The Human Genome Project and Genomics

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "The Human Genome Project and Genomics"

Transcription

1 Genomic Sequencing is an Extension of Genetic Mapping The Human Genome Project and Genomics Chapter 15! Mutant genes are the basis of genetic disorders! Mapping helps identify genes that cause disease The first step in developing diagnostic tests and treatments for these disorders! Linkage Two or more genes located on the same chromosome that tend to be inherited together Linkage Between Nail-Patella Syndrome and ABO Blood Type Crossing-Over Between Homologous Chromosomes in Meiosis

2 Linked Genes on the Same Chromosome! Crossover frequencies are used to construct genetic maps, giving the order and distance between genes on the chromosome Recombinant DNA Technology Changes Gene-Mapping! Positional cloning mapping and cloning genes with no prior information about the gene product or its function Inheritance of molecular markers is used to follow the inheritance of genetic disorders in pedigrees Some Genes Identified by Positional Cloning Genetic Map of Human Chromosome 1

3 Organisms Included in the Human Genome Project History of the Human Genome Project New Scientific Fields Goals of Genomics! Genomics The study of the organization, function, and evolution of genomes! Bioinformatics The use of software, computational tools, and databases to acquire, store, analyze, and visualize the information from genomics

4 Methods of Sequencing DNA Methods of Sequencing DNA! To sequence a small amount of DNA, DNA bases (A, T, C, G) are tagged with a radioisotope and combined with DNA fragments, which are then separated by size onto a gel with four lanes! To sequence an entire genome, the process is automated; each base is labeled with a different fluorescent dye which can be read in a single lane by a scanner linked to a computer Bioinformatics: Storing and Accessing Genetic Information Genomics: Sequencing, Identifying, and Mapping Genes! Genomes are stored in databases; the human genome contains over 3 billion nucleotides! Geneticists developed two strategies for genome sequencing The government s genome project used the clone-by-clone method The privately-funded Celera genome project used the shotgun method

5 The Clone-by-Clone Method Shotgun Cloning! Clone-by-clone method A method of genome sequencing that begins with genetic and physical maps Uses clones from a genomic library that have been arranged to cover an entire chromosome After the order of clones is known, they are sequenced! Shotgun sequencing A method of genome sequencing that selects clones at random from a genomic library After the clones are sequenced, assembly software organizes them into the genomic sequence Clone-by-Clone and Shotgun Sequencing Completing the Genome! The bacterium Haemophilus influenzae was the first organism to have its genome sequenced! Drafts of the human genome were published in 2001and 2003; neither project sequenced the 15% of the genome in heterochromatic regions Government s Approach Celera s Approach

6 Annotation is Used to Find Where Genes Are! Annotation Analysis of genomic nucleotide sequence data to identify protein-coding genes, non-protein-coding genes, their regulatory sequences and functions Only 5% of human DNA encodes genes How are Genes Identified in a DNA Sequence?! If a DNA sequence encodes a protein, its nucleotide sequence is an open reading frame! Open reading frame (ORF) Codons in a gene that encode the amino acids of the gene product Control sequences (CAAT, CCAAT) at the beginning of genes - promoter; splice sites between exons and introns; terminator sequences Genetic Sequence from Hemoglobin! Splice junctions between introns and exons (blue); site where transcription begins (green) Geneticists Discover Gene Functions and Products! After a gene has been identified by annotation, its amino acid sequence is derived and compared with sequences already in protein databases! So far, functions have been assigned to about 60% of known genes

7 Functional Assignments for the Human Genome What Have We Learned So Far About the Human Genome?! Only about 5% of our 3 billion nucleotides of DNA encode genetic information! Genes are distributed unequally on chromosomes Clusters are separated by gene-poor bands! Humans have 20,000 to 25,000 genes Far fewer than the predicted 80,000 to 100,000 What Have We Learned So Far about the Human Genome? Comparison of Selected Genomes! There are more proteins in the body than genes mrnas are processed in many ways so 20,000 to 25,000 genes can produce 300,000 proteins! Genomes of humans and other higher organisms are similar We share half our genes with the fruit fly and more than 90% with mice

8 Using Genomics and Bioinformatics to Study a Human Genetic Disorder! Where is the gene located?! What is the normal function of the protein encoded by this gene?! How does the mutant gene or protein produce the disease phenotype? Mapping Genes and Gene Function! The cystic fibrosis gene was easy to map, convert to amino-acid sequence, and determine its function, but more than half of identified genes have no known function Proteomics is an Extension of Genomics Role of Proteomics! Proteomics is the study of the structure and function of proteins, which is important in development of new diagnostic tests and drugs! Proteomics Study of expressed proteins in a cell at a specific time under a particular set of circumstances! Understanding gene function and its changing role in development and aging! Identifying proteins that are biomarkers for diseases; used to develop diagnostic tests! Finding proteins for development of drugs to treat diseases and genetic disorders

9 Proteins Expressed in a Cell! Separated by size and electric charge and displayed on a gel Ethical Concerns about Human Genomics! To deal with the impact of genomic information on society, the HGP set up the ELSI (Ethical, Legal, and Social Implications) program to ensure that genetic information would be safeguarded, not used in discriminatory ways! ELSI works to develop policy guidelines for the use of genomic information New Developments Needed in Genomics Genetics in Society: Who Owns Your Genome?! When John Moore had his spleen removed due to a rare form of cancer, his doctor patented a cell line and products derived from the spleen! When Moore sued to share in the profits, the court ruled that patients had no property rights over tissues removed from their bodies

The Human Genome Project

The Human Genome Project The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?

