SUPPLEMENTAL MATERIAL

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "SUPPLEMENTAL MATERIAL"

Transcription

1 SUPPLEMENTAL MATERIAL SUPPLEMENTAL METHODS Measurement of mrna expression levels by quantitative RT-PCR. Following primer sequences were used for real-time PCR: The primer sequences were as followed: TNF-α (forward, 5'-ACG GCA TGG ATC TCA AAG AC-3', reverse, 5'-AGA TAG CAA ATC GGC TGA CG-3'); CXCL10 (forward, 5'-CCA AGT GCT GCC GTC ATT TTC-3', reverse, 5'-GGC TCG CAG GGA TGA TTT CAA-3'); CYBB (forward, 5'-TTG GGT CAG CAC TGG CTC TG-3', reverse, 5'-TGG CGG TGT GCA GTG CTA TC-3'); CCL5 (forward, 5'-GCT GCT TTG CCT ACC TCT CC-3', reverse, 5'-TCG AGT GAC AAA CAC GAC TGC-3'); EMR1 (forward, 5'-CTG GGA TCC TAC AGC TGC TC-3', reverse, 5'- AGG AGC CTG GTA CAT TGG TG-3'); ITGAX (forward, 5'-CTG GAT AGC CTT TCT TCT GCT G-3', reverse, 5'-GCA CAC TGT GTC CGA ACT CA-3'); β-catenin (forward, 5'-CCG TTC GCC TTC ATT ATG GA-3', reverse, 5'-GGC AAG GTT TCG AAT CAA TCC-3'); PGC1α (forward, 5'-TCG ATG TGT CGC CTT CTT GC-3', reverse, 5'-ACG AGA GCG CAT CCT TTG G-3'); Adiponectin (forward, 5'-AGG AGC TGA AGG GCC ACG GG-3', reverse, 5'-TGG GAA CAG TGA CGC GGG TC-3'); Leptin (forward, 5'-GGG AGC ACC GTG AAG GCT GC-3', reverse, 5'-CCT GGC TGA CCC CCA AAG CC-3'); PAI-1 (forward, 5'-AGG GCT TCA TGC CCC ACT TCT TCA-3', reverse, 5'- AGTA GAG GGC ATT CAC CAG CAC CA-3'); FAS (forward, 5'-CCT GGA TAG CAT TCC GAA CCT-3', reverse, 5'-GCA CAT CTC GAA GGC TAC ACA-3'); LPL (forward, 5'-GCC GCG TAG TTC CAG CAG CA-3', reverse, 5'-CCC TCC TCG GAA GGC GGT CA-3'); ATGL (forward, 5'-CTC ATT CGC TGG CTG CGG CT-3', reverse, 5'-CCC CAG TGA CCA GCG CTG TG-3'); HSL (forward, 5'- TGG GGA GCT CCA GTC GGA AGA GG-3', reverse, 5'-CAT TAG ACA GCC GCC GTG CTG-3'); MCAD (forward, 5'-CAA CAC TCG AAA GCG GCT CA-3', reverse, 5'-ACT TGC GGG CAG TTG CTT G-3'); CPT1α (forward, 5'-ACC ACT GGC CGC ATG TCA AG-3', reverse, 5'-AGC GAG TAG CGC ATA GTC AT-3'); c-myc (forward, 5'-GCC CCC AAG GTA GTG ATC CT-3', reverse, 5'-GTG CTC GTC TGC TTG AAT GG-3'); CyclinD1 (forward, 5'-TGC CAT CCA TGC GGA AA-3', reverse, 5'-AGC GGG AAG AAC TCC TCT TC-3'); Axin2 (forward, 5'-TGA CTC TCC TTC CAG ATC

