List of Primers PRIMERS.DOCX 1 /

Size: px
Start display at page:

Download "List of Primers PRIMERS.DOCX 1 /"

Transcription

1 List of Primers petm11/24 REV CAGCAGCCAACTCAGC Vladimir Benes Custom Primer GEMHE_Rev1 5' CACTTTATGCTTCCGGCTCG 3' Sequence found 3' of pgemhe linearization cassette GEMHE_Rev2 5' GAGCAGATACGAATGGCTAC 3' Sequence found 3' of pgemhe MCS IE1 promoter 5' TGGATATTGTTTCAGTTGCAAG IE1 term 5' CAACAACGGCCCCTCGATA mcherry REV 5' GCACCTTGAAGCGCATGAACTCC p5ftx 3 5' CGC GGA GGG GGG CGT CAC 3' FTX vectors pac5.1f 5' ACACAAAGCCGCTCCATCAG pacycduetup1 5' GGA TCT CGA CGC TCT CCC T 3' Forward primer for MCS 1 of pcdfduet vectors. pamp_3in 5' ACT CCC CGT CGT GTA GAT 3' Ampicillin gene internal primer pamp_3out 5' ATC TAC ACG ACG GGG AGT 3' Ampicillin gene internal primer pamp_5in 5' ATC AGT TGG GTG CAC GAG 3' Ampicillin gene internal primer pamp_5out 5' CTC GTG CAC CCA ACT GAT 3' Ampicillin internal primer parie 2REV 5' GCC ACT AGT CGA TCT CCC C 3' Primer to be used for Arie's plasmids, keep in stock. pbacpak FWD 5'TGTAATGAGACGCACAA pbacpak 8/9 vectors pbacpak REV 5' TCAACAACGCACAGAATCT pbacpak 8/9 vectors pbad_rev 5' GAT TTA ATC TGT ATC AGG 3' pbad pbadfwd 5' ATG CCA TAG CAT TTT TAT CC 3' pbadm_11 5 5' CCG TTT TTT GGG CTA ACA 3' pcdna3_1rev 5' TAG AAG GCA CAG TCG AGG 3' pcdna3.1 pcmu3 5' GAA AGA ACA ATC AAG GGT CC 3' pcmu IV pcmu5 5' CTG GTC CCC ACA GAC TGC 3' pcmu IV pduetdown1 5' GAT TAT GCG GCC GTG TAC AA 3' Reverse primer for MCS 1 of pcdfduet vector. 1 /

2 pduetup2 5' TTG TAC ACG GCC GCA TAA TC 3' Forward primer for MCS 2 of petduet vector. peg5rev 5' CCT CCA GCC CTT TGA TAA T peg5 Vectors. Reverse primer pegfp all 5' CCT CTA CAA ATG TGG TAT GGC 3' 3' of MCS, pdsred2 C1, pecfp C1, pegfp C1/2/3, peyfp C1(SV40 poly A seqgment) pegfp c 5' GCC GCC GGG ATC AC 3' 5' of MCS, pdsred2 C1, pecfp C1, pegfp C1/2/3, peyfp C1(GFP internal primer) pegfp CMV 5' TAA CAA CTC CGC CCC ATT 3' 5' MCS, pdsred2 N1, pecfp N1, pegfp N1/2/3, peyfp N1(on CMV promotor) pegfp rev 5' GTC CAG CTC GAC CAG GAT GGG 3' 3' MCS, pdsred2 N1, pecfp N1, pegfp N1/2/3, peyfp N1(GFP internal primer) pentr4 FWD 343 pet M11 rev 5' CTT AAG CTC GGG CCC CA 3' 5' CAG CAG CCA ACT CAG C 3' pet_upstream 5' ATG CGT CCG GCG TAG A 3' pet Vectors pet28 SUMO1FWD pet28 SUMO3FWD 5' TGAGGGTCAGAGAATTG 3' 5' CTGACACTCCAGCACA 3' pet40 MBP 5' GAA AGA CGC GCA GAC T 3' pet40 primer petm_50 5 5' GGA TCA ACT AGT GGT TCT GG 3' 5' primer covering junction between reporter gene and insert of interest petm11 FWD 5' ACC ATC ACC CCA TGA GCG 3' petm20 5 5' CTG GCC GGT TCT GGT TCT 3' 5' primer covering junction between reporter gene and insert of interest petm60 5 5' TCG GTG ACG AAG CGA CTA GT 3' 5' primer covering junction between reporter gene and insert of interest pfastbac_fwd 5' AAT GAT AAC CAT CTC GCA A 3' pfastbac pfastbac_rev 5' CAA CAA CAA TTG CAT TCA 3' pfastbac pgex_fwd 5' GGG CTG GCA AGC CAC GTT TGG TG 3' pgex Vectors, anneals to 3' end of GST gene pgex_rev 5' CCG GGA GCT GCA TGT GTA AGA GG 3' pgex Vectors, (specific for pgex only) pgfp5 BAMH1 5' GGA TCC ATG GTG AGC AAG GGC GAG GAG CTG 3' pgfpint3 5' CAT GCC GAG AGT GAT CC 3' GFP internal primer pgfpint5 5' GCT GGA CGG CGA CGT AAA 3' GFP internal primer pgfp midas 5' AGG ATG TTG CCG TCC TCC 3' GFP internal primer Extreme 5' orientation in direction of GFP 2 /