More information

14.3 Studying the Human Genome

14.3 Studying the Human Genome 14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question. Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

Biological Sciences Initiative. Human Genome

Biological Sciences Initiative. Human Genome Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.

More information

Human Genome and Human Genome Project. Louxin Zhang

Human Genome and Human Genome Project. Louxin Zhang Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

Genomes and SNPs in Malaria and Sickle Cell Anemia

Genomes and SNPs in Malaria and Sickle Cell Anemia Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing

More information

BioBoot Camp Genetics

BioBoot Camp Genetics BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before

More information

Chromosomes, Mapping, and the Meiosis Inheritance Connection

Chromosomes, Mapping, and the Meiosis Inheritance Connection Chromosomes, Mapping, and the Meiosis Inheritance Connection Carl Correns 1900 Chapter 13 First suggests central role for chromosomes Rediscovery of Mendel s work Walter Sutton 1902 Chromosomal theory

More information

Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009

Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Genome and DNA Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Admin Reading: Chapters 1 & 2 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring09/bme110-calendar.html

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

The correct answer is c A. Answer a is incorrect. The white-eye gene must be recessive since heterozygous females have red eyes.

The correct answer is c A. Answer a is incorrect. The white-eye gene must be recessive since heterozygous females have red eyes. 1. Why is the white-eye phenotype always observed in males carrying the white-eye allele? a. Because the trait is dominant b. Because the trait is recessive c. Because the allele is located on the X chromosome

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

1865 Discovery: Heredity Transmitted in Units

1865 Discovery: Heredity Transmitted in Units 1859 Discovery: Natural Selection Genetic Timeline Charles Darwin wrote On the Origin of Species by Means of Natural Selection, or the Preservation of Favored Races in the Struggle for Life. 1865 Discovery:

More information

Final Project Report

Final Project Report CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes

More information

Genetics Test Biology I

Genetics Test Biology I Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Genetic testing. The difference diagnostics can make. The British In Vitro Diagnostics Association

Genetic testing. The difference diagnostics can make. The British In Vitro Diagnostics Association 6 Genetic testing The difference diagnostics can make The British In Vitro Diagnostics Association Genetic INTRODUCTION testing The Department of Health published Our Inheritance, Our Future - Realising

More information

Worksheet - COMPARATIVE MAPPING 1

Worksheet - COMPARATIVE MAPPING 1 Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

PROYECTO GENOMA HUMANO. Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA

PROYECTO GENOMA HUMANO. Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA PROYECTO GENOMA HUMANO Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA GENOMA HUMANO Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA Some landmarks on the way to 1940s

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

12.1 The Role of DNA in Heredity

12.1 The Role of DNA in Heredity 12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

The Human Genome Project. From genome to health From human genome to other genomes and to gene function Structural Genomics initiative

The Human Genome Project. From genome to health From human genome to other genomes and to gene function Structural Genomics initiative The Human Genome Project From genome to health From human genome to other genomes and to gene function Structural Genomics initiative June 2000 What is the Human Genome Project? U.S. govt. project coordinated

More information

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:

More information

Bob Jesberg. Boston, MA April 3, 2014

Bob Jesberg. Boston, MA April 3, 2014 DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

Chapter 9 Patterns of Inheritance

Chapter 9 Patterns of Inheritance Bio 100 Patterns of Inheritance 1 Chapter 9 Patterns of Inheritance Modern genetics began with Gregor Mendel s quantitative experiments with pea plants History of Heredity Blending theory of heredity -

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Searching Nucleotide Databases

Searching Nucleotide Databases Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames

More information

(1-p) 2. p(1-p) From the table, frequency of DpyUnc = ¼ (p^2) = #DpyUnc = p^2 = 0.0004 ¼(1-p)^2 + ½(1-p)p + ¼(p^2) #Dpy + #DpyUnc

(1-p) 2. p(1-p) From the table, frequency of DpyUnc = ¼ (p^2) = #DpyUnc = p^2 = 0.0004 ¼(1-p)^2 + ½(1-p)p + ¼(p^2) #Dpy + #DpyUnc Advanced genetics Kornfeld problem set_key 1A (5 points) Brenner employed 2-factor and 3-factor crosses with the mutants isolated from his screen, and visually assayed for recombination events between

More information

DNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences

DNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences DNA and the Cell Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Version 2.3 English version ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia and

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

Automated DNA sequencing 20/12/2009. Next Generation Sequencing

Automated DNA sequencing 20/12/2009. Next Generation Sequencing DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing

