Sequence Alignment Young-Rae Cho
|
|
- Samson Briggs
- 7 years ago
- Views:
Transcription
1 BINF 3350, Genomics and Bioinformatics Sequence Alignment Young-Rae Cho Associate Professor Department of Computer Science Baylor University BINF 3350, Chapter 4, Sequence Alignment 1. Sequence Alignment 2. Dynamic Programming 3. Scoring Alignments 4. Gap Penalty 5. Global vs. Local Alignment 6. Pairwise vs. Multiple Sequence Alignment 7. Sequence Homolog Search 8. Motif Search 1
2 Sequence Homology Homologs Similar sequence and Common ancestor Similar sequence and Same function (in divergent evolution) Orthologs Homologous sequences in different species by species divergence Paralogs Homologous sequences in the same species by gene duplication Analogs Similar sequence and No common ancestor (in convergent evolution) Sequence Similarity Importance of finding similar (DNA or protein) sequences Evolutionary closeness Relationship between sequences and evolution Functional similarity Relationship between sequences and functions How to measure sequence similarity (Method 1) Counting identical letters on each position A T G T T A T T C G T A C T (Method 2) Inserting gaps to maximize the number of identical letters Sequence alignment A T G T T A T T C G T A C T 2
3 Sequence Alignment Sequence Alignment Aligning two or more sequences to maximize their similarity including gaps How to find sequence alignment? (1) Measuring edit distance Edit Distance (1) Definition Edit distance between two sequences x and y : the minimum number of editing operations (insertion, deletion, substitution) to transform x into y Example x= TGCATAT (m=7), y= ATCCGAT (n=7) TGCATAT ATGCATAT ATCCATAT ATCCGATAT ATCCGATT ATCCGAT insertion of A substitution of G with C insertion of G deletion of A deletion of T edit distance = 5? 3
4 Edit Distance (2) Example x= TGCATAT (m=7), y= ATCCGAT (n=7) TGCATAT ATGCATAT ATGCAAT ATCCAAT ATCCGAT insertion of A deletion of T substitute of G with C substitute of A with G edit distance = 4? Can it be done in 3 steps? How to measure edit distance efficiently? A T G T T A T G C A A T G T A C T T A T C G T A C T C A G T T C A A G T C A Edit Distance (3) Example in 2-Row Representation x= ATCTGATG (m=8), y= TGCATAC (n=7) x y A T C T G A T G T G C A T A C 4 matches 4 insertions 3 deletions x y A T C T G A T G T G C A T A C 4 matches 3 insertions 2 deletions 1 substitutions Edit distance = #insertions + #deletions + #substitutions 4
5 Hamming Distance vs. Edit Distance Hamming Distance Compares the letters on the same position between two sequences Not good to measure evolutionary distance between DNA sequences Edit Distance Compares the letters between two sequences after inserting gaps Allows comparison of two sequences of different lengths Good to measure evolutionary distance between DNA sequences Example x= ATATATAT, y= TATATATA Hamming distance between x and y? Edit distance between x and y? Sequence Alignment Sequence Alignment Aligning two or more sequences to maximize their similarity including gaps How to find sequence alignment? (1) Measuring edit distance (2) Finding longest common subsequence 5
6 Longest Common Subsequence (1) Subsequence of x An ordered sequence of letters from x Not necessarily consecutive e.g., x= ATTGCTA, AGCA?, TCG?, ATCT?, TGAT? Common Subsequence of x and y e.g., x= ATCTGAT and y= TGCATA, TCTA?, TGAT?, TATA? Longest Common Subsequence (LCS) of x and y? Longest Common Subsequence (2) Example x= ATCTGATG (m=8), y= TGCATAC (n=7) LCS of X and Y? 2-row representation How to find LCS efficiently? A T G T T A T G C A A T G T A C T T A G A C T C A A G T G C C A T T T G A C T C G T A C T C A G T T C A A G T C A G T T A C G A G T A C A T G C A A A C 6
7 Sequence Alignment Sequence Alignment Aligning two or more sequences to maximize their similarity including gaps How to find sequence alignment? (1) Measuring edit distance (2) Finding longest common subsequence Dynamic programming BINF 3350, Chapter 4, Sequence Alignment 1. Sequence Alignment 2. Dynamic Programming 3. Scoring Alignments 4. Gap Penalty 5. Global vs. Local Alignment 6. Pairwise vs. Multiple Sequence Alignment 7. Sequence Homolog Search 8. Motif Search 7
