Histone demethylase RBP2 is critical for breast cancer progression and metastasis

Transcription

1 Supplemental Information Histone demethylase RBP2 is critical for breast cancer progression and metastasis Jian Cao, Zongzhi Liu, William K.C. Cheung, Minghui Zhao, Sophia Y. Chen, Siew Wee Chan, Carmen J. Booth, Don X. Nguyen and Qin Yan Inventory of Supplemental Information included in this document Figures S1-S6 Table legends for Tables S1 and S3, which are provided in a separate Excel file. Tables S2 Supplemental Experimental Procedures Supplemental References

2 Figure S1. High RBP2 expression level is associated with breast cancer metastasis, especially in ER - patients, Related to Figure 1. (A, D-E, and G-H) Kaplan-Meier Plotter analyses of metastasis-free survival of lymph node negative patients with the indicated ER status, stratified by RBP2 expression level based on the _s_at or _at probe. (C) Summary of Kaplan-Meier Plotter analysis of metastasis-free survival of lymph node negative patients with the indicated ER status based on the _s_at probe. (B, F, and I) Kaplan-Meier analyses of metastasis-free survival of patients from the EMC286 cohort with the indicated ER status. High and low RBP2 levels were defined by top 25% and bottom 25%, respectively.

3 Figure S2. RBP2 loss results in global increase of H3K4me3 level, Related to Figure 2. (A) Real time RT-PCR analysis of RBP2 expression in MDA-MB-231 cells transfected with the indicated sirna. RBP2 mrna level was normalized to GAPDH. Error bars represent SD. (B) Western blot analysis of histone or histone modifications in MDA-MB-231 cells transfected with the indicated sirna. Scr si, scrambled sirna; RBP2 si-1, RBP2 sirna-1; RBP2 si-2, RBP2 sirna-2; RBP2 si-3, RBP2 sirna-3.

4 Figure S3. LM2 cells are more invasive than MDA-MB-231 cells and TNC expression is higher in ER - tumors with high RBP2 expression, Related to Figure 3. (A) Quantification of MDA-MB-231 cells (231) and LM2 cells invaded through Matrigel coated membrane inserts. 4 random fields of each insert were quantified and normalized to LM2 cells. Error bars represent SEM of three inserts. (B) Box and whiskers plots showing TNC expression level in ER + or ER - tumors expressing high, or medium and low RBP2 levels in the EMC286 clinical dataset. RBP2 high, M (medium) and L (low) were defined using k-means clustering. The box indicates the 25th to 75th percentiles, while the line in the middle of the box is plotted at the median. The whiskers indicate the minimum and maximum values.

5 Figure S4. RBP2 regulates TNC expression in a demethylase-independent manner, Related to Figure 4. (A) A schematic map of the primers used in ChIP assays. TSS, transcriptional start site. (B) ChIP analysis for H3K4me3 occupancy on regions near transcriptional start site of TNC in LM2 cells transfected with scrambled sirna or sirna against RBP2. Scr si, scrambled sirna; RBP2 si-1, RBP2 sirna-1; DS, downstream. Error bars represent SD. (C) A schematic map of VSVG-RBP2 plasmids used in Figure 4B and 4D. (D) ChIP analysis for RBP2 binding to TNC and NDUFA9 in LM2 cells. Error bars represent SD.

6 Figure S5. Knockdown of RBP2 in LM2 and 1833 cells, Related to Figure 5. Western blot analysis of the indicated proteins in whole cell lysates or culture media of LM2 (A) and 1833 (B) cells stably expressing the indicated shrna. Ctrl sh, control shrna.

7 Figure S6. Box plot showing the average weight of primary tumors from the MMTV-neu mice with the indicated genotypes examined in Figure 6, Related to Figure 6. Error bars represent SEM.

8 Table legends for Tables S1 and S3 Table S1. The association of mrna levels of histone modifying enzymes with metastasisfree survival, Related to Figure 1. Table S3. List of up- and down-regulated genes after RBP2 sirna treatment of MDA-MB- 231 cells, Related to Figure 2. Table S2. Cox multivariate analysis of RBP2, ER, PR, HER2 levels and stage for metastasis free survival in the EMC286 cohort, Related to Figure 1. Number of Patients Percentage Hazard Ratio Lower.95 Upper.95 p-value Variable Group RBP2 Low % RBP2 Mid % RBP2 High % ER % ER % PR % PR % PR Unknown % HER % HER % HER2 Unknown % Stage % Stage > %