2 CCA-3', reverse, 5'-TGC CCA CAC TAG GCT GAC A-3'); MMP7 (forward, 5'-CTG CCA CTG TCC CAG GAA G-3', reverse, 5'-GGG AGA GTT TTC CAG TCA TGG-3'); NRX (forward, 5'-TTG CTT AGA AAT AAC GGG CAG T-3', reverse, 5'-CCA GCA CTC TGG TAA GGC TT-3'); FABP4 (forward, 5'-TGA GAT GGC CTC AGC TAT CTG-3', reverse, 5'-TGC CCG ATG TGT AGA TGT AGA A-3'); Col1a1 (forward, 5 -GTG CTC CTG GTA TTG CTG GT-3, reverse, 5 -GGC TCC TCG TTT TCC TTC TT-3 ); Col3a1 (forward, 5 -GGG TTT CCC TGG TCC TAA AG-3, reverse, 5 -CCT GGT TTC CCA TTT TCT CC-3 ); Col6a1 (forward, 5 -GAT GAG GGT GAA GTG GGA GA-3, reverse, 5 -CAG CAC GAA GAG GAT GTC AA-3 ); Elastin (forward, 5 -TGG TAT TGG TGG CAT CGG-3 ; reverse, 5 -CCT TGG CTT TGA CTC CTG TG-3 ); Dvl-1 (forward, 5 -ATG AGG AGG ACA ATA CGA GCC-3, reverse, 5 -GCA TTT GTG CTT CCG AAC TAG C-3 ); Dvl-2 (forward, 5 -GGT GTA GGC GAG ACG AAG G-3, reverse, 5 -GCT GCA AAA CGC TCT TGA AAT C-3 ); Dvl-3 (forward, 5 -GTC ACC TTG GCG GAC TTT AAG-3, reverse, 5 -AAG CAG GGT AGC TTG GCA TTG-3 ); β-actin (forward, 5'-TGC CGA CAG GAT GCA GAA G-3', reverse, 5'-CTC AGG AGG AGC AAT GAT CTT GA-3'); 36B4 (forward, 5'-AGA TTC GGG ATA TGC TGT-3', reverse, 5'- AAA GCC TGG AAG AAG GAG-3'). Transfection of sirna. Two days after reaching confluence, 3T3-L1 cells were cultured in a serumfree medium for 1 h and transfected with 120 nm of the target gene or control sirna using the Lipofectamine RNAi MAX transfection reagent. After 6 h, the transfected cells were differentiated according to the differentiation protocol. After 4 days, total RNA was prepared and analyzed by quantitative RT-PCR. Following sirna oligonucleotide sequences were used: #1 Dvl-1, 5 - AGAAGCAGCAUUUACACAG(dTdT)-3 ; #2 Dvl-1, 5 -AUGUCAAGCCAAUAUCCUG(dTdT)-3 ; #1 Dvl-2, 5 -AUGGUAAAUCACCUUCGUC(dTdT)-3 ; #2 Dvl-2, 5 -UACUCAUGGUGUCAUCC UC(dTdT)-3 ; #1 Dvl-3, 5 -UCGUGAAGCGAUAGGUUGG(dTdT)-3 ; #2 Dvl-3, 5 -ACCACCU GACUUGGAGUCC(dTdT)-3. Stealth RNAi negative control duplexes (scrambled sirna, Invitrogen) were used as controls for sequence-independent effects. Tissue insulin signaling. Animal were fasted for 6 h and recombinant insulin (10 U/kg) was injected

3 intraperitoneally. Mice were sacrificed 5 min post stimulation. Tissues, i.e., liver, skeletal muscle, and epididymal adipose tissues were quickly dissected and snap-frozen in liquid nitrogen. Tissues were homogenized in RIPA buffer containing both protease inhibitors and phosphatase inhibitors and activation of AKT by insulin was analyzed by immunoblotting. SUPPLEMENTARY TABLE Supplementary Table 1: Metabolic parameters in plasma of 6-month-old WT and Adipo-NRX mice. Data are presented as means ± SD (n = 4 per group). *P < 0.05 versus control Parameter WT Adipo-NRX GOT (IU/L) 114.3± ±16.5 GPT (IU/L) 67.6± ±32.2 Cholesterol (mg/dl) 174.6± ±26.4 BUN (mg/dl) 20.7± ±2.6 Creatinine (mg/dl) 0.3± ±0.06 Glucose (mg/dl) 185.4± ±44.7 * Triglycerides (mg/dl) 72± ±12.1 HDL (mg/dl) 101± ±24.5 LDL (mg/dl) 44.3± ±13.5 Insulin (ng/dl) 0.9± ±0.2 *

4 SUPPLEMENTARY FIGURE LEGENDS Supplementary Fig. 1. Generation of Tg mice and analysis of NRX protein levels in several tissues isolated from Adipo-NRX and WT mice. (A) Structural illustration of construct for generating LSL-NRX transgenic mice. The loxp-stop-loxp ligated NRX cdna was inserted into EcoRI site of the pcaggs expression vector (Addgene), therefrom SalI-BamHI fragment was isolated and used for microinjection to Mouse Zygote. (B) Adipo-NRX mice were generated by crossing LSL-NRX mice with Adiponectin-Cre mice. NRX protein in tissues isolated from Adipo- NRX and WT mice was analyzed by Western blotting. Ponceu S-stained NC membrane was used as a loading control. (C) Expression levels of adiponectin were analyzed using real-time quantitative RT- PCR at the indicated days of differentiation of primary adipocytes. (D) Expression levels of NRX were analyzed using real-time quantitative RT-PCR at the indicated days of differentiation of primary adipocytes isolated from WT and Adipo-NRX mice. Supplementary Fig. 2. Histological analysis of liver and skeletal muscle. Hematoxylin and eosin staining (upper panels, X100 magnification) or Oil red O staining (lower panels, X200 magnification) in liver and TA (Tibialis anterior) muscle section in 6-month old WT and Adipo-NRX mice. Supplementary Fig. 3. Lipid accumulation of 3T3-L1 cells transfected with Dvl-1, Dvl-2, or Dvl- 3 sirna. (A) After transfection with Dvl-1, 2 or 3 sirna each into 3T3-L1 cells, relative mrna levels of Dvl-1, 2 or 3 were analyzed using real-time quantitative RT-PCR compared to control sirna transfected cells. Data are presented as mean ± SD. (B) Representative images of lipid accumulation of control or Dvl-1, 2 or 3-knockdown cells were taken by Oil red O staining at 8 day post adipogenic differentiation.