8 Dynamic Programming Definition An algorithm to solve complex problems by breaking them down into simpler sub problems The result of a sub problem is used to solve the next sub problem Features Optimization Finding an optimal solution Saving memory space Examples Binary search tree Sequence alignment Dynamic Programming for Sequence Alignment Edit Graph 2 D grid structure having a diagonal on the position of the same letter Weight the diagonal lines as 1 Weight the other lines as 0 source A T C G T A C A T G Goal Finding the strongest path from source to sink T T A T Algorithm (1) Compute the max score for each node (The max score means the max counts of identical letters from source to each node) (2) When reaching the sink, trace backward to find LCS sink 8
9 Sequence Alignment Example Example source A T C G T A C A T G T T A T sink Sequence Alignment A T C G T A C A T G T TA T Quiz Example X = ATGCGT, Y = AGACAT source A T G C G T A G A C Sequence Alignment A T sink 9
10 BINF 3350, Chapter 4, Sequence Alignment 1. Sequence Alignment 2. Dynamic Programming 3. Scoring Alignments 4. Gap Penalty 5. Global vs. Local Alignment 6. Pairwise vs. Multiple Sequence Alignment 7. Sequence Homolog Search 8. Motif Search Scoring Alignments: Percent Identity (1) Identity Degree of identical matches between sequences Percent Identity Percentage of identical matches Dot-plot representations Visualization method of identity 10
11 Scoring Alignments: Percent Identity (2) Dot-plot representations of self alignment The background noise can be removed by setting a threshold of the min identity score in a fixed window Scoring Alignments: Percent Similarity Percent Similarity Percentage of similar amino acid pairs in biochemical structure (Protein) Percentage of similar nucleotide pairs in biochemical structure (DNA) Advanced Scoring Schemes Varying scores in similarity of biochemical structures Penalties (negative scores) for strong mismatches Relative likelihood of evolutionary relationship Probability of mutations Minimum Acceptance Score 90% of sequence pairs with more than 30% sequence identity: homolog 20~30% sequence identity: twilight zone 11
12 Substitution Matrices (1) Substitution Matrix Score matrix among nucleotides or amino acids 4 4 array representation for DNA sequences or (4) (4) array array representation for protein sequences or (20) (20) array Entry of δ(i,j) has the score between i and j, i.e., the rate at which i is substituted with j over time Substitution Matrices (2) PAM (Point Accepted Mutations) For protein sequence alignment Amino acid substitution frequency in mutations Logarithmic matrix of mutation probabilities PAM120: Results from 120 mutations per 100 residues PAM120 vs. PAM240 BLOSUM (Block Substitution Matrix) For protein sequence alignment Applied for local sequence alignments Substitution frequencies between clustered groups BLOSUM-62: Results with a threshold (cut-off) of 62% identity BLOSUM-62 vs. BLOSUM-50 12
13 Substitution Matrices (3) Substitution Matrix Examples BLOSUM-62 PAM120 Theory of Scoring Alignments Random model Non-random model Odds ratio Odds ratio for each position Odds ratio for entire alignment log-odds ratio (a score in a substitution matrix) Expected score 13
14 BINF 3350, Chapter 4, Sequence Alignment 1. Sequence Alignment 2. Dynamic Programming 3. Scoring Alignments 4. Gap Penalty 5. Global vs. Local Alignment 6. Pairwise vs. Multiple Sequence Alignment 7. Sequence Homolog Search 8. Motif Search Gap Penalty (1) Gaps Contiguous sequence of spaces in one of the aligned sequences Gaps inserted as the results of insertions and deletions (indels) Gap Penalties High penalties vs. Low penalties Fixed penalties vs. Flexible penalties depending on residues No penalty on start gaps and end gaps Finding optimal number of gaps for the best score in sequence alignment Dynamic Programming 14
15 Gap Penalty (2) Examples of high penalties and low penalties Affine Gap Penalty (1) Motivation -σ for 1 gap (insertion or deletion) -2σ for 2 consecutive gaps (insertions or deletions) -3σ for 3 consecutive gaps (insertions or deletions), etc. too severe penalty for a series of 100 consecutive gaps Example x= ATAGC, y= ATATTGC single event x= ATAGGC, y= ATGTGC 15