3 pgfp midsense 5' CAA GAC CCG CGC CGA GGT 3' GFP internal primer pgfp REV 90 5' GCC CTC GCC CTC GCC GGA 3' 3' of MCS, pdsred2 N1, pecfp N1, pegfp N1/2/3, peyfp N1(GFP internal primer) pgl2 5' CTT TAT GTT TTT GGC GTC TTC CA 3' pgl2 or 3 (Luciferase Reporter Vectors phsp70 fwd 5' TCA ACT GCA ACT ACT GA 3' puast Vector. Forward primer pk SV40 5' TAG TGG GAA TTG TCT AGG AAG C 3' psv40 pmalefus 5' ggt cgt cag act gtc gat gaa gcc 3' pmal (Fusion of MalE gene and insert of interest) pmalestart 5' TGT GAG CGG ATA ACA ATT TC 3' pmal (Beginning of MalE gene) pmatch3 5' GCG GGG TTT TTC AGT ATC TAC GAT 3' pmatch Vector pme Fwd pme Rev CTT CTG CTC TAA AAG CTG CG CGA CCT GCA GCT CGA GCA CA pproex3' 5' CGC TTC TGC GTT CTG ATT 3' ppro vector rev sequencing primer pproex5' 5' GGA AAC AGA CCA TGT CGT ACT 3' ppro vector fwd sequencing primer pqe fwd 5' CCC GAA AAG TGC CAC CTG 3' pqe Vectors pqe rev 5' GTT CTG AGG TCA TTA CTG G 3' pqe Vectors prm F 5' GTG CAT CAG TTG TGG TCA GCA GC 3' prmha forward primer prm fwd 5' GTG CAT CAG TTG TGG TCA GCA GC 3' prm Vectors prm r 5' AAT TAA GTA GAG CGT TTA TCA G 3' prmha reverse primer prm rev 5' ATT TAA GTA GAG CGT TTA TCA G 3' prm Vectors promppro 5' TTT GCG CCG ACA TCA TA 3' ppro vectors. Primer for Promotor region prsetrev 5' CTA GTT ATT GCT CAG CGG TGG 3' prset Vectors. Revers primer prv primer3 5' CTA GCA AAA TAG GCT GTC CC 3' prv Vectors Pry 4 5' CAA TCA TAT CGC TGT CTC ACT C 3' psg5 reverse 5' GAA GCG GAA GAG TCT AGA GTC G 3' psg5 psupsp 5' ATT ACG TGA CGT AGA AAG TA 3' Unknown vector ptactacfwd 5 ATC GAT GCT TAG GAG GTC 3 3 /

4 ptopo R 5' CTC GGA TCC ACT AGT AAC G 3' All pcrtopo Vectors except pcr4topo, Junction may not be visible ptopo U 5' CAG TGT GAT GGA TAT CTG C 3' All pcrtopo Vectors except pcr4topo, Junction may not be visible ptrchisfwd 5' TCT GTG TGG GCA CTC GAC 3' ptrchis ptrchisrev 5' TCC GCC AAA ACA GCC AAG 3' ptrchis ptub5 out 5' CCA ATG GTC TTG TCA CTT 3' ptub Vectors puast HSP70 5' TCA ACT GCA ACT ACT GA 3' puast forward primer. PVL fwd 5' AAA ATG ATA ACC ATC TCG C 3' pvl Vectors PVL rev 5' GTC CAA GTT TCC CTG 3' pvl Vectors py2hlower 5' TTG CGG GGT TTT TCA GTA TCT ACG A 3' pse1107 reverse primer py2hupper 5' GAT GAT GAA GAT ACC CCA CCA AAC C 3' pse1107 forward primer py2hupper 2 5' ATC TAT TCG ATG ATG AAG ATA CCC C 3' pse1107 forward primer RP M13rev 5' CAG GAA ACA GCT ATG ACC 3' (Vectors containing Lac Z), pbs, pcrtopo, pgem, puc19, pzero2.1...(not pt7t3d vector) RPOP 5' GGA ATT GTG AGC GGA TTA CA 3' Vectors containing Lac Z Seq LA Seq LB 5' TCG CGT TAA CGC TAG CAT GGA 3 N5 GTA ACA TCA GAG ATT TTG AGA CAC 3 Sp6 5' GCT ATT TAG GTG ACA CTA TAG 3' pcr2.1topo, pcriitopo, pgem, pcrs2+, pzero2.1, pcdna3, pcmv Sport6, phat2 S Tag 5' CGA ACG CCA GCA CAT GGA CA 3' T3 5' ATT TAA CCC TCA CTA AAG GG 3' pbluescriptii, pt7t3d, pclneo, pcr4topo T7_all (pcs2+, pcineo ONLY) 5' TAA TAC GAC TCA CTA TAG 3' T7_term (pet vectors rev) 5' GCT AGT TAT TGC TCA GCG G 3' pcs+, pclneo T7 3G (STANDARD) 5' TAA TAC GAC TCA CTA TAG GG 3' pcmv Sport6, pcdna3.1. pet, pgbkt7, pgem, phat2 TEV 4 Fwd TEV 4 Rev 5' GTG GCC CCG GGA ATT CT 3' 5' AGC GGC TTC GGC CAG TA 3' UP M13fwd 5' CGA CGT TGT AAA ACG ACG GCC AGT 3' (Vectors containing Lac Z) pbs, pcrtopo, pgem, puc19, pzero2.1 (M13 20) pet 4 /

5 UPOP 5' GGT AAC GCC AGG GTT TTC C 3' Vectors containing Lac Z (M13 40) 5 /

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration

More information

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C) TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain

More information

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors.