5 A C SalI EcoRI EcoRI BamHI B D 730 DM(days) Adiponectin-Cre NRX Loading control Supplementary Figure 1

6 Liver Sk. muscle WT Adipo-NRX WT Adipo-NRX H&E (X100) Oil Red O (X200) Supplementary Figure 2

7 A Relative Dvl-1 expression Relative Dvl-2 expression Relative Dvl-3 expression Dvl-1 Dvl-2 Dvl-3 Dvl-1 Dvl-2 Dvl-3 Dvl-1 Dvl-2 Dvl-3 B Dvl-1 Dvl-2 Dvl-3 Supplementary Figure 3

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration

More information

HP22.1 Roth Random Primer Kit A für die RAPD-PCR

HP22.1 Roth Random Primer Kit A für die RAPD-PCR HP22.1 Roth Random Kit A für die RAPD-PCR Kit besteht aus 20 Einzelprimern, jeweils aufgeteilt auf 2 Reaktionsgefäße zu je 1,0 OD Achtung: Angaben beziehen sich jeweils auf ein Reaktionsgefäß! Sequenz

More information

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors.

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. Legends of supplemental figures and tables Figure 1: Overview of study design and results. (A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. After raw data gene expression

More information

To measure the expression and regulation of the srfa and myc operons, lacz-reporter gene

To measure the expression and regulation of the srfa and myc operons, lacz-reporter gene SUPPLEMENTAL MATERIAL 1 1 1 1 1 0 1 Construction of reporter gene fusions To measure the expression and regulation of the srfa and myc operons, lacz-reporter gene fusions were made. For this the plasmid

More information

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C) TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain

More information

DNA and Protein Synthesis Grade 10

DNA and Protein Synthesis Grade 10 Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 5 Illustrate the relationship of the structure and function of DNA to protein

More information

Table S1. Related to Figure 4

Table S1. Related to Figure 4 Table S1. Related to Figure 4 Final Diagnosis Age PMD Control Control 61 15 Control 67 6 Control 68 10 Control 49 15 AR-PD PD 62 15 PD 65 4 PD 52 18 PD 68 10 AR-PD cingulate cortex used for immunoblot

More information

TA PCR Cloning Kit. Product Name:

TA PCR Cloning Kit. Product Name: Product Name: Kit Component DynaExpress TA PCR Cloning Kit (ptac-2) Cat. # Product Size DS126 DynaExpress TA PCR Cloning Kit (ptac-2) 20 reactions Box 1 (-20 ) ptac-2 Vector, linearized 20 µl (50 ng/µl)

More information

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21,

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, 2008 7 2 Introduction to Molecular Biology We will start with a very short repetition of the basics of molecular biology, including a summary of

More information

DNA Sample preparation and Submission Guidelines

DNA Sample preparation and Submission Guidelines DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene Supplementary Online Material for Morris et al. sirna-induced transcriptional gene silencing in human cells. Materials and Methods Lentiviral vector and sirnas. FIV vector pve-gfpwp was prepared as described

More information

Beloit College BIOL Emerging Infectious Diseases

Beloit College BIOL Emerging Infectious Diseases Virus classification and life cycle activity For reference Transcription: Krasner p 131 Translation: Krasner p 132-135 Genetic code: Krasner p 135 A virus is an obligate intracellular parasite, meaning

More information

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.

More information

FDC-Specific Functions of p55tnfr and IKK2

FDC-Specific Functions of p55tnfr and IKK2 Supplemental Data FDC-Specific Functions of p55tnfr and IKK2 in the Development of FDC Networks and of Antibody Responses Panayiotis Victoratos, Jacques Lagnel, Sotiria Tzima, Marat B. Alimzhanov, Klaus

More information

Mutations and Genetic Variability. 1. What is occurring in the diagram below?

Mutations and Genetic Variability. 1. What is occurring in the diagram below? Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.

More information

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1 Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation Beginning Perl, Chap 4 6 Example 1 #!/usr/bin/perl -w use strict; # version 1: my @nt = ('A', 'C', 'G', 'T'); for

More information

The p53 MUTATION HANDBOOK

The p53 MUTATION HANDBOOK The p MUTATION HANDBOOK Version 1. /7 Thierry Soussi Christophe Béroud, Dalil Hamroun Jean Michel Rubio Nevado http://p/free.fr The p Mutation HandBook By T Soussi, J.M. Rubio-Nevado, D. Hamroun and C.