16 Affine Gap Penalty (2) Linear Gap Penalty Score for a gap of length x : -σ x Constant Gap Penalty Score for a gap of length x : -ρ Affine Gap Penalty Score for a gap of length x : - (ρ + σ x) ρ : gap opening penalty / σ : gap extension penalty ( ρ σ ) BINF 3350, Chapter 4, Sequence Alignment 1. Sequence Alignment 2. Dynamic Programming 3. Scoring Alignments 4. Gap Penalty 5. Global vs. Local Alignment 6. Pairwise vs. Multiple Sequence Alignment 7. Sequence Homolog Search 8. Motif Search 16
17 Global vs. Local Alignment Global Alignment Finding sequence alignment across the whole length of sequences Dynamic Programming (Needleman-Wunch algorithm) Local Alignment Finding significant similarity in a part of sequences Dynamic Programming (Smith-Waterman algorithm) Example x = TCAGTGTCGAAGTTA y = TAGGCTAGCAGTGTA T C A G T G T C G A A G T T A T A G G C T A G C A G T G T A T C A G T G T C G A A G T T A T A G G C T A G C A G T G T A Local Alignment Example Local Alignment Applied for multi-domain protein sequences Protein domain Basic functional block Evolutionary conserved 17
18 BINF 3350, Chapter 4, Sequence Alignment 1. Sequence Alignment 2. Dynamic Programming 3. Scoring Alignments 4. Gap Penalty 5. Global vs. Local Alignment 6. Pairwise vs. Multiple Sequence Alignment 7. Sequence Homolog Search 8. Motif Search Multiple Alignment (1) Pairwise Alignment Alignment of two sequences Sometimes two sequences are functionally similar or have common ancestor although they have weak sequence similarity Multiple Alignment Alignment of three or more sequences simultaneously Finds similarity which is invisible in pairwise alignment 18
19 Multiple Alignment (2) Example Dynamic Programming? Computationally not acceptable Need heuristic methods Hierarchical Method (1) Hierarchical Method (1) Compares all sequences in pairwise alignments (2) Creates a guide tree (hierarchy) (3) Follows the guide tree for a series of pairwise alignments v 1 v 2 v 3 v 4 v 1 v 2 v 3 v
20 Hierarchical Method (2) Features Also called progressive alignment More intelligent strategy on each step Use of consensus sequence to compare groups of sequences Gaps are permanent ( once a gap, always a gap ) Works well for close sequences Application Tools ClustalW Comparing residues one pair at a time and imposing gap penalties DIALIGN Finding pairs of equal-length gap-free segments Divide-and-Conquer Method Process Features Fast aligning of long sequences 20
21 Multiple Alignment Results Examples Summary of PSA & MSA Algorithms Rigorous Algorithms Heuristic Algorithms 21
22 BINF 3350, Chapter 4, Sequence Alignment 1. Sequence Alignment 2. Dynamic Programming 3. Scoring Alignments 4. Gap Penalty 5. Global vs. Local Alignment 6. Pairwise vs. Multiple Sequence Alignment 7. Sequence Homolog Search 8. Motif Search Searching Databases Sequence Homolog Search Search similar sequences to a query sequence in a database Computational issues Dynamic programming (N-W / S-W algorithms) are rigorous But inefficient in searching a huge database Need heuristic approaches Sequence Homolog Searching Tools FASTA BLAST 22
23 FASTA (1) FASTA DNA / protein sequence alignment tool (local alignment) Applies dynamic programming in scoring selected sequences Heuristic method in candidate sequence search Algorithm (1) Finding all pairwise k-tuples (at least k contiguous matching residues) (2) Scoring the k-tuples by a substitution matrix (3) Selecting sequences with high scores for alignment FASTA (2) Indexing (or Hashing) Indexing Process in FASTA (1) Find all k-tuples from a query sequence and calculate c i (2) Build an index table 23
24 FASTA Package FASTA package query sequence database fasta protein protein fasta DNA DNA fastx / fasty DNA (all reading frames) protein tfastx / tfasty protein DNA (all reading frames) ssearch : applies dynamic programming (S-W algorithm) BLAST (1) BLAST (Basic Local Alignment Search Tool) DNA / protein sequence alignment tool Finds local alignments Heuristic method in sequence search Runs faster than FASTA Algorithm (1) Makes a list of words (word pairs) from the query sequence (2) Chooses high-scoring words (3) Searches database for matches (hits) with the high-scoring words (4) Extends the matches in both directions to find high-scoring segment pair (HSP) (5) Selects the sequence which has two or more HSPs for S-W alignment 24