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. Legends of supplemental figures and tables Figure 1: Overview of study design and results. (A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. After raw data gene expression

More information

DNA Sample preparation and Submission Guidelines

DNA Sample preparation and Submission Guidelines DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send

More information

Table S1. Related to Figure 4

Table S1. Related to Figure 4 Table S1. Related to Figure 4 Final Diagnosis Age PMD Control Control 61 15 Control 67 6 Control 68 10 Control 49 15 AR-PD PD 62 15 PD 65 4 PD 52 18 PD 68 10 AR-PD cingulate cortex used for immunoblot

More information

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1 Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation Beginning Perl, Chap 4 6 Example 1 #!/usr/bin/perl -w use strict; # version 1: my @nt = ('A', 'C', 'G', 'T'); for

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.

More information

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene Supplementary Online Material for Morris et al. sirna-induced transcriptional gene silencing in human cells. Materials and Methods Lentiviral vector and sirnas. FIV vector pve-gfpwp was prepared as described

More information

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204 Gene Synthesis 191 Mutagenesis 194 Gene Cloning 196 AccuGeneBlock Service 198 Gene Synthesis FAQs 201 User Protocol 204 Gene Synthesis Overview Gene synthesis is the most cost-effective way to enhance

More information

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.

More information

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service

More information

Mutations and Genetic Variability. 1. What is occurring in the diagram below?

Mutations and Genetic Variability. 1. What is occurring in the diagram below? Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are

More information

The p53 MUTATION HANDBOOK

The p53 MUTATION HANDBOOK The p MUTATION HANDBOOK Version 1. /7 Thierry Soussi Christophe Béroud, Dalil Hamroun Jean Michel Rubio Nevado http://p/free.fr The p Mutation HandBook By T Soussi, J.M. Rubio-Nevado, D. Hamroun and C.

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing 38. Informationsgespräch der Blutspendezentralefür Wien, Niederösterreich und Burgenland Österreichisches Rotes Kreuz 22. November 2014, Parkhotel Schönbrunn Die Zukunft hat

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human Supplementary Information Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human vascular endothelial growth factor 165 revealed by biosensor based assays Yoichi Takakusagi

More information

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

Molecular analyses of EGFR: mutation and amplification detection

Molecular analyses of EGFR: mutation and amplification detection Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens Outline presentation

More information

Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project

Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Protocol for recovery of sequences flanking insertions in the Drosophila Gene Disruption

More information

ANALYSIS OF A CIRCULAR CODE MODEL

ANALYSIS OF A CIRCULAR CODE MODEL ANALYSIS OF A CIRCULAR CODE MODEL Jérôme Lacan and Chrstan J. Mchel * Laboratore d Informatque de Franche-Comté UNIVERSITE DE FRANCHE-COMTE IUT de Belfort-Montbélard 4 Place Tharradn - BP 747 5 Montbélard

More information

pcmv6-neo Vector Application Guide Contents

pcmv6-neo Vector Application Guide Contents pcmv6-neo Vector Application Guide Contents Package Contents and Storage Conditions... 2 Product Description... 2 Introduction... 2 Production and Quality Assurance... 2 Methods... 3 Other required reagents...

More information

Supplemental Data. Short Article. PPARγ Activation Primes Human Monocytes. into Alternative M2 Macrophages. with Anti-inflammatory Properties

Supplemental Data. Short Article. PPARγ Activation Primes Human Monocytes. into Alternative M2 Macrophages. with Anti-inflammatory Properties Cell Metabolism, Volume 6 Supplemental Data Short Article PPARγ Activation Primes Human Monocytes into Alternative M2 Macrophages with Anti-inflammatory Properties M. Amine Bouhlel, Bruno Derudas, Elena

More information

Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians

Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians Vol. 44 No. 3 SCIENCE IN CHINA (Series C) June 2001 Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians KE Yuehai ( `º) 1, SU Bing (3 Á) 1 3, XIAO Junhua

More information

Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer

Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer Archimer http://www.ifremer.fr/docelec/ Archive Institutionnelle de l Ifremer The original publication

More information

Title : Parallel DNA Synthesis : Two PCR product from one DNA template

Title : Parallel DNA Synthesis : Two PCR product from one DNA template Title : Parallel DNA Synthesis : Two PCR product from one DNA template Bhardwaj Vikash 1 and Sharma Kulbhushan 2 1 Email: vikashbhardwaj@ gmail.com 1 Current address: Government College Sector 14 Gurgaon,

More information

ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA)

ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA) ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA) Zrůstová J., Bílek K., Baránek V., Knoll A. Ústav morfologie, fyziologie a genetiky zvířat, Agronomická

More information

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain?