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing 38. Informationsgespräch der Blutspendezentralefür Wien, Niederösterreich und Burgenland Österreichisches Rotes Kreuz 22. November 2014, Parkhotel Schönbrunn Die Zukunft hat

More information

Laboratory diagnostic of Avian Influenza in the Caribbean

Laboratory diagnostic of Avian Influenza in the Caribbean Laboratory diagnostic of Avian Influenza in the Caribbean CIRAD, Guadeloupe CIRAD International Research Centre in Agricultural for Development Research, development, training Veterinary medicine and public

More information

The effect of trna levels on decoding times of mrna codons Supplementary File

The effect of trna levels on decoding times of mrna codons Supplementary File The effect of trna levels on decoding times of mrna codons Supplementary File Authors: Alexandra Dana 1 and Tamir Tuller 1 *. 1 The Department of Biomedical Engineering, Tel-Aviv University, Tel-Aviv 69978,

More information

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204 Gene Synthesis 191 Mutagenesis 194 Gene Cloning 196 AccuGeneBlock Service 198 Gene Synthesis FAQs 201 User Protocol 204 Gene Synthesis Overview Gene synthesis is the most cost-effective way to enhance

More information

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE 6 AND ATPASE 8 GENES IN DIFFERENT MAMMALIAN SPECIES

MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE 6 AND ATPASE 8 GENES IN DIFFERENT MAMMALIAN SPECIES , pp.-068-075. Available online at http://www.bioinfopublication.org/jouarchive.php?opt=&jouid=bpj0000220 MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE

More information

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human Supplementary Information Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human vascular endothelial growth factor 165 revealed by biosensor based assays Yoichi Takakusagi

More information

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service

More information

Molecular analyses of EGFR: mutation and amplification detection

Molecular analyses of EGFR: mutation and amplification detection Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens Outline presentation

More information

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe Codon usage bias is correlated with gene expression levels Blackwell Y Hiraoka usage Publishing et al. bias in fission Inc yeast in the fission yeast Schizosaccharomyces pombe Yasushi Hiraoka 1,2,3, *,

More information

Supplemental Data. Short Article. PPARγ Activation Primes Human Monocytes. into Alternative M2 Macrophages. with Anti-inflammatory Properties

Supplemental Data. Short Article. PPARγ Activation Primes Human Monocytes. into Alternative M2 Macrophages. with Anti-inflammatory Properties Cell Metabolism, Volume 6 Supplemental Data Short Article PPARγ Activation Primes Human Monocytes into Alternative M2 Macrophages with Anti-inflammatory Properties M. Amine Bouhlel, Bruno Derudas, Elena

More information

pcmv6-neo Vector Application Guide Contents

pcmv6-neo Vector Application Guide Contents pcmv6-neo Vector Application Guide Contents Package Contents and Storage Conditions... 2 Product Description... 2 Introduction... 2 Production and Quality Assurance... 2 Methods... 3 Other required reagents...

More information

Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project

Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Protocol for recovery of sequences flanking insertions in the Drosophila Gene Disruption

More information

Supplementary Figure 1: Postive and negative control cell lines wers used as positive and negative controls for HPV16 (A,B) and HPV18 (C,D) PCR.

Supplementary Figure 1: Postive and negative control cell lines wers used as positive and negative controls for HPV16 (A,B) and HPV18 (C,D) PCR. Supplementary Figure 1: Postive and negative control cell lines wers used as positive and negative controls for HPV16 (A,B) and HPV18 (C,D) PCR. (A) (C) (B) (D) Supplementary Figure 2: Representative image

More information

for Detection of Multiple Pathogens and William C. Reeves 1

for Detection of Multiple Pathogens and William C. Reeves 1 Bioelectronic DNA Detection of Human Papillomaviruses Using esensor : A Model System for Detection of Multiple Pathogens Suzanne D. Vernon 1 (svernon@cdc.gov), Daniel H. Farkas 2* (dfarkas@bcm.tmc.edu),

More information

Blue Heron, Your Gene Synthesis Partner

Blue Heron, Your Gene Synthesis Partner Blue Heron, Your Gene Synthesis Partner You Design it We Build it Simple to Complex Sequences Codon Optimization Any species Variants Single or pooled clone libraries Antibody Affinity Optimization Whole

More information

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations http://members.cox.net/amgough/mutation_chromosome_translocation.gif Introduction: In biology, mutations are changes to the base

More information

ANALYSIS OF A CIRCULAR CODE MODEL

ANALYSIS OF A CIRCULAR CODE MODEL ANALYSIS OF A CIRCULAR CODE MODEL Jérôme Lacan and Chrstan J. Mchel * Laboratore d Informatque de Franche-Comté UNIVERSITE DE FRANCHE-COMTE IUT de Belfort-Montbélard 4 Place Tharradn - BP 747 5 Montbélard