25 BLAST (2) Deterministic Finite Automata (DFA) DFA Analysis Process in BLAST (1) Build DFA using high-scoring words (2) Read sequences in database and trace DFA (3) Output the positions for hits BLAST Package BLAST programs query sequence database blastp protein protein blastn DNA DNA blastx DNA (all reading frames) protein tblastn protein DNA (all reading frames) tblastx DNA (all reading frames) DNA (all reading frames) 25
26 Search Results BLAST Search Results FASTA Search Results E-value E-value Average number of alignments with a score of at least S that would be expected by chance alone in searching a database of n sequences Ranges of E-value: 0 ~ n High alignment score S Low E-value Low alignment score S High E-value Factors Alignment score The number of sequences in the database Sequence length Default E-value threshold: 0.01 ~
27 Filtering Low-Complexity Region Highly biased amino acid composition Lowers significant hits in sequence alignment BLAST filters the query sequence for low-complexity regions and mark X Summary of Homolog Search Algorithms Rigorous Algorithms Heuristic Algorithms 27
28 BINF 3350, Chapter 4, Sequence Alignment 1. Sequence Alignment 2. Dynamic Programming 3. Scoring Alignments 4. Gap Penalty 5. Global vs. Local Alignment 6. Pairwise vs. Multiple Sequence Alignment 7. Sequence Homolog Search 8. Motif Search Motifs Motifs Short sequence patterns Functionally related sequences share similarly distributed patterns (motifs) of critical functional residues Types of Motif Search Search a query sequence in a motif database Search a pattern in a sequence database Find a pattern from a set of sequences Motif Finding Consensus method by global multiple alignment 28
29 Motif Search Tools (1) BLOCKS Logos Size of letters: conservation levels Color of letters: biochemical properties Motif Search Tools (2) MEME Summary motif information Location of motifs in sequences 29
30 Motif Databases PROSITE Code for patterns Each letter represents an amino acid residue All positions are separated by - Code description Example X any amino acid G-X-L-M-S-A-D-F-F-F [] two or more possible amino acid G-[LI]-L-M-S-A-D-F-F-F {} disallowed amino acid G-[LI]-L-M-S-A-{RK}-F-F-F (n) repetition by n of the amino acid G-[LI]-L-M-S-A-{RK}-F(3) (n,m) a range: only allowed with X G-[LI]-L-M-S-A-{RK}-X(1,3) 30
Pairwise Sequence Alignment
Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
More informationBLAST. Anders Gorm Pedersen & Rasmus Wernersson
BLAST Anders Gorm Pedersen & Rasmus Wernersson Database searching Using pairwise alignments to search databases for similar sequences Query sequence Database Database searching Most common use of pairwise
More informationRETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
More informationSimilarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003
Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:
More informationBio-Informatics Lectures. A Short Introduction
Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively
More informationProtein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004
Protein & DNA Sequence Analysis Bobbie-Jo Webb-Robertson May 3, 2004 Sequence Analysis Anything connected to identifying higher biological meaning out of raw sequence data. 2 Genomic & Proteomic Data Sequence
More informationBioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
More informationNetwork Protocol Analysis using Bioinformatics Algorithms
Network Protocol Analysis using Bioinformatics Algorithms Marshall A. Beddoe Marshall_Beddoe@McAfee.com ABSTRACT Network protocol analysis is currently performed by hand using only intuition and a protocol
More informationBioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
More informationIntroduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
More informationPROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org
BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,
More informationBIOINFORMATICS TUTORIAL
Bio 242 BIOINFORMATICS TUTORIAL Bio 242 α Amylase Lab Sequence Sequence Searches: BLAST Sequence Alignment: Clustal Omega 3d Structure & 3d Alignments DO NOT REMOVE FROM LAB. DO NOT WRITE IN THIS DOCUMENT.