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain? Networked Systems, COMPGZ01, 2012 Answer TWO questions from Part ONE on the answer booklet containing lined writing paper, and answer ALL questions in Part TWO on the multiple-choice question answer sheet.

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

Molecular chaperones involved in preprotein. targeting to plant organelles

Molecular chaperones involved in preprotein. targeting to plant organelles Molecular chaperones involved in preprotein targeting to plant organelles Dissertation der Fakultät für Biologie der Ludwig-Maximilians-Universität München vorgelegt von Christine Fellerer München 29.

More information

Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases

Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases Dissertation der Mathematisch-Naturwissenschaftlichen Fakultät der Eberhard Karls Universität

More information

Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala

Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala -'Pablo García-Lugo 1t, Celedonio González l, Germán Perdomo l, Nélida

More information

Five-minute cloning of Taq polymerase-amplified PCR products

Five-minute cloning of Taq polymerase-amplified PCR products TOPO TA Cloning Version R 8 April 2004 25-0184 TOPO TA Cloning Five-minute cloning of Taq polymerase-amplified PCR products Catalog nos. K4500-01, K4500-40, K4510-20, K4520-01, K4520-40, K4550-01, K4550-40,

More information

The making of The Genoma Music

The making of The Genoma Music 242 Summary Key words Resumen Palabras clave The making of The Genoma Music Aurora Sánchez Sousa 1, Fernando Baquero 1 and Cesar Nombela 2 1 Department of Microbiology, Ramón y Cajal Hospital, and 2 Department

More information

Chapter 9. Applications of probability. 9.1 The genetic code

Chapter 9. Applications of probability. 9.1 The genetic code Chapter 9 Applications of probability In this chapter we use the tools of elementary probability to investigate problems of several kinds. First, we study the language of life by focusing on the universal

More information

Module 6: Digital DNA

Module 6: Digital DNA Module 6: Digital DNA Representation and processing of digital information in the form of DNA is essential to life in all organisms, no matter how large or tiny. Computing tools and computational thinking

More information

Heraeus Sepatech, Kendro Laboratory Products GmbH, Berlin. Becton Dickinson,Heidelberg. Biozym, Hessisch Oldendorf. Eppendorf, Hamburg

Heraeus Sepatech, Kendro Laboratory Products GmbH, Berlin. Becton Dickinson,Heidelberg. Biozym, Hessisch Oldendorf. Eppendorf, Hamburg 13 4. MATERIALS 4.1 Laboratory apparatus Biofuge A Centrifuge 5804R FACScan Gel electrophoresis chamber GPR Centrifuge Heraeus CO-AUTO-ZERO Light Cycler Microscope Motopipet Neubauer Cell Chamber PCR cycler

More information

N-terminal Regulatory Domains of Phosphodiesterases 1, 4, 5 and 10 examined with an Adenylyl Cyclase as a Reporter

N-terminal Regulatory Domains of Phosphodiesterases 1, 4, 5 and 10 examined with an Adenylyl Cyclase as a Reporter N-terminal Regulatory Domains of Phosphodiesterases 1, 4, 5 and 10 examined with an Adenylyl Cyclase as a Reporter Dissertation der Mathematisch-Naturwissenschaftlichen Fakultät der Eberhard Karls Universität

More information

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR Page 1 of 5 Materials DNase digestion buffer [13 mm Tris-Cl, ph7,5 / 5 mm MgCl2 / 0,12 mm CaCl2] RSS plasmid ptr-uf11 SV40pA Forward primer (10µM) AGC AAT AGC ATC ACA AAT TTC ACA A SV40pA Reverse Primer

More information

DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108

DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 THE INTERLEUKIN-10 FAMILY CYTOKINES GENE POLYMORPHISMS IN PLAQUE PSORIASIS KÜLLI KINGO TARTU

More information

The DNA-"Wave Biocomputer"

The DNA-Wave Biocomputer The DNA-"Wave Biocomputer" Peter P. Gariaev (Pjotr Garjajev)*, Boris I. Birshtein*, Alexander M. Iarochenko*, Peter J. Marcer**, George G. Tertishny*, Katherine A. Leonova*, Uwe Kaempf ***. * Institute

More information

All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI_ NotI

All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI_ NotI 2. Primer Design 2.1 Multiple Cloning Sites All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI NotI XXX XXX GGA TCC CCG AAT

More information

Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.)

Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.) Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.) J. Paz-Ares, F. Ponz, P. Rodríguez-Palenzuela, A. Lázaro, C. Hernández-Lucas,

More information

Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype

Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype Iori Sakakibara 1,2,3, Marc Santolini 4, Arnaud Ferry 2,5, Vincent Hakim 4, Pascal Maire 1,2,3 * 1 INSERM U1016,

More information

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 For life science research only. Not for use in diagnostic procedures. Copyright 2011 Roche NimbleGen, Inc. All Rights Reserved. Editions Version

More information

Drosophila NK-homeobox genes

Drosophila NK-homeobox genes Proc. Natl. Acad. Sci. USA Vol. 86, pp. 7716-7720, October 1989 Biochemistry Drosophila NK-homeobox genes (NK-1, NK-2,, and DNA clones/chromosome locations of genes) YONGSOK KIM AND MARSHALL NIRENBERG

More information

BD BaculoGold Baculovirus Expression System Innovative Solutions for Proteomics

BD BaculoGold Baculovirus Expression System Innovative Solutions for Proteomics BD BaculoGold Baculovirus Expression System Innovative Solutions for Proteomics Table of Contents Innovative Solutions for Proteomics...........................................................................

More information

Chapter 5. Stripping Bacillus: ComK auto-stimulation is responsible for the bistable response in competence development

Chapter 5. Stripping Bacillus: ComK auto-stimulation is responsible for the bistable response in competence development Stripping Bacillus: ComK auto-stimulation is responsible for the bistable response in competence development This chapter has been adapted from: W.K. Smits*, C.C. Eschevins*, K.A. Susanna, S. Bron, O.P.

More information

Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR. Protocol

Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR. Protocol Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR Protocol 31 January 2011 Joint Research Centre Institute for Health and Consumer Protection Molecular Biology and Genomics

More information

Insulin Receptor Gene Mutations in Iranian Patients with Type II Diabetes Mellitus

Insulin Receptor Gene Mutations in Iranian Patients with Type II Diabetes Mellitus Iranian Biomedical Journal 13 (3): 161-168 (July 2009) Insulin Receptor Gene Mutations in Iranian Patients with Type II Diabetes Mellitus Bahram Kazemi 1*, Negar Seyed 1, Elham Moslemi 2, Mojgan Bandehpour

More information

Molecular detection of Babesia rossi and Hepatozoon sp. in African wild dogs (Lycaon pictus) in South Africa

Molecular detection of Babesia rossi and Hepatozoon sp. in African wild dogs (Lycaon pictus) in South Africa Available online at www.sciencedirect.com Veterinary Parasitology 157 (2008) 123 127 Short communication Molecular detection of Babesia rossi and Hepatozoon sp. in African wild dogs (Lycaon pictus) in

More information

Biopython Tutorial and Cookbook

Biopython Tutorial and Cookbook Biopython Tutorial and Cookbook Jeff Chang, Brad Chapman, Iddo Friedberg, Thomas Hamelryck, Michiel de Hoon, Peter Cock Last Update September 2008 Contents 1 Introduction 5 1.1 What is Biopython?.........................................

More information

Metabolic Engineering of Escherichia coli for Enhanced Production of Succinic Acid, Based on Genome Comparison and In Silico Gene Knockout Simulation

Metabolic Engineering of Escherichia coli for Enhanced Production of Succinic Acid, Based on Genome Comparison and In Silico Gene Knockout Simulation APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Dec. 2005, p. 7880 7887 Vol. 71, No. 12 0099-2240/05/$08.00 0 doi:10.1128/aem.71.12.7880 7887.2005 Copyright 2005, American Society for Microbiology. All Rights

More information

were demonstrated to be, respectively, the catalytic and regulatory subunits of protein phosphatase 2A (PP2A) (29).

were demonstrated to be, respectively, the catalytic and regulatory subunits of protein phosphatase 2A (PP2A) (29). JOURNAL OF VIROLOGY, Feb. 1992, p. 886-893 0022-538X/92/020886-08$02.00/0 Copyright C) 1992, American Society for Microbiology Vol. 66, No. 2 The Third Subunit of Protein Phosphatase 2A (PP2A), a 55- Kilodalton

More information

How To Clone Into Pcdna 3.1/V5-His

How To Clone Into Pcdna 3.1/V5-His pcdna 3.1/V5-His A, B, and C Catalog no. V810-20 Rev. date: 09 November 2010 Manual part no. 28-0141 MAN0000645 User Manual ii Contents Contents and Storage... iv Methods... 1 Cloning into pcdna 3.1/V5-His

More information

Association of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer risk

Association of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer risk DOI 10.1007/s10552-009-9438-4 ORIGINAL PAPER Association of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer risk Elisabeth Feik Æ Andreas Baierl Æ Barbara Hieger Æ Gerhard Führlinger

More information

Chlamydomonas adapted Green Fluorescent Protein (CrGFP)

Chlamydomonas adapted Green Fluorescent Protein (CrGFP) Chlamydomonas adapted Green Fluorescent Protein (CrGFP) Plasmid pfcrgfp for fusion proteins Sequence of the CrGFP In the sequence below, all amino acids which have been altered from the wildtype GFP from

More information

Impaired insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer s disease is this type 3 diabetes?