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Journal of Cell and Molecular Research (2011) 3 (1), 1-11 Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Fatemeh Moosavi 1, Hassan Mohabatkar

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Egypt Interpretation of sequence results An overview on

More information

ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA)

ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA) ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA) Zrůstová J., Bílek K., Baránek V., Knoll A. Ústav morfologie, fyziologie a genetiky zvířat, Agronomická

More information

Title : Parallel DNA Synthesis : Two PCR product from one DNA template

Title : Parallel DNA Synthesis : Two PCR product from one DNA template Title : Parallel DNA Synthesis : Two PCR product from one DNA template Bhardwaj Vikash 1 and Sharma Kulbhushan 2 1 Email: vikashbhardwaj@ gmail.com 1 Current address: Government College Sector 14 Gurgaon,

More information

Supporting information

Supporting information This journal is The Royal Society of Chemistry 213 New Platform for Convenient Genotyping System Keum-Soo Song, b Satish Balasaheb Nimse, a Junghoon Kim, b Danishmalik Rafiq Sayyed, a Taisun Kim* a a Institute

More information

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain?

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain? Networked Systems, COMPGZ01, 2012 Answer TWO questions from Part ONE on the answer booklet containing lined writing paper, and answer ALL questions in Part TWO on the multiple-choice question answer sheet.

More information

Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians

Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians Vol. 44 No. 3 SCIENCE IN CHINA (Series C) June 2001 Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians KE Yuehai ( `º) 1, SU Bing (3 Á) 1 3, XIAO Junhua

More information

Analysis of BRCA1 and BRCA2 mutations in Brazilian breast cancer patients with positive family history

Analysis of BRCA1 and BRCA2 mutations in Brazilian breast cancer patients with positive family history ORIGINAL ARTICLE Rozany Mucha Dufloth Sílvia Carvalho Juliana Karina Heinrich Júlia Yoriko Shinzato César Cabello dos Santos Luiz Carlos Zeferino Fernando Schmitt Analysis of BRCA1 and BRCA2 mutations

More information

[ ] : MMP22,MMP29 TIMP21, TIMP22

[ ] : MMP22,MMP29 TIMP21, TIMP22 212 BULL HUNAN MED UNIV 2003,28 (3) MMP22,MMP29,TIMP21 TIMP22,,, (, 410011) [ ] : MMP22,MMP29 TIMP21, TIMP22 mrna : 56 MMP22 mrna, TIMP22 mrna ; MMP22,MMP29, TIMP21, TIMP22 : MMP22 mrna, TIMP22 mrna,mmp22,mmp29,timp21

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer

Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer Archimer http://www.ifremer.fr/docelec/ Archive Institutionnelle de l Ifremer The original publication

More information

DNA pol RNA pol ARS trna Ribosome DNA mrna Protein Transcription Translation Replication A B Acceptor stem D-loop T C loop Anticodon loop Variable loop Relative trna gene copy number 0.0 0.2 0.4

More information

Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala

Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala -'Pablo García-Lugo 1t, Celedonio González l, Germán Perdomo l, Nélida

More information

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 For life science research only. Not for use in diagnostic procedures. Copyright 2011 Roche NimbleGen, Inc. All Rights Reserved. Editions Version

More information

Provisional inspection method of genetically modified flax (FP967)

Provisional inspection method of genetically modified flax (FP967) Provisional inspection method of genetically modified flax (FP967) The inspection target of this inspection method is flax grains. Extraction and purification of DNA is performed using an anion exchange

More information

Clayton B. Green, Xiaomin Zhao, Kathleen M. Yeater and Lois L. Hoyer INTRODUCTION

Clayton B. Green, Xiaomin Zhao, Kathleen M. Yeater and Lois L. Hoyer INTRODUCTION Microbiology (2005), 151, 1051 1060 DOI 10.1099/mic.0.27696-0 Construction and real-time RT-PCR validation of Candida albicans PALS-GFP reporter strains and their use in flow cytometry analysis of ALS

More information

Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype

Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype Iori Sakakibara 1,2,3, Marc Santolini 4, Arnaud Ferry 2,5, Vincent Hakim 4, Pascal Maire 1,2,3 * 1 INSERM U1016,

More information

Impaired insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer s disease is this type 3 diabetes?

Impaired insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer s disease is this type 3 diabetes? Journal of Alzheimer s Disease 7 (2005) 63 80 63 IOS Press Impaired insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer s disease is this type 3 diabetes? Eric Steen,

More information

Molecular chaperones involved in preprotein. targeting to plant organelles

Molecular chaperones involved in preprotein. targeting to plant organelles Molecular chaperones involved in preprotein targeting to plant organelles Dissertation der Fakultät für Biologie der Ludwig-Maximilians-Universität München vorgelegt von Christine Fellerer München 29.