9 Supplemental Experimental Procedures: Immunoblot and Real-Time RT-PCR Analysis Immunoblotting of cellular proteins was performed as described previously (Klose et al., 2007). For immunoblotting of secreted proteins, cells were grown in Opti-MEM (Invitrogen) for 24 hours, and the conditioned media were harvested and concentrated using acetone precipitation (Wajapeyee et al., 2008). Antibodies for immunoblotting were GAPDH (G9545, Sigma), RBP2 (mab3876, Cell signaling or descripted previously (Klose et al., 2007)), TNC (MAB1918, Millipore), IGFBP7 (SC-13095, Santa Cruz), HA (MMS101P, Covance), VSV-G (ab50549, Abcam), tubulin (T5168, Sigma), H3 (ab1791, Abcam), H3K4me (ab8895, Abcam), and H3K4me3 (ab8580, Abcam). Total RNA was isolated and reverse transcription was performed, followed by real-time PCR as described previously (Lin et al., 2011). Primers for real-time PCR were GAPDH-F: tgcaccaccaactgcttagc, GAPDH-R: ggcatggactgtggtcatgag; RBP2-F: ccgtctttgagccgagttg, RBP2- R: ggactcttggagtgaaacgaaa; TNC-F: gtcaccgtgtcaacctgatg, TNC-R: gcctgccttcaagatttctg; SOX4- F: aagcttcagcaaccagcatt, SOX4-R: ccctctctctcgctctctca; FSCN1-F: aggggactcagagctcttcc, FSCN1-R: tgcctgtggagtctttgatg; PDGFA-F: caagaccaggacggtcattt, PDGFA-R: cctgacgtattccaccttgg; SEPRINE2-F: ctttgaggatccagcctctg, SEPRINE2-R: tgcgtttctttgtgttctcg; PLCB1-F: cgtggctttccaagaagaag; PLCB1-R: gcttccgatctgctgaaaac. Chromatin Immunoprecipitation Subconflucent LM2 cells grown in 100 mm dishes were first treated with DMEM containing 1% formaldehyde for 10 min. The crosslinking was stopped by the addition of M glycine for 10 min. After washing twice with PBS, the cells were resuspended in 1 ml of lysis buffer I (50 mm Hepes KOH (ph 7.5), 140 mm NaCl, 1 mm EDTA, 10% glycerol, 0.5% NP40, 0.25% Triton X-100) with 1 mm PMSF and incubated on ice for 20 min. After centrifugation at 3,000 rpm in a Eppendorf 5415R refridgerated microcentrifuge for 10 min, the cell pellets were resuspended in lysis buffer II (200 mm NaCl, 10 mm Tris HCl (ph 8.0), 1 mm EDTA, 0.5 mm EGTA) supplemented with complete protease inhibitor cocktail (Roche Molecular Biochemicals). After rocking for 10 min, nuclei were pelleted by centrifugation at 3,000 rpm for 10 min and resuspended in lysis buffer III (100 mm NaCl, 10 mm Tris HCl (ph 8.0), 1 mm EDTA, 0.5 mm EGTA, 0.1% Na-Deoxycholate, 0.5% N-lauroyl sarcosine) supplemented with completer protease inhibitor cocktail. The chromatin samples were then sonicated into fragments with an average length of 1 kb. After centrifugation at 13,000 rpm for 10 min, Triton X-100 was added to a final concentration of 1% and ChIP assays were performed with the indicated antibodies. PCR analyses were then performed to determine the amount of targets in the ChIP samples. Real-time PCR was performed in triplicate using Fast SYBR Green Master Mix (Applied Biosystems). The relative amount of immunoprecipitated DNA to input DNA was plotted in the figures. The primers used were: RBP2-A-F: tgctggttgagacacagctt, RBP2-A-R: cctcccagacagcaagaaag, RBP2-B-F: ggacgcctttcagcactaag, RBP2-B-R: tgacattgttcatgccctgt, RBP2-C-F: tatgcaaatgggttccttcc, RBP2-C-R: tggcgaattaaaggaacagc, RBP2-D-F: tgagtgcgtctttcatgagc, RBP2-D-R: gcgagctccttcctctgtaa, RBP2-E-F: ctgctgttctgcagaggaaa, RBP2-

10 E-R: tctccctgcactcctctatca, RBP2-DS-F: ccactcaagcaggattccat, RBP2-DS-R: ttaggctttcgggaaaaggt, NDUFA9-F: acggggatttaaggttttgg, NDUFA9-R: ggaaagcgaaaggagaaacc. Histopathology Mice were euthanized by CO 2 asphyxiation and lungs or leg bones (femur, tibia, fibula, and patella) were harvested and fixed in 10% neutral buffered formalin, processed (bones are also decalcified), sectioned and stained by hematoxylin and eosin (H&E) by routine methods by Yale Research Histology (Department of Pathology) or Yale Mouse Research Pathology (Section of Comparative Medicine). Tissues were evaluated blind to experimental manipulation (by CJB) for the presence and number of tumor metastatic foci and percentage of lung effaced by tumor. Digital light microscopic images were recorded using a Axio Imager.A.1 microscope and an AxioCam MRc5 camera and AxioVision 4.7 imaging software (Zeiss) and optimized in Adobe Photoshop CS5 (Adobe Systems Incorporated, USA). All procedures involving animals were approved by the Yale University Institutional Animal Care and Use Committee. Supplemental References: Wajapeyee, N., Serra, R. W., Zhu, X., Mahalingam, M., and Green, M. R. (2008). Oncogenic BRAF Induces Senescence and Apoptosis through Pathways Mediated by the Secreted Protein IGFBP7. Cell 132,