the process. Retrotransposon New copy of retrotransposon Formation of a single-stranded RNA intermediate Reverse transcriptase RNA Insertion
11 Multigene Families Many genes are actually part of a group or cluster of similar genes referred to as a multigene family. 2 or more genes with nearly identical or very similar sequences thought to have arisen due to gene duplication and subsequent mutation members of a multigene family are typically similar in function as well as sequence arrangement of genes in multigene families also provides evidence of similar origins
12 b-globin a-globin Heme a-globin gene family Chromosome 16 b-globin gene family Chromosome 11 z y z ya 2 y a 1 a 2 a 1 y q e G g A g y b d b Embryo Fetus and adult Embryo Fetus Adult (b) The human a-globin and b-globin gene families
13 2. How Genomes Evolve Chapter Reading pp
14 Rearrangement of Genomes Genomes can undergo a number of large-scale changes that can lead to significant changes in genetic structure and in gene products: Chromosomal rearrangement breaking and recombining of pieces of diff. chrom. Transposition of mobile DNA elements sequences that can move around the genome Gene duplication duplication of gene sequences Exon shuffling combining of exons from different genes
15 Changes in Chromosome Structure Human chromosome 2 is clearly a combination of chimpanzee chromosomes 12 & 13. Telomere sequences Centromere sequences Human chromosome 2 Chimpanzee chromosomes Blocks of genes in mice and humans have remained intact though they are distributed differently among chromosomes. Telomere-like sequences Centromere-like sequences 12 Human chromosome 16 Mouse chromosomes (a) Human and chimpanzee chromosomes (b) Human and mouse chromosomes
16 Evolution of Novel Genes Genes encoding proteins with entirely new functions can arise by: 1) Duplication of existing gene followed by mutation producing distinct gene product the 2 genes will share significant homology however may have very different functions (e.g., lysozyme and a-lactalbumin) 2) Exon shuffling errors in meiotic recombination or transposition can cause the addition or loss of exons from similar or very different genes
17 Gene Duplication & Crossing Over Incorrect pairing of two homologs during meiosis Nonsister chromatids Gene Crossover point Transposable element Misalignment of similar DNA sequences during meiotic crossing over can result in chromosomes with duplicated (or missing) regions of DNA. and
18 Duplication followed by Mutation lysozyme vs a-lactalbumin
19 Model for Globin Gene Duplication The globin gene families show evidence of duplication. Duplication of ancestral gene Ancestral globin gene Evolutionary time Mutation in both copies Transposition to different chromosomes Further duplications and mutations z a a a b e b g b z y z y a y a a 2 a 1 y q e Gg Ag y b d b 2 1 a-globin gene family on chromosome 16 b-globin gene family on chromosome 11
20 Globin Gene Comparison Over time apparently duplicated globin genes diverged via mutation into similar yet distinct proteins with similar yet unique functions.
21 Exon Shuffling EGF EGF EGF EGF Epidermal growth factor gene with multiple EGF exons F F F F Fibronectin gene with multiple finger exons Exon shuffling Exon duplication F EGF K K K Plasminogen gene with a kringle exon Exon shuffling Portions of ancestral genes TPA gene as it exists today
22 Comparing Genomes Most recent common ancestor of all living things Billions of years ago 1 0 Bacteria Eukarya Archaea Sequence homology and genome structure reflect evolutionary relatedness: Millions of years ago 10 Chimpanzee Human Mouse 0 degree of differences in gene sequences, chromosome & gene structures allow estimation of time since a common ancestor
23 Key Terms for Chapter 21 whole genome shotgun seq. bioinformatics transposable elements: transposons, transposase, retrotransposons gene duplication, exon shuffling Relevant Chapter Questions: 1-6
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
More informationChapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
More information1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
More informationWorksheet - COMPARATIVE MAPPING 1
Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that
More informationBiotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
More informationCCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
More informationIntroduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationPolymorphism of retrotransposons in Bos taurus
Polymorphism of retrotransposons in Bos taurus Bernt Guldbrandtsen Goutam Sahana Mogens Sandø Lund Center for Quantitative Genetics and Genomics Aarhus University Denmark Transposons Type of jumping genes
More informationHuman Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
More informationSample Questions for Exam 3
Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.
More informationControl of Gene Expression
Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems
More information4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?
Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.
More informationChapter 13: Meiosis and Sexual Life Cycles
Name Period Chapter 13: Meiosis and Sexual Life Cycles Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know.