Impaired insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer s disease is this type 3 diabetes? Journal of Alzheimer s Disease 7 (2005) 63 80 63 IOS Press Impaired insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer s disease is this type 3 diabetes? Eric Steen,

More information

Archimer http://archimer.ifremer.fr

Archimer http://archimer.ifremer.fr Please note that this is an author-produced PDF of an article accepted for publication following peer review. The definitive publisher-authenticated version is available on the publisher Web site Fish

More information

The Arabinosyltransferase EmbC Is Inhibited by Ethambutol in Mycobacterium tuberculosis

The Arabinosyltransferase EmbC Is Inhibited by Ethambutol in Mycobacterium tuberculosis ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Oct. 2009, p. 4138 4146 Vol. 53, No. 10 0066-4804/09/$08.00 0 doi:10.1128/aac.00162-09 Copyright 2009, American Society for Microbiology. All Rights Reserved. The

More information

Interleukin-4 Receptor Signal Transduction: Involvement of P62

Interleukin-4 Receptor Signal Transduction: Involvement of P62 Interleukin-4 Receptor Signal Transduction: Involvement of P62 Den Naturwissenschaftlichen Fakultäten der Friedrich Alexander Universität Erlangen Nürnberg zur Erlangung des Doktorgrades vorgelegt von

More information

TA Cloning Kit. Version V 7 April 2004 25-0024. Catalog nos. K2000-01, K2000-40, K2020-20, K2020-40, K2030-01 K2030-40, K2040-01, K2040-40

TA Cloning Kit. Version V 7 April 2004 25-0024. Catalog nos. K2000-01, K2000-40, K2020-20, K2020-40, K2030-01 K2030-40, K2040-01, K2040-40 TA Cloning Kit Version V 7 April 2004 25-0024 TA Cloning Kit Catalog nos. K2000-01, K2000-40, K2020-20, K2020-40, K2030-01 K2030-40, K2040-01, K2040-40 ii Table of Contents Table of Contents...iii Important

More information

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

http://hdl.handle.net/10197/2727

http://hdl.handle.net/10197/2727 Provided by the author(s) and University College Dublin Library in accordance with publisher policies. Please cite the published version when available. Title Performance of DNA data embedding algorithms

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

9. Materials. 9.1 Chemicals Acetic Acid (glacial) Materials. 8-Aminoguanosine Ammonium Hydroxide Ammonium Persulfate.

9. Materials. 9.1 Chemicals Acetic Acid (glacial) Materials. 8-Aminoguanosine Ammonium Hydroxide Ammonium Persulfate. 9. Materials 9.1 Chemicals Acetic Acid (glacial) Acetone Acetonitrile Agarose 8-Aminoguanosine Ammonium Hydroxide Ammonium Persulfate Ampicillin ATP Bromophenol Blue Butanol Chloroform CTP 7-Deaza-GTP

More information

Introduction to Bioinformatics (Master ChemoInformatique)

Introduction to Bioinformatics (Master ChemoInformatique) Introduction to Bioinformatics (Master ChemoInformatique) Roland Stote Institut de Génétique et de Biologie Moléculaire et Cellulaire Biocomputing Group 03.90.244.730 rstote@igbmc.fr Biological Function

More information

inhibition of mitosis

inhibition of mitosis The EMBO Journal vol.13 no.2 pp.425-434, 1994 cdt 1 is an essential target of the Cdc 1 O/Sct 1 transcription factor: requirement for DNA replication and inhibition of mitosis Johannes F.X.Hofmann and

More information

DNA Sequencing of the eta Gene Coding for Staphylococcal Exfoliative Toxin Serotype A

DNA Sequencing of the eta Gene Coding for Staphylococcal Exfoliative Toxin Serotype A Journal of General Microbiology (1988), 134, 71 1-71 7. Printed in Great Britain 71 1 DNA Sequencing of the eta Gene Coding for Staphylococcal Exfoliative Toxin Serotype A By SUSUMU SAKURA, HTOSH SUZUK

More information

Distribution of the DNA transposon family, Pokey in the Daphnia pulex species complex

Distribution of the DNA transposon family, Pokey in the Daphnia pulex species complex Eagle and Crease Mobile DNA (2016) 7:11 DOI 10.1186/s13100-016-0067-7 RESEARCH Open Access Distribution of the DNA transposon family, Pokey in the Daphnia pulex species complex Shannon H. C. Eagle and

More information

pentr Directional TOPO Cloning Kits

pentr Directional TOPO Cloning Kits user guide pentr Directional TOPO Cloning Kits Five-minute, directional TOPO Cloning of blunt-end PCR products into an entry vector for the Gateway System Catalog numbers K2400-20, K2420-20, K2525-20,

More information

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)

More information

On Covert Data Communication Channels Employing DNA Recombinant and Mutagenesis-based Steganographic Techniques

On Covert Data Communication Channels Employing DNA Recombinant and Mutagenesis-based Steganographic Techniques On Covert Data Communication Channels Employing DNA Recombinant and Mutagenesis-based Steganographic Techniques MAGDY SAEB 1, EMAN EL-ABD 2, MOHAMED E. EL-ZANATY 1 1. School of Engineering, Computer Department,

More information

Open Access CASE STUDY

Open Access CASE STUDY DOI 1.1186/s6-15-136-8 CASE STUDY Open Access Production of thyrotropin receptor antibodies in acute phase of infectious mononucleosis due to Epstein Barr virus primary infection: a case report of a child