More informationProtein Protein Interaction Networks
Functional Pattern Mining from Genome Scale Protein Protein Interaction Networks Young-Rae Cho, Ph.D. Assistant Professor Department of Computer Science Baylor University it My Definition of Bioinformatics
More informationRapid alignment methods: FASTA and BLAST. p The biological problem p Search strategies p FASTA p BLAST
Rapid alignment methods: FASTA and BLAST p The biological problem p Search strategies p FASTA p BLAST 257 BLAST: Basic Local Alignment Search Tool p BLAST (Altschul et al., 1990) and its variants are some
More informationSequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment
Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... Multiple sequence alignment Substitution matrices Phylogenetic trees You first need
More informationAmino Acids and Their Properties
Amino Acids and Their Properties Recap: ss-rrna and mutations Ribosomal RNA (rrna) evolves very slowly Much slower than proteins ss-rrna is typically used So by aligning ss-rrna of one organism with that
More informationWelcome to the Plant Breeding and Genomics Webinar Series
Welcome to the Plant Breeding and Genomics Webinar Series Today s Presenter: Dr. Candice Hansey Presentation: http://www.extension.org/pages/ 60428 Host: Heather Merk Technical Production: John McQueen
More informationMolecular Databases and Tools
NWeHealth, The University of Manchester Molecular Databases and Tools Afternoon Session: NCBI/EBI resources, pairwise alignment, BLAST, multiple sequence alignment and primer finding. Dr. Georgina Moulton
More informationCD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/
CD-HIT User s Guide Last updated: April 5, 2010 http://cd-hit.org http://bioinformatics.org/cd-hit/ Program developed by Weizhong Li s lab at UCSD http://weizhong-lab.ucsd.edu liwz@sdsc.edu 1. Introduction
More informationSGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD
White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper
More informationDatabase searching with DNA and protein sequences: An introduction Clare Sansom Date received (in revised form): 12th November 1999
Dr Clare Sansom works part time at Birkbeck College, London, and part time as a freelance computer consultant and science writer At Birkbeck she coordinates an innovative graduate-level Advanced Certificate
More informationBiological Databases and Protein Sequence Analysis
Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to
More informationPhylogenetic Trees Made Easy
Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts
More informationBIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:
More informationMultiple Sequence Alignment. Hot Topic 5/24/06 Kim Walker
Multiple Sequence Alignment Hot Topic 5/24/06 Kim Walker Outline Why are Multiple Sequence Alignments useful? What Tools are Available? Brief Introduction to ClustalX Tools to Edit and Add Features to
More informationClone Manager. Getting Started
Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software
More informationFocusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
More informationLinear Sequence Analysis. 3-D Structure Analysis
Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic
More informationComputational searches of biological sequences
UNAM, México, Enero 78 Computational searches of biological sequences Special thanks to all the scientis that made public available their presentations throughout the web from where many slides were taken
More informationIntroduction to Bioinformatics AS 250.265 Laboratory Assignment 6
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 In the last lab, you learned how to perform basic multiple sequence alignments. While useful in themselves for determining conserved residues
More informationAlgorithms in Bioinformatics I, WS06/07, C.Dieterich 47. This lecture is based on the following, which are all recommended reading:
Algorithms in Bioinformatics I, WS06/07, C.Dieterich 47 5 BLAST and FASTA This lecture is based on the following, which are all recommended reading: D.J. Lipman and W.R. Pearson, Rapid and Sensitive Protein
More informationCore Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1
Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: Sonia.Casillas@uab.cat
More informationA Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University jakemdrew@gmail.com www.jakemdrew.com Sequence Characters IUPAC nucleotide
More informationAnalyzing A DNA Sequence Chromatogram
LESSON 9 HANDOUT Analyzing A DNA Sequence Chromatogram Student Researcher Background: DNA Analysis and FinchTV DNA sequence data can be used to answer many types of questions. Because DNA sequences differ
More informationGuide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
More informationChoices, choices, choices... Which sequence database? Which modifications? What mass tolerance?
Optimization 1 Choices, choices, choices... Which sequence database? Which modifications? What mass tolerance? Where to begin? 2 Sequence Databases Swiss-prot MSDB, NCBI nr dbest Species specific ORFS
More informationTHREE DIMENSIONAL REPRESENTATION OF AMINO ACID CHARAC- TERISTICS
THREE DIMENSIONAL REPRESENTATION OF AMINO ACID CHARAC- TERISTICS O.U. Sezerman 1, R. Islamaj 2, E. Alpaydin 2 1 Laborotory of Computational Biology, Sabancı University, Istanbul, Turkey. 2 Computer Engineering
More informationGenome Explorer For Comparative Genome Analysis
Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence
More informationUCHIME in practice Single-region sequencing Reference database mode
UCHIME in practice Single-region sequencing UCHIME is designed for experiments that perform community sequencing of a single region such as the 16S rrna gene or fungal ITS region. While UCHIME may prove
More informationDNA Printer - A Brief Course in sequence Analysis
Last modified August 19, 2015 Brian Golding, Dick Morton and Wilfried Haerty Department of Biology McMaster University Hamilton, Ontario L8S 4K1 ii These notes are in Adobe Acrobat format (they are available
More informationT cell Epitope Prediction
Institute for Immunology and Informatics T cell Epitope Prediction EpiMatrix Eric Gustafson January 6, 2011 Overview Gathering raw data Popular sources Data Management Conservation Analysis Multiple Alignments
More informationHeuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations
Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations AlCoB 2014 First International Conference on Algorithms for Computational Biology Thiago da Silva Arruda Institute
More informationHidden Markov Models
8.47 Introduction to omputational Molecular Biology Lecture 7: November 4, 2004 Scribe: Han-Pang hiu Lecturer: Ross Lippert Editor: Russ ox Hidden Markov Models The G island phenomenon The nucleotide frequencies
More informationDesign Style of BLAST and FASTA and Their Importance in Human Genome.