More informationThe world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
More information14.3 Studying the Human Genome
14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating
More informationRecombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
More informationGenetics 301 Sample Final Examination Spring 2003
Genetics 301 Sample Final Examination Spring 2003 50 Multiple Choice Questions-(Choose the best answer) 1. A cross between two true breeding lines one with dark blue flowers and one with bright white flowers
More informationRETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
More informationHuman Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
More informationBiology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA
Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns
More informationDNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
More informationBiotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
More informationMilestones of bacterial genetic research:
Milestones of bacterial genetic research: 1944 Avery's pneumococcal transformation experiment shows that DNA is the hereditary material 1946 Lederberg & Tatum describes bacterial conjugation using biochemical
More informationBioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
More informationGene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
More informationChapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
More informationINTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
More informationChapter 5: Organization and Expression of Immunoglobulin Genes
Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed
More informationInnovations in Molecular Epidemiology
Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether
More informationLecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
More informationPairwise Sequence Alignment
Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
More informationControl of Gene Expression
Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure
More informationrestriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
More informationRecombinant DNA Technology
Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium
More informationPractice Problems 4. (a) 19. (b) 36. (c) 17
Chapter 10 Practice Problems Practice Problems 4 1. The diploid chromosome number in a variety of chrysanthemum is 18. What would you call varieties with the following chromosome numbers? (a) 19 (b) 36
More informationEuropean Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
More informationLecture 2: Mitosis and meiosis
Lecture 2: Mitosis and meiosis 1. Chromosomes 2. Diploid life cycle 3. Cell cycle 4. Mitosis 5. Meiosis 6. Parallel behavior of genes and chromosomes Basic morphology of chromosomes telomere short arm
More informationGenetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
More informationLocalised Sex, Contingency and Mutator Genes. Bacterial Genetics as a Metaphor for Computing Systems
Localised Sex, Contingency and Mutator Genes Bacterial Genetics as a Metaphor for Computing Systems Outline Living Systems as metaphors Evolutionary mechanisms Mutation Sex and Localized sex Contingent
More informationList, describe, diagram, and identify the stages of meiosis.
Meiosis and Sexual Life Cycles In this topic we will examine a second type of cell division used by eukaryotic cells: meiosis. In addition, we will see how the 2 types of eukaryotic cell division, mitosis
More informationGenetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
More informationChapter 8: Variation in Chromosome Structure and Number
Chapter 8: Variation in Chromosome Structure and Number Student Learning Objectives Upon completion of this chapter you should be able to: 1. Know the principles and terminology associated with variations
More information2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
More informationStructure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
More informationRecombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
More informationChapter 13: Meiosis and Sexual Life Cycles
Name Period Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know. Define: gene locus gamete male gamete female
More informationMUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
More informationName: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Chapter 17 Practice Multiple Choice Identify the choice that best completes the statement or answers the question. 1. The correct order for the levels of Linnaeus's classification system,
More informationBio EOC Topics for Cell Reproduction: Bio EOC Questions for Cell Reproduction:
Bio EOC Topics for Cell Reproduction: Asexual vs. sexual reproduction Mitosis steps, diagrams, purpose o Interphase, Prophase, Metaphase, Anaphase, Telophase, Cytokinesis Meiosis steps, diagrams, purpose
More informationPROYECTO GENOMA HUMANO. Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA
PROYECTO GENOMA HUMANO Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA GENOMA HUMANO Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA Some landmarks on the way to 1940s
More informationAlgorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
More informationLecture 7 Mitosis & Meiosis
Lecture 7 Mitosis & Meiosis Cell Division Essential for body growth and tissue repair Interphase G 1 phase Primary cell growth phase S phase DNA replication G 2 phase Microtubule synthesis Mitosis Nuclear
More informationBio 102 Practice Problems Recombinant DNA and Biotechnology
Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More informationGenetic Variation and Molecular Evolution
1 Genetic Variation and Molecular Evolution Werner Arber Biozentrum, University of Basel, Klingelbergstrasse 70, Basel, Switzerland 1 Introduction 3 2 Principles of Molecular Evolution 4 2.1 Evolutionary
More informationGene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
More informationAmazing DNA facts. Hands-on DNA: A Question of Taste Amazing facts and quiz questions
Amazing DNA facts These facts can form the basis of a quiz (for example, how many base pairs are there in the human genome?). Students should be familiar with most of this material, so the quiz could be
More informationArabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham
Arabidopsis A Practical Approach Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham OXPORD UNIVERSITY PRESS List of Contributors Abbreviations xv xvu
More information13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
More informationThe sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
More informationDNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
More informationDNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
More information5 GENETIC LINKAGE AND MAPPING
5 GENETIC LINKAGE AND MAPPING 5.1 Genetic Linkage So far, we have considered traits that are affected by one or two genes, and if there are two genes, we have assumed that they assort independently. However,
More informationA and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently.
Name Section 7.014 Problem Set 5 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68-120 by 5:00pm on Friday
More information1. Why is mitosis alone insufficient for the life cycle of sexually reproducing eukaryotes?