More information

2 Materials and Methods

2 Materials and Methods 2 Materials and Methods 2.1 Materials 2.1.1 Chemicals, reagents and consumable materials Chemicals were used from the companies Sigma (München), Roth (Karlsruhe), Merck (Darmstadt), Fluka (Neu-Ulm), Serva

More information

BioTOP-Report. Biotech and Pharma in Berlin-Brandenburg

BioTOP-Report. Biotech and Pharma in Berlin-Brandenburg BioTOP-Report 2013 Biotech and Pharma in Berlin-Brandenburg BioTOP-Report Content Editorial Unique Chances to Create Value in Biotechnology and Life Sciences 3 Biotechnology More Companies, More Employees

More information

4 th DVFA Life Science Conference. Going East / Going West. Life Science Asia/Europe getting insight in mutual growth opportunities

4 th DVFA Life Science Conference. Going East / Going West. Life Science Asia/Europe getting insight in mutual growth opportunities 4 th DVFA Life Science Conference Going East / Going West Life Science Asia/Europe getting insight in mutual growth opportunities 4 th DVFA Symposium Life Science followed by a Get Together 17 May 2011,

More information

BioTOP-Report. Biotech and Pharma in Berlin-Brandenburg

BioTOP-Report. Biotech and Pharma in Berlin-Brandenburg BioTOP-Report 2014 Biotech and Pharma in Berlin-Brandenburg BioTOP-Report 2014 Content Editorial The German Capital Region Biotechnology and Life Sciences are Ready for the Future 3 Biotechnology The Capital

More information

Taqman TCID50 for AAV Vector Infectious Titer Determination

Taqman TCID50 for AAV Vector Infectious Titer Determination Page 1 of 8 Purpose: To determine the concentration of infectious particles in an AAV vector sample. This process involves serial dilution of the vector in a TCID50 format and endpoint determination through

More information

TP53 Genotype but Not p53 Immunohistochemical Result Predicts Response to Preoperative Short-Term Radiotherapy in Rectal Cancer

TP53 Genotype but Not p53 Immunohistochemical Result Predicts Response to Preoperative Short-Term Radiotherapy in Rectal Cancer ORIGINAL ARTICLES ANNALS OF SURGERY Vol. 235, No. 4, 493 498 2002 Lippincott Williams & Wilkins, Inc. TP53 Genotype but Not p53 Immunohistochemical Result Predicts Response to Preoperative Short-Term Radiotherapy

More information

Mutation of the SPSl-encoded protein kinase of Saccharomyces cerevisiae leads to defects in transcription and morphology during spore formation

Mutation of the SPSl-encoded protein kinase of Saccharomyces cerevisiae leads to defects in transcription and morphology during spore formation Mutation of the SPSl-encoded protein kinase of Saccharomyces cerevisiae leads to defects in transcription and morphology during spore formation Helena Friesen/ Rayna Lunz/* Steven Doyle,^ and Jacqueline

More information

III III 0 IIOI DID IIO 1101 010 II0 1101 I IIII

III III 0 IIOI DID IIO 1101 010 II0 1101 I IIII (19) United States III III 0 IIOI DID IIO 1101 010 II0 1101 I IIII US 20020090376A1 III 1010 II 0I II (12) Patent Application Publication (lo) Pub. No.: US 2002/0090376 Al KANIGA et at. (43) Pub. Date:

More information

Complete Amino Acid Sequence and in vitro Expression of Rat NF-M, The Middle Molecular Weight Neurofilament Protein

Complete Amino Acid Sequence and in vitro Expression of Rat NF-M, The Middle Molecular Weight Neurofilament Protein The Journal of Neuroscience, August 1987, 7(8): 2590-2599 Complete Amino Acid Sequence and in vitro Expression of Rat NF-M, The Middle Molecular Weight Neurofilament Protein Eugene W. Napolitano, Steven

More information

APOT - Assay. Protocol for HPV16 and 18. Amplification of Papilloma Virus Oncogene Transcripts HPV. E6 E7 E1 Zelluläre DNA poly(a)

APOT - Assay. Protocol for HPV16 and 18. Amplification of Papilloma Virus Oncogene Transcripts HPV. E6 E7 E1 Zelluläre DNA poly(a) E5 E2 E1 APOT - Assay Amplification of Papilloma Virus Oncogene Transcripts URR E6 E7 L1 HPV L2 E4 E6 E7 E1 Zelluläre DNA poly(a) Protocol for HPV16 and 18 Brief summary of the APOT assay Fig.1A shows

More information

The nucleotide sequence of the gene for human protein C

The nucleotide sequence of the gene for human protein C Proc. Natl. Acad. Sci. USA Vol. 82, pp. 4673-4677, July 1985 Biochemistry The nucleotide sequence of the gene for human protein C (DNA sequence analysis/vitamin K-dependent proteins/blood coagulation)

More information

Anhang A: Primerliste. 1. Primer für RT-PCR-Analyse. 2. Allgemeine Klonierungsprimer

Anhang A: Primerliste. 1. Primer für RT-PCR-Analyse. 2. Allgemeine Klonierungsprimer Anhang A: Primerliste 1. Primer für RT-PCR-Analyse Primername Primersequenz (5 3 ) Temperatur Zyklenzahl Kin7-f01 gat aat cac ggg tgc tgg 56 C 25 Kin7-r01 gtt gat caa ctg tct acc 56 C 25 MPK4-f01 cgg aga