More information

Keywords: human papillomavirus, multiplex real-time PCR, genotyping, hybrid capture, cervical cytology

Keywords: human papillomavirus, multiplex real-time PCR, genotyping, hybrid capture, cervical cytology Establishment of an efficient multiplex real-time PCR assay for human papillomavirus genotyping in cervical cytology specimens: comparison with hybrid capture II J.-H. Lee*, N.-W. Lee, S.-W. Hong, Y.-S.

More information

I Lq A Simplified Procedure for Developing Multiplex PCRs

I Lq A Simplified Procedure for Developing Multiplex PCRs I Lq A Simplified Procedure for Developing Multiplex PCRs Anthony P. Shuber, 1 Valerie J. Grondin, and Katherine W. Klinger Department of Technology Development, Integrated Genetics, Inc., Framingham Massachusetts

More information

Heraeus Sepatech, Kendro Laboratory Products GmbH, Berlin. Becton Dickinson,Heidelberg. Biozym, Hessisch Oldendorf. Eppendorf, Hamburg

Heraeus Sepatech, Kendro Laboratory Products GmbH, Berlin. Becton Dickinson,Heidelberg. Biozym, Hessisch Oldendorf. Eppendorf, Hamburg 13 4. MATERIALS 4.1 Laboratory apparatus Biofuge A Centrifuge 5804R FACScan Gel electrophoresis chamber GPR Centrifuge Heraeus CO-AUTO-ZERO Light Cycler Microscope Motopipet Neubauer Cell Chamber PCR cycler

More information

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR Page 1 of 5 Materials DNase digestion buffer [13 mm Tris-Cl, ph7,5 / 5 mm MgCl2 / 0,12 mm CaCl2] RSS plasmid ptr-uf11 SV40pA Forward primer (10µM) AGC AAT AGC ATC ACA AAT TTC ACA A SV40pA Reverse Primer

More information

Chapter 9. Applications of probability. 9.1 The genetic code

Chapter 9. Applications of probability. 9.1 The genetic code Chapter 9 Applications of probability In this chapter we use the tools of elementary probability to investigate problems of several kinds. First, we study the language of life by focusing on the universal

More information

All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI_ NotI

All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI_ NotI 2. Primer Design 2.1 Multiple Cloning Sites All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI NotI XXX XXX GGA TCC CCG AAT

More information

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information

Module 6: Digital DNA

Module 6: Digital DNA Module 6: Digital DNA Representation and processing of digital information in the form of DNA is essential to life in all organisms, no matter how large or tiny. Computing tools and computational thinking

More information

Drosophila NK-homeobox genes

Drosophila NK-homeobox genes Proc. Natl. Acad. Sci. USA Vol. 86, pp. 7716-7720, October 1989 Biochemistry Drosophila NK-homeobox genes (NK-1, NK-2,, and DNA clones/chromosome locations of genes) YONGSOK KIM AND MARSHALL NIRENBERG

More information

Analysis of Synonymous Codon Usage Bias in Chlamydia

Analysis of Synonymous Codon Usage Bias in Chlamydia ISSN 1672-9145 Acta Biochimica et Biophysica Sinica 2005, 37(1): 1 10 CN 31-1940/Q Analysis of Synonymous Codon Usage Bias in Chlamydia Hui LÜ, Wei-Ming ZHAO*, Yan ZHENG, Hong WANG, Mei QI, and Xiu-Ping

More information

The making of The Genoma Music

The making of The Genoma Music 242 Summary Key words Resumen Palabras clave The making of The Genoma Music Aurora Sánchez Sousa 1, Fernando Baquero 1 and Cesar Nombela 2 1 Department of Microbiology, Ramón y Cajal Hospital, and 2 Department

More information

Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases

Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases Dissertation der Mathematisch-Naturwissenschaftlichen Fakultät der Eberhard Karls Universität

More information

Molecular Cloning, DNA Nucleotide Sequencing, and Expression in Bacillus subtilis Cells of the Bacillus macerans Cyclodextrin Glucanotransferase Gene

Molecular Cloning, DNA Nucleotide Sequencing, and Expression in Bacillus subtilis Cells of the Bacillus macerans Cyclodextrin Glucanotransferase Gene JOURNAL OF BACTERIOLOGY, June 1986, p. 11181122 00219193/86/06111805$02.00/0 Copyright 1986, American Society for Microbiology Vol. 166, No. 3 Molecular Cloning, DNA Nucleotide Sequencing, and Expression

More information

Supporting Information. for. Formation of carbohydrate-functionalised. polystyrene and glass slides and their analysis by