Chapter 13: Meiosis and Sexual Life Cycles 1. Why is mitosis alone insufficient for the life cycle of sexually reproducing eukaryotes? 2. Define: gamete zygote meiosis homologous chromosomes diploid haploid
More informationFinal Project Report
CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes
More informationGenetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
More informationCHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the
More informationTransmission of genetic variation: conjugation. Transmission of genetic variation: conjugation
Transmission of genetic variation: conjugation Transmission of genetic variation: conjugation Bacterial Conjugation is genetic recombination in which there is a transfer of DNA from a living donor bacterium
More informationTrasposable elements: P elements
Trasposable elements: P elements In 1938 Marcus Rhodes provided the first genetic description of an unstable mutation, an allele of a gene required for the production of pigment in maize. This instability
More informationGenetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
More informationBiology Final Exam Study Guide: Semester 2
Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion
More information1865 Discovery: Heredity Transmitted in Units
1859 Discovery: Natural Selection Genetic Timeline Charles Darwin wrote On the Origin of Species by Means of Natural Selection, or the Preservation of Favored Races in the Struggle for Life. 1865 Discovery:
More informationPrinciples of Evolution - Origin of Species
Theories of Organic Evolution X Multiple Centers of Creation (de Buffon) developed the concept of "centers of creation throughout the world organisms had arisen, which other species had evolved from X
More informationReproductive System & Development: Practice Questions #1
Reproductive System & Development: Practice Questions #1 1. Which two glands in the diagram produce gametes? A. glands A and B B. glands B and E C. glands C and F D. glands E and F 2. Base your answer
More informationName Class Date. binomial nomenclature. MAIN IDEA: Linnaeus developed the scientific naming system still used today.
Section 1: The Linnaean System of Classification 17.1 Reading Guide KEY CONCEPT Organisms can be classified based on physical similarities. VOCABULARY taxonomy taxon binomial nomenclature genus MAIN IDEA:
More information12.1 The Role of DNA in Heredity
12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin
More informationThe E. coli Insulin Factory
The E. coli Insulin Factory BACKGROUND Bacteria have not only their normal DNA, they also have pieces of circular DNA called plasmids. Plasmids are a wonderfully ally for biologists who desire to get bacteria
More informationGenome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009
Genome and DNA Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Admin Reading: Chapters 1 & 2 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring09/bme110-calendar.html
More informationMAKING AN EVOLUTIONARY TREE
Student manual MAKING AN EVOLUTIONARY TREE THEORY The relationship between different species can be derived from different information sources. The connection between species may turn out by similarities
More informationThe NF1-gene a hotspot for de novo Alu- and L1-insertion?
The NF1-gene a hotspot for de novo Alu- and L1-insertion? Katharina Wimmer Division Humangenetik, Medizinische Universität Innsbruck Molekulare Diagnostik 2013 Zürich, 1. März, 2013 2 Die im Vortrag vorgestellten
More informationDNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)
DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure
More informationBiological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
More informationsomatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive
CHAPTER 6 MEIOSIS AND MENDEL Vocabulary Practice somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive CHAPTER 6 Meiosis and Mendel sex
More informationEvidence for evolution factsheet
The theory of evolution by natural selection is supported by a great deal of evidence. Fossils Fossils are formed when organisms become buried in sediments, causing little decomposition of the organism.
More informationLecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur
More informationForensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
More informationCompiled and/or written by Amy B. Vento and David R. Gillum
Fact Sheet Describing Recombinant DNA and Elements Utilizing Recombinant DNA Such as Plasmids and Viral Vectors, and the Application of Recombinant DNA Techniques in Molecular Biology Compiled and/or written
More informationOkami Study Guide: Chapter 3 1
Okami Study Guide: Chapter 3 1 Chapter in Review 1. Heredity is the tendency of offspring to resemble their parents in various ways. Genes are units of heredity. They are functional strands of DNA grouped
More informationHeuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations
Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations AlCoB 2014 First International Conference on Algorithms for Computational Biology Thiago da Silva Arruda Institute
More informationExpression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu
Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.
More informationOverview of Eukaryotic Gene Prediction
Overview of Eukaryotic Gene Prediction CBB 231 / COMPSCI 261 W.H. Majoros What is DNA? Nucleus Chromosome Telomere Centromere Cell Telomere base pairs histones DNA (double helix) DNA is a Double Helix
More informationSummary. 16 1 Genes and Variation. 16 2 Evolution as Genetic Change. Name Class Date
Chapter 16 Summary Evolution of Populations 16 1 Genes and Variation Darwin s original ideas can now be understood in genetic terms. Beginning with variation, we now know that traits are controlled by
More informationNext Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took
More informationEvolution of Retroviruses: Fossils in our DNA 1
Evolution of Retroviruses: Fossils in our DNA 1 JOHN M. COFFIN Professor of Molecular Biology and Microbiology Tufts University UNIQUE AMONG INFECTIOUS AGENTS, retroviruses provide the opportunity for
More informationBioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
More informationAppendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
More informationHierarchical Bayesian Modeling of the HIV Response to Therapy
Hierarchical Bayesian Modeling of the HIV Response to Therapy Shane T. Jensen Department of Statistics, The Wharton School, University of Pennsylvania March 23, 2010 Joint Work with Alex Braunstein and
More informationPRINCIPLES OF POPULATION GENETICS
PRINCIPLES OF POPULATION GENETICS FOURTH EDITION Daniel L. Hartl Harvard University Andrew G. Clark Cornell University UniversitSts- und Landesbibliothek Darmstadt Bibliothek Biologie Sinauer Associates,
More information