1) Functions of living things (grow, reproduce, respond to stimulus) 2) Basic cell structures cytoplasm, cell membrane, DNA

Transcription

1 CELL THEORY AND CELL ORGANELLES 1. List the three statements of the cell theory. 3 rd 9-WEEKS STUDY GUIDE 1) All living things made of cells. 2) Cells are the basic units of structure and function in living things. 3) New cells are produced from existing cells. 2. Every cell has to have 3 structures. What are they? Cytoplasm, Cell Membrane, DNA 3. List at least 2 differences between Prokaryotes and Eukaryotes. Prok s are small and simple; Euk s large and complex Prok s = no nucleus; Euk s = nucleus and other organelles. 4. List at least 2 similarities between Prok s and Euk s. 1) Functions of living things (grow, reproduce, respond to stimulus) 2) Basic cell structures cytoplasm, cell membrane, DNA 5. Complete the following chart on cell organelles. Organelle Structure Function Usually round and centrally located controls most cell processes Nucleus nuclear membrane nucleolus System of membranes with many folds TRANSPORTS proteins inside the ER Rough ER have ribosomes stuck to it; cell Smooth ER does not bead-like ***MAKES PROTEINS*** Ribosome can be attached to ER or free in the cytoplasm Golgi Layers or stacks of folded membranes Layers or stacks of folded Apparatus membranes Small, round with a double membrane BREAKS DOWN and recycles Lysosome parts from dead organelles BREAKS DOWN large food particles Vacuole Sac-like STORAGE of materials Outer double membrane ***Site of photosynthesis*** Chloroplast large internal stacks of photosynthetic membranes kidney bean shaped ***Site of cellular respiration*** Mitochondria Smooth outer membrane Folded inner membrane 6. Identify at least 2 differences between plant cells and animal cells. Plant cells have a cell wall, chloroplast, 1 large vacuole. Animal cells have no cell wall or chloroplast and several smaller vacuoles.

2 Movement Across the Cell Membrane 1. What is the function of the cell membrane? Controls what enters and leaves the cell 2. Draw and label a picture of the cell membrane (zoomed in on a molecular level NOT JUST AN OUTLINE OF A CELL!!!) 3. Find the concentrations of the following solutions: a. 82 g of salt dissolved in 250 ml of water b. 500 ml of water with 338 g of sugar mixed in. c. 4.5 g of Kool-Aid in 1.89 L of water. 4. Define the following terms: a. Permeable able to go through b. Impermeable can t go through c. Selectively Permeable some stuff can go through but not everything. 5. Define the following types of movement: a. Diffusion movement from high concentration to low concentration b. Osmosis diffusion of water (move to the higher of concentration of solutes) c. Facilitated Diffusion diffusion with a channel protein 6. These types of movement are considered Passive Transport. What does this mean? NO ENERGY REQUIRED FROM THE CELL

3 7. Imagine that we have a beaker divided in half by a selectively permeable membrane. The membrane is permeable to salt, sugar, and water, but is impermeable to everything else. The beaker is filled with 400 ml of water. a. We add 46 g of salt to the left side of the beaker. What will the concentration be on that side? 46g / 200mL =.23 g/ml b. We add 84 g of salt to the right side of the beaker. What will the concentration be on that side? 84g / 200 ml =.42 g/ml c. What type of movement will take place (D, FD, or O)? In what direction (left or right)? DIFFUSION - LEFT d. What will be the equilibrium concentration?.23 g/ml +.42 g/ml =.65 g/ml / 2 =.325 g/ml 8. For each of the following, tell (1) what type of movement will take place, (2) which direction it will go, and (3) what the equilibrium concentration will be. a. The concentration of a molecule inside the cell is 492 g/ml. Outside, the concentration is 268 g/ml. The membrane is permeable to this molecule. D OUT ( )/2 = 380 g/ml b. The concentration of a molecule inside the cell is 2.6 g/ml. Outside, the concentration is 22.1 g/ml. The membrane is impermeable to this molecule. O WATER OUT g/ml c. The concentration of a molecule inside the cell is g/ml. Outside, the concentration is 12.4 g/ml. The membrane is permeable to this molecule. D IN g/ml d. The concentration of a molecule inside the cell is 0.4 g/ml. Outside, the concentration is 0.28 g/ml. The membrane is impermeable to this molecule, but there is a channel protein. FD OUT.34 g/ml e. The concentration of a molecule inside the cell is 23 g/ml. Outside, the concentration is 30 g/ml. The membrane is impermeable to this molecule. O WATER OUT 26.5 g/ml