Design Style of BLAST and FASTA and Their Importance in Human Genome. Saba Khalid 1 and Najam-ul-haq 2 SZABIST Karachi, Pakistan Abstract: This subjected study will discuss the concept of BLAST and FASTA.BLAST
More informationModule 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
More informationBioinformática BLAST. Blast information guide. Buscas de sequências semelhantes. Search for Homologies BLAST
BLAST Bioinformática Search for Homologies BLAST BLAST - Basic Local Alignment Search Tool http://blastncbinlmnihgov/blastcgi 1 2 Blast information guide Buscas de sequências semelhantes http://blastncbinlmnihgov/blastcgi?cmd=web&page_type=blastdocs
More informationMORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix.
MORPHEUS http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. Reference: MORPHEUS, a Webtool for Transcripton Factor Binding Analysis Using
More informationDNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
More informationModule 10: Bioinformatics
Module 10: Bioinformatics 1.) Goal: To understand the general approaches for basic in silico (computer) analysis of DNA- and protein sequences. We are going to discuss sequence formatting required prior
More informationBayesian Phylogeny and Measures of Branch Support
Bayesian Phylogeny and Measures of Branch Support Bayesian Statistics Imagine we have a bag containing 100 dice of which we know that 90 are fair and 10 are biased. The
More informationIntegrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon
Integrating DNA Motif Discovery and Genome-Wide Expression Analysis Department of Mathematics and Statistics University of Massachusetts Amherst Statistics in Functional Genomics Workshop Ascona, Switzerland
More information2.3 Identify rrna sequences in DNA
2.3 Identify rrna sequences in DNA For identifying rrna sequences in DNA we will use rnammer, a program that implements an algorithm designed to find rrna sequences in DNA [5]. The program was made by
More informationDynamic Programming. Lecture 11. 11.1 Overview. 11.2 Introduction
Lecture 11 Dynamic Programming 11.1 Overview Dynamic Programming is a powerful technique that allows one to solve many different types of problems in time O(n 2 ) or O(n 3 ) for which a naive approach
More informationLearning from Diversity
Learning from Diversity Epitope Prediction with Sequence and Structure Features using an Ensemble of Support Vector Machines Rob Patro and Carl Kingsford Center for Bioinformatics and Computational Biology
More informationProtein Sequence Analysis - Overview -
Protein Sequence Analysis - Overview - UDEL Workshop Raja Mazumder Research Associate Professor, Department of Biochemistry and Molecular Biology Georgetown University Medical Center Topics Why do protein
More informationUsing MATLAB: Bioinformatics Toolbox for Life Sciences
Using MATLAB: Bioinformatics Toolbox for Life Sciences MR. SARAWUT WONGPHAYAK BIOINFORMATICS PROGRAM, SCHOOL OF BIORESOURCES AND TECHNOLOGY, AND SCHOOL OF INFORMATION TECHNOLOGY, KING MONGKUT S UNIVERSITY
More informationSequence information - lectures
Sequence information - lectures Pairwise alignment Alignments in database searches Multiple alignments Profiles Patterns RNA secondary structure / Transformational grammars Genome organisation / Gene prediction
More informationIntroduction to Phylogenetic Analysis
Subjects of this lecture Introduction to Phylogenetic nalysis Irit Orr 1 Introducing some of the terminology of phylogenetics. 2 Introducing some of the most commonly used methods for phylogenetic analysis.
More informationBIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16
Course Director: Dr. Barry Grant (DCM&B, bjgrant@med.umich.edu) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems
More informationTutorial for proteome data analysis using the Perseus software platform
Tutorial for proteome data analysis using the Perseus software platform Laboratory of Mass Spectrometry, LNBio, CNPEM Tutorial version 1.0, January 2014. Note: This tutorial was written based on the information
More informationWeb Data Extraction: 1 o Semestre 2007/2008
Web Data : Given Slides baseados nos slides oficiais do livro Web Data Mining c Bing Liu, Springer, December, 2006. Departamento de Engenharia Informática Instituto Superior Técnico 1 o Semestre 2007/2008
More informationDnaSP, DNA polymorphism analyses by the coalescent and other methods.
DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,
More informationHOBIT at the BiBiServ
HOBIT at the BiBiServ Jan Krüger Henning Mersch Bielefeld Bioinformatics Service Institute of Bioinformatics CeBiTec jkrueger@techfak.uni-bielefeld.de hmersch@techfak.uni-bielefeld.de Cologne, March 2005
More informationSeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
More informationWhen you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
More informationVersion 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
More informationThe Central Dogma of Molecular Biology
Vierstraete Andy (version 1.01) 1/02/2000 -Page 1 - The Central Dogma of Molecular Biology Figure 1 : The Central Dogma of molecular biology. DNA contains the complete genetic information that defines
More informationEfficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing
Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing James D. Jackson Philip J. Hatcher Department of Computer Science Kingsbury Hall University of New Hampshire Durham,
More informationDNA Sequencing Overview
DNA Sequencing Overview DNA sequencing involves the determination of the sequence of nucleotides in a sample of DNA. It is presently conducted using a modified PCR reaction where both normal and labeled
More informationData Mining Cluster Analysis: Basic Concepts and Algorithms. Lecture Notes for Chapter 8. Introduction to Data Mining
Data Mining Cluster Analysis: Basic Concepts and Algorithms Lecture Notes for Chapter 8 Introduction to Data Mining by Tan, Steinbach, Kumar Tan,Steinbach, Kumar Introduction to Data Mining 4/8/2004 Hierarchical
More informationDATA MINING CLUSTER ANALYSIS: BASIC CONCEPTS
DATA MINING CLUSTER ANALYSIS: BASIC CONCEPTS 1 AND ALGORITHMS Chiara Renso KDD-LAB ISTI- CNR, Pisa, Italy WHAT IS CLUSTER ANALYSIS? Finding groups of objects such that the objects in a group will be similar
More informationPhysical Data Organization
Physical Data Organization Database design using logical model of the database - appropriate level for users to focus on - user independence from implementation details Performance - other major factor
More informationOrdered Index Seed Algorithm for Intensive DNA Sequence Comparison
Ordered Index Seed Algorithm for Intensive DNA Sequence Comparison Dominique Lavenier IRISA / CNRS Campus de Beaulieu 35042 Rennes, France lavenier@irisa.fr Abstract This paper presents a seed-based algorithm
More information14.10.2014. Overview. Swarms in nature. Fish, birds, ants, termites, Introduction to swarm intelligence principles Particle Swarm Optimization (PSO)
Overview Kyrre Glette kyrrehg@ifi INF3490 Swarm Intelligence Particle Swarm Optimization Introduction to swarm intelligence principles Particle Swarm Optimization (PSO) 3 Swarms in nature Fish, birds,
More informationAn Introduction to Data Mining. Big Data World. Related Fields and Disciplines. What is Data Mining? 2/12/2015
An Introduction to Data Mining for Wind Power Management Spring 2015 Big Data World Every minute: Google receives over 4 million search queries Facebook users share almost 2.5 million pieces of content
More informationVIBE. Visual Integrated Bioinformatics Environment. Enter the Visual Age of Computational Genomics. Whitepaper
VIBE Visual Integrated Bioinformatics Environment Whitepaper Enter the Visual Age of Computational Genomics INCOGEN, Inc. 104 George Perry Williamsburg, VA 23185 www.incogen.com Phone: 757-221-0550 info@incogen.com
More information5. A full binary tree with n leaves contains [A] n nodes. [B] log n 2 nodes. [C] 2n 1 nodes. [D] n 2 nodes.