Supporting Information. for. Formation of carbohydrate-functionalised. polystyrene and glass slides and their analysis by Supporting Information for Formation of carbohydrate-functionalised polystyrene and glass slides and their analysis by MALDI-TOF MS Martin J. Weissenborn 1, Johannes W. Wehner 2, Christopher J. Gray 1,

More information

N-terminal Regulatory Domains of Phosphodiesterases 1, 4, 5 and 10 examined with an Adenylyl Cyclase as a Reporter

N-terminal Regulatory Domains of Phosphodiesterases 1, 4, 5 and 10 examined with an Adenylyl Cyclase as a Reporter N-terminal Regulatory Domains of Phosphodiesterases 1, 4, 5 and 10 examined with an Adenylyl Cyclase as a Reporter Dissertation der Mathematisch-Naturwissenschaftlichen Fakultät der Eberhard Karls Universität

More information

Five-minute cloning of Taq polymerase-amplified PCR products

Five-minute cloning of Taq polymerase-amplified PCR products TOPO TA Cloning Version R 8 April 2004 25-0184 TOPO TA Cloning Five-minute cloning of Taq polymerase-amplified PCR products Catalog nos. K4500-01, K4500-40, K4510-20, K4520-01, K4520-40, K4550-01, K4550-40,

More information

Significance of sarcomere gene mutation in patients with dilated cardiomyopathy

Significance of sarcomere gene mutation in patients with dilated cardiomyopathy Significance of sarcomere gene mutation in patients with dilated cardiomyopathy Y.D. Li 1 *, Y.T. Ji 1 *, X.H. Zhou 1, H.L. Li 2, H.T. Zhang 3, Y. Zhang 1, J.X. Li 1, Q. Xing 1, J.H. Zhang 1, Y.F. Hong

More information

The Adaptation of Temperate Bacteriophages to their Host Genomes

The Adaptation of Temperate Bacteriophages to their Host Genomes Supplementary material for the manuscript by The Adaptation of Temperate Bacteriophages to their Host Genomes Louis-Marie Bobay, Eduardo PC Rocha, Marie Touchon Table of contents: Table S1 - General features

More information

DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108

DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 THE INTERLEUKIN-10 FAMILY CYTOKINES GENE POLYMORPHISMS IN PLAQUE PSORIASIS KÜLLI KINGO TARTU

More information

0302 Screening and identification of sirna to suppress macrophage migration inhibitory factor (MIF) gene expression

0302 Screening and identification of sirna to suppress macrophage migration inhibitory factor (MIF) gene expression 0302 Screening and identification of to suppress macrophage migration inhibitory factor (MIF) gene expression SHAN Zhi-Xin (MIF), LIN Qiu-Xiong,YU Xi-Yong, LIN Shu-Guang, FU Yong-Heng, DENG Chun-Yu Division

More information

were demonstrated to be, respectively, the catalytic and regulatory subunits of protein phosphatase 2A (PP2A) (29).

were demonstrated to be, respectively, the catalytic and regulatory subunits of protein phosphatase 2A (PP2A) (29). JOURNAL OF VIROLOGY, Feb. 1992, p. 886-893 0022-538X/92/020886-08$02.00/0 Copyright C) 1992, American Society for Microbiology Vol. 66, No. 2 The Third Subunit of Protein Phosphatase 2A (PP2A), a 55- Kilodalton

More information

Interleukin-4 Receptor Signal Transduction: Involvement of P62

Interleukin-4 Receptor Signal Transduction: Involvement of P62 Interleukin-4 Receptor Signal Transduction: Involvement of P62 Den Naturwissenschaftlichen Fakultäten der Friedrich Alexander Universität Erlangen Nürnberg zur Erlangung des Doktorgrades vorgelegt von

More information

BD BaculoGold Baculovirus Expression System Innovative Solutions for Proteomics

BD BaculoGold Baculovirus Expression System Innovative Solutions for Proteomics BD BaculoGold Baculovirus Expression System Innovative Solutions for Proteomics Table of Contents Innovative Solutions for Proteomics...........................................................................

More information

Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR. Protocol

Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR. Protocol Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR Protocol 31 January 2011 Joint Research Centre Institute for Health and Consumer Protection Molecular Biology and Genomics

More information

Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.)

Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.) Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.) J. Paz-Ares, F. Ponz, P. Rodríguez-Palenzuela, A. Lázaro, C. Hernández-Lucas,

More information

The DNA-"Wave Biocomputer"

The DNA-Wave Biocomputer The DNA-"Wave Biocomputer" Peter P. Gariaev (Pjotr Garjajev)*, Boris I. Birshtein*, Alexander M. Iarochenko*, Peter J. Marcer**, George G. Tertishny*, Katherine A. Leonova*, Uwe Kaempf ***. * Institute

More information

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

Association of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer risk

Association of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer risk DOI 10.1007/s10552-009-9438-4 ORIGINAL PAPER Association of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer risk Elisabeth Feik Æ Andreas Baierl Æ Barbara Hieger Æ Gerhard Führlinger

More information

Insulin Receptor Gene Mutations in Iranian Patients with Type II Diabetes Mellitus

Insulin Receptor Gene Mutations in Iranian Patients with Type II Diabetes Mellitus Iranian Biomedical Journal 13 (3): 161-168 (July 2009) Insulin Receptor Gene Mutations in Iranian Patients with Type II Diabetes Mellitus Bahram Kazemi 1*, Negar Seyed 1, Elham Moslemi 2, Mojgan Bandehpour

More information

Gene Finding. Slides by Carl Kingsford

Gene Finding. Slides by Carl Kingsford Gene Finding Slides by Carl Kingsford Genome of the Cow a sequence of 2.86 billion letters enough letters to fill a million pages of a typical book. TATGGAGCCAGGTGCCTGGGGCAACAAGACTGTGGTCACTGAATTCATCCTTCTTGGTCTAACAGAGAACATAG

More information

J. Biomedical Science and Engineering, 2010, 3, JBiSE

J. Biomedical Science and Engineering, 2010, 3, JBiSE J. Biomedical Science and Engineering, 2010, 3, 340-350 doi:10.4236/jbise.2010.34047 Published Online April 2010 (http://www.scirp.org/journal/jbise/). Characterization of the sequence spectrum of DNA

More information

Solution Key Problem Set 3

Solution Key Problem Set 3 Solution Key- 7.016 Problem Set 3 Question 1 The following human pedigree shows the inheritance pattern of a specific disease within a family. Assume that the individuals marrying into the family for all

More information

Chlamydomonas adapted Green Fluorescent Protein (CrGFP)

Chlamydomonas adapted Green Fluorescent Protein (CrGFP) Chlamydomonas adapted Green Fluorescent Protein (CrGFP) Plasmid pfcrgfp for fusion proteins Sequence of the CrGFP In the sequence below, all amino acids which have been altered from the wildtype GFP from

More information

Archimer http://archimer.ifremer.fr

Archimer http://archimer.ifremer.fr Please note that this is an author-produced PDF of an article accepted for publication following peer review. The definitive publisher-authenticated version is available on the publisher Web site Fish

More information

On Covert Data Communication Channels Employing DNA Recombinant and Mutagenesis-based Steganographic Techniques

On Covert Data Communication Channels Employing DNA Recombinant and Mutagenesis-based Steganographic Techniques On Covert Data Communication Channels Employing DNA Recombinant and Mutagenesis-based Steganographic Techniques MAGDY SAEB 1, EMAN EL-ABD 2, MOHAMED E. EL-ZANATY 1 1. School of Engineering, Computer Department,

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

Metabolic Engineering of Escherichia coli for Enhanced Production of Succinic Acid, Based on Genome Comparison and In Silico Gene Knockout Simulation

Metabolic Engineering of Escherichia coli for Enhanced Production of Succinic Acid, Based on Genome Comparison and In Silico Gene Knockout Simulation APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Dec. 2005, p. 7880 7887 Vol. 71, No. 12 0099-2240/05/$08.00 0 doi:10.1128/aem.71.12.7880 7887.2005 Copyright 2005, American Society for Microbiology. All Rights

More information

Taqman TCID50 for AAV Vector Infectious Titer Determination

Taqman TCID50 for AAV Vector Infectious Titer Determination Page 1 of 8 Purpose: To determine the concentration of infectious particles in an AAV vector sample. This process involves serial dilution of the vector in a TCID50 format and endpoint determination through

More information

Early assessment of the efficacy of a human papillomavirus type 16 L1 virus-like particle vaccine

Early assessment of the efficacy of a human papillomavirus type 16 L1 virus-like particle vaccine Vaccine 22 (2004) 2936 2942 Early assessment of the efficacy of a human papillomavirus type 16 L1 virus-like particle vaccine Darron R. Brown a,, Kenneth H. Fife a, Cosette M. Wheeler b, Laura A. Koutsky

More information

Biopython Tutorial and Cookbook

Biopython Tutorial and Cookbook Biopython Tutorial and Cookbook Jeff Chang, Brad Chapman, Iddo Friedberg, Thomas Hamelryck, Michiel de Hoon, Peter Cock Last Update September 2008 Contents 1 Introduction 5 1.1 What is Biopython?.........................................

More information

Molecular detection of Babesia rossi and Hepatozoon sp. in African wild dogs (Lycaon pictus) in South Africa

Molecular detection of Babesia rossi and Hepatozoon sp. in African wild dogs (Lycaon pictus) in South Africa Available online at www.sciencedirect.com Veterinary Parasitology 157 (2008) 123 127 Short communication Molecular detection of Babesia rossi and Hepatozoon sp. in African wild dogs (Lycaon pictus) in

More information