4 9. Complete the following chart on osmosis: Type of Where is the What will happen to Solution concentration higher? the cell? Hypotonic Draw a picture of the cell in this type of solution. Hypertonic Isotonic 10. List the 3 types of Active Transport we discussed in class. 1) Protein Pumps 2) Endocytosis 3) Exocytosis 11. What is the difference in Passive Transport and Active Transport? 1) Active Transport requires energy; passive transport does not. 2) Passive transport goes from high conc. to low; active goes from low conc. to high CELL CYCLE 1. Describe the 4 steps of the cell cycle. Draw a diagram that shows them in order. G1 cell grows and gets ready to copy DNA S cell copies its DNA G2 cell grows and gets ready to divide M cell division 2. What happens during G0? The cell breaks off from the normal cell cycle and does its job. 3. G1, S, and G2 all together can be called INTERPHASE. 4. List and describe the 5 stages of mitosis. - PROPHASE chromosomes form; spindles form; nuclear membrane breaks down - METAPHASE chromosomes line up in middle of cell - ANAPHASE sister chromatids are pulled apart toward the poles of the cell - TELOPHASE chromatids arrive at poles; spindle breaks down; new nuclear membranes form - CYTOKINESIS cytoplasm pinches in until 2 new cells are formed.

5 5. Draw a picture of a cell as it goes through the whole cell cycle (including the individual steps of mitosis). Start with a brand new cell just out of mitosis and end with 2 new daughter cells at the end of mitosis.

6 6. In what type of cells does meiosis occur? gametes reproductive cells 7. List the steps of meiosis. Draw a diagram of a cell in each phase. 8. Complete the following table that compares and contrasts mitosis and meiosis: MITOSIS MEIOSIS Number of parent cells 1 1 Number of daughter cells formed 2 4 Daughter cells identical to parent? Yes No Number of phases 4/5 8/9 Number of chromosomes in each daughter (same as parent, 1/2 of parent's) Same Half

7 DNA TO PROTEIN 1. Describe the structure AND function of DNA. Structure double helix made of nucleotides joined together; sides of ladder formed by sugar-phosphate bonding; rungs of ladder made by base pairing. Function - instructions for building proteins 2. Draw and label the parts of a nucleotide. 3. List 3 differences between DNA and RNA. - DNA is double stranded, RNA is single stranded - DNA has the sugar deoxyribose ; RNA has the sugar ribose - DNA has the nitrogen base Thymine (T); RNA has the nitrogen base Uracil (U) instead 4. What is transcription? - rewriting in a different form of the same language (DNA to RNA) 5. What is translation? - rewriting in a different language (RNA to protein) 6. Use the rules of base pairing to sequence the other side of these DNA strands: a) G A C A T C G G T T C A G C A A A C T G A A G C T G T AGCCAAGT CGTTTGACTTC b) CCTGACTTGTAAGACTAGACCGA G GACTGAACATTCTGATCTGGCT 7. Use the rules of base pairing to transcribe the following pieces of DNA to RNA: a) CCTGACTTGTAAGACTAGACCGA G GACUGAACAUUGUGAUCUGGCU b) G A C A T C G G T T C A G C A A A C T G A A G CUGUAGCCAAGUCGUUUGACUUC 8. Use the genetic code to translate the following pieces of RNA to protein: a) CGUU C C A A G G C A CAGU C C A G U arg. ser. lys. ala. gln. ser. ser. b) G G C A C A U A C CUACGUG C A CAU gly. thr. tyr. leu. arg. ala. his.

8 9. Transcribe and translate the following pieces of DNA to protein: A ) CTACGATTCGAACCTGACTACG G AUGCUAAGCUUGGACUGAUGC asp. ala. lys. leu. gly. leu. met. B) G T A C A C G T G G C A C T G G T A C A TA CAUGUGCACCGUGACCAUGUAU his. val. his. arg. asp. his. val.