1. The advantage of.. is that they solve the problem if sequential storage representation. But disadvantage in that is they are sequential lists. [A] Lists [B] Linked Lists [A] Trees [A] Queues 2. The
More informationEMBOSS A data analysis package
EMBOSS A data analysis package Adapted from course developed by Lisa Mullin (EMBL-EBI) and David Judge Cambridge University EMBOSS is a free Open Source software analysis package specially developed for
More informationSupplementary Information
Supplementary Information S1: Degree Distribution of TFs in the E.coli TRN and CRN based on Operons 1000 TRN Number of TFs 100 10 y = 619.55x -1.4163 R 2 = 0.8346 1 1 10 100 1000 Degree of TFs CRN 100
More informationConvergence of Translation Memory and Statistical Machine Translation
Convergence of Translation Memory and Statistical Machine Translation Philipp Koehn and Jean Senellart 4 November 2010 Progress in Translation Automation 1 Translation Memory (TM) translators store past
More informationHIV NOMOGRAM USING BIG DATA ANALYTICS
HIV NOMOGRAM USING BIG DATA ANALYTICS S.Avudaiselvi and P.Tamizhchelvi Student Of Ayya Nadar Janaki Ammal College (Sivakasi) Head Of The Department Of Computer Science, Ayya Nadar Janaki Ammal College
More informationA java applet visualizing the Aho-Corasick can be found at: http://www-sr.informatik.uni-tuebingen.de/ buehler/ac/ac1.html
5 BLAST Dan Gusfield: Algorithms on Strings, Trees, and Sequences. Computer Science and Computational Biology. Cambridge University Press, Cambridge, 1997, pages 379ff. ISBN 0-521-58519-8 An earlier version
More informationLabGenius. Technical design notes. The world s most advanced synthetic DNA libraries. hi@labgeni.us V1.5 NOV 15
LabGenius The world s most advanced synthetic DNA libraries Technical design notes hi@labgeni.us V1.5 NOV 15 Introduction OUR APPROACH LabGenius is a gene synthesis company focussed on the design and manufacture
More informationBig Data and Scripting map/reduce in Hadoop
Big Data and Scripting map/reduce in Hadoop 1, 2, parts of a Hadoop map/reduce implementation core framework provides customization via indivudual map and reduce functions e.g. implementation in mongodb
More informationGraph Mining and Social Network Analysis
Graph Mining and Social Network Analysis Data Mining and Text Mining (UIC 583 @ Politecnico di Milano) References Jiawei Han and Micheline Kamber, "Data Mining: Concepts and Techniques", The Morgan Kaufmann
More informationCurrent Motif Discovery Tools and their Limitations
Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.
More informationKrishna Institute of Engineering & Technology, Ghaziabad Department of Computer Application MCA-213 : DATA STRUCTURES USING C
Tutorial#1 Q 1:- Explain the terms data, elementary item, entity, primary key, domain, attribute and information? Also give examples in support of your answer? Q 2:- What is a Data Type? Differentiate
More informationIntroduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
More informationSearching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
More informationWorksheet - COMPARATIVE MAPPING 1
Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that
More informationThey can be obtained in HQJHQH format directly from the home page at: http://www.engene.cnb.uam.es/downloads/kobayashi.dat
HQJHQH70 *XLGHG7RXU This document contains a Guided Tour through the HQJHQH platform and it was created for training purposes with respect to the system options and analysis possibilities. It is not intended
More informationMASCOT Search Results Interpretation
The Mascot protein identification program (Matrix Science, Ltd.) uses statistical methods to assess the validity of a match. MS/MS data is not ideal. That is, there are unassignable peaks (noise) and usually
More informationFinal Project Report
CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes
More informationEMBL-EBI Web Services
EMBL-EBI Web Services Rodrigo Lopez Head of the External Services Team SME Workshop Piemonte 2011 EBI is an Outstation of the European Molecular Biology Laboratory. Summary Introduction The JDispatcher
More informationFlexible Information Visualization of Multivariate Data from Biological Sequence Similarity Searches
Flexible Information Visualization of Multivariate Data from Biological Sequence Similarity Searches Ed Huai-hsin Chi y, John Riedl y, Elizabeth Shoop y, John V. Carlis y, Ernest Retzel z, Phillip Barry
More informationMaster's projects at ITMO University. Daniil Chivilikhin PhD Student @ ITMO University
Master's projects at ITMO University Daniil Chivilikhin PhD Student @ ITMO University General information Guidance from our lab's researchers Publishable results 2 Research areas Research at ITMO Evolutionary
More informationMultiple Sequence Alignment and Analysis: Part I An Introduction to the Theory and Application of Multiple Sequence Analysis.
Steven M. Thompson Manuscript for Multiple Sequence Alignment and Analysis Page 1 3/31/04 Multiple Sequence Alignment and Analysis: Part I An Introduction to the Theory and Application of Multiple Sequence
More informationSTATISTICA Formula Guide: Logistic Regression. Table of Contents
: Table of Contents... 1 Overview of Model... 1 Dispersion... 2 Parameterization... 3 Sigma-Restricted Model... 3 Overparameterized Model... 4 Reference Coding... 4 Model Summary (Summary Tab)... 5 Summary
More informationUsing Illumina BaseSpace Apps to Analyze RNA Sequencing Data
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless
More information