More information

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated

More information

PROTOCOL: Illumina Paired-end Whole Exome Capture Library Preparation Using Full-length Index Adaptors and KAPA DNA Polymerase

PROTOCOL: Illumina Paired-end Whole Exome Capture Library Preparation Using Full-length Index Adaptors and KAPA DNA Polymerase PROTOCOL: Illumina Paired-end Whole Exome Capture Library Preparation Using Full-length Index Adaptors and KAPA DNA Polymerase This protocol provides instructions for preparing DNA paired-end capture libraries

More information

Insect cells as an engineering and production platform for antibodies and antibody derived products

Insect cells as an engineering and production platform for antibodies and antibody derived products University of Natural Ressources and Life Sciences Institute of Applied Microbiology Insect cells as an engineering and production platform for antibodies and antibody derived products Doctoral thesis

More information

Immortalized epithelial cells from human autosomal dominant polycystic kidney cysts

Immortalized epithelial cells from human autosomal dominant polycystic kidney cysts Am J Physiol Renal Physiol 285: F397 F412, 2003. First published May 6, 2003; 10.1152/ajprenal.00310.2002. Immortalized epithelial cells from human autosomal dominant polycystic kidney cysts Mahmoud Loghman-Adham,

More information

Differentiation of Klebsiella pneumoniae and K. oxytoca by Multiplex Polymerase Chain Reaction

Differentiation of Klebsiella pneumoniae and K. oxytoca by Multiplex Polymerase Chain Reaction Differentiation of Klebsiella pneumoniae and K. oxytoca by Multiplex Polymerase Chain Reaction Yogesh Chander 1 M. A. Ramakrishnan 1 Naresh Jindal 1 Kevan Hanson 2 Sagar M. Goyal 1 1 Department of Veterinary

More information

Directed-Mutagenesis and Deletion Generated through an Improved Overlapping-Extension PCR Based Procedure

Directed-Mutagenesis and Deletion Generated through an Improved Overlapping-Extension PCR Based Procedure Research Article Directed-Mutagenesis and Deletion Generated through an Improved Overlapping-Extension PCR Based Procedure Wirojne Kanoksilapatham 1*, Juan M. González 2 and Frank T. Robb 3 1 Department

More information

Copper Acquisition Is Mediated by YcnJ and Regulated by YcnK and CsoR in Bacillus subtilis

Copper Acquisition Is Mediated by YcnJ and Regulated by YcnK and CsoR in Bacillus subtilis JOURNAL OF BACTERIOLOGY, Apr. 2009, p. 2362 2370 Vol. 191, No. 7 0021-9193/09/$08.00 0 doi:10.1128/jb.01616-08 Copyright 2009, American Society for Microbiology. All Rights Reserved. Copper Acquisition

More information

MultiSite Gateway Pro

MultiSite Gateway Pro MultiSite Gateway Pro Using Gateway Technology to simultaneously clone multiple DNA fragments Catalog nos. 12537-102, 12537-103, 12537-104, 12537-100 Version B 3 October 2006 25-0942 Design your MultiSite

More information

Irina V Nesterova, Cecily A. Bennett, S. Sibel Erdem, Robert P. Hammer, Prescott L. Deininger, and Steven A. Soper

Irina V Nesterova, Cecily A. Bennett, S. Sibel Erdem, Robert P. Hammer, Prescott L. Deininger, and Steven A. Soper ear-ir Single Fluorophore Quenching System Based on Phthalocyanine (Pc) Aggregation and its Application for Monitoring Inhibitor/Activator Action on a Therapeutic Target: L1-E Irina V esterova, Cecily

More information

Identification and Characterization of Genes with Specific Expression in Dendritic Cells

Identification and Characterization of Genes with Specific Expression in Dendritic Cells Identification and Characterization of Genes with Specific Expression in Dendritic Cells Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften (Dr. rer. Nat.) der Naturwissenschaften Fakultät

More information

Protein Synthesis Simulation

Protein Synthesis Simulation Protein Synthesis Simulation Name(s) Date Period Benchmark: SC.912.L.16.5 as AA: Explain the basic processes of transcription and translation, and how they result in the expression of genes. (Assessed

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 2007 69451 Weinheim, Germany Evolving a Thermostable DNA polymerase that Accurately Amplifies Highly-Damaged Templates Christian Gloeckner, Katharina B. M. Sauter, and

More information

Cloning and intracellular localization of the U2 small nuclear

Cloning and intracellular localization of the U2 small nuclear Proc. Nadl. Acad. Sci. USA Vol. 89, pp. 8769-8773, September 1992 Biochemistry Cloning and intracellular localization of the U2 small nuclear ribonucleoprotein auxiliary factor small subunit (spllcing/spliceosome/rna

More information

Functional analysis of the murine. cytomegalovirus genes m142 and m143

Functional analysis of the murine. cytomegalovirus genes m142 and m143 Functional analysis of the murine cytomegalovirus genes m142 and m143 Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt

More information