More information

BI122 Introduction to Human Genetics, Fall 2014

BI122 Introduction to Human Genetics, Fall 2014 BI122 Introduction to Human Genetics, Fall 2014 Course Overview We will explore 1) the genetic and molecular basis of heredity and inherited traits, 2) how genetics & genomics reveals an understanding

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

SNP Essentials The same SNP story

SNP Essentials The same SNP story HOW SNPS HELP RESEARCHERS FIND THE GENETIC CAUSES OF DISEASE SNP Essentials One of the findings of the Human Genome Project is that the DNA of any two people, all 3.1 billion molecules of it, is more than

More information

The world of non-coding RNA. Espen Enerly

The world of non-coding RNA. Espen Enerly The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often

More information

Course Curriculum for Master Degree in Medical Laboratory Sciences/Clinical Biochemistry

Course Curriculum for Master Degree in Medical Laboratory Sciences/Clinical Biochemistry Course Curriculum for Master Degree in Medical Laboratory Sciences/Clinical Biochemistry The Master Degree in Medical Laboratory Sciences /Clinical Biochemistry, is awarded by the Faculty of Graduate Studies

More information

Chapter 5: Organization and Expression of Immunoglobulin Genes

Chapter 5: Organization and Expression of Immunoglobulin Genes Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed

More information

Basic Concepts of DNA, Proteins, Genes and Genomes

Basic Concepts of DNA, Proteins, Genes and Genomes Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate

More information

DNA Sequencing & The Human Genome Project

DNA Sequencing & The Human Genome Project DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this

More information

Test Two Study Guide

Test Two Study Guide Test Two Study Guide 1. Describe what is happening inside a cell during the following phases (pictures may help but try to use words): Interphase: : Consists of G1 / S / G2. Growing stage, cell doubles

More information

The National Institute of Genomic Medicine (INMEGEN) was

The National Institute of Genomic Medicine (INMEGEN) was Genome is...... the complete set of genetic information contained within all of the chromosomes of an organism. It defines the particular phenotype of an individual. What is Genomics? The study of the

More information

CHROMOSOMES AND INHERITANCE

CHROMOSOMES AND INHERITANCE SECTION 12-1 REVIEW CHROMOSOMES AND INHERITANCE VOCABULARY REVIEW Distinguish between the terms in each of the following pairs of terms. 1. sex chromosome, autosome 2. germ-cell mutation, somatic-cell

More information

Human Genetics: Online Resources

Human Genetics: Online Resources Human Genetics: Online Resources David A Adler, ZymoGenetics, Seattle, Washington, USA There is a large source of information concerning human genetics available on a variety of different Internet sites,

More information

Cancer Genomics: What Does It Mean for You?

Cancer Genomics: What Does It Mean for You? Cancer Genomics: What Does It Mean for You? The Connection Between Cancer and DNA One person dies from cancer each minute in the United States. That s 1,500 deaths each day. As the population ages, this

More information

Control of Gene Expression

Control of Gene Expression Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

The Making of the Fittest: Evolving Switches, Evolving Bodies

The Making of the Fittest: Evolving Switches, Evolving Bodies OVERVIEW MODELING THE REGULATORY SWITCHES OF THE PITX1 GENE IN STICKLEBACK FISH This hands-on activity supports the short film, The Making of the Fittest:, and aims to help students understand eukaryotic

More information

Concluding lesson. Student manual. What kind of protein are you? (Basic)

Concluding lesson. Student manual. What kind of protein are you? (Basic) Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

CTY Genetics Syllabus

CTY Genetics Syllabus CTY Genetics Syllabus Week 1: Review and Mendelian Genetics What (DUE DATE) 1 Introduction and Review Morning Classroom Policies/ Ice Breaker Game/Introductions Syllabus Distribute Syllabus, Discuss Course

More information

Genetic Testing in Research & Healthcare

Genetic Testing in Research & Healthcare We Innovate Healthcare Genetic Testing in Research & Healthcare We Innovate Healthcare Genetic Testing in Research and Healthcare Human genetic testing is a growing science. It is used to study genes

More information

Genetics 1. Defective enzyme that does not make melanin. Very pale skin and hair color (albino)

Genetics 1. Defective enzyme that does not make melanin. Very pale skin and hair color (albino) Genetics 1 We all know that children tend to resemble their parents. Parents and their children tend to have similar appearance because children inherit genes from their parents and these genes influence

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

What makes cells different from each other? How do cells respond to information from environment?

What makes cells different from each other? How do cells respond to information from environment? What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

The RNA strategy. RNA as a tool and target in human disease diagnosis and therapy.

The RNA strategy. RNA as a tool and target in human disease diagnosis and therapy. The RNA strategy RNA as a tool and target in human disease diagnosis and therapy. The Laboratory of RNA Biology and Biotechnology at the Centre for Integrative Biology (CIBIO) of the University of Trento,

More information

Technology funding opportunities at the National Cancer Institute

Technology funding opportunities at the National Cancer Institute Technology funding opportunities at the National Cancer Institute Through the Cancer Diagnosis Program http://cancerdiagnosis.nci.nih.gov/index.html Avraham Rasooly Ph.D. National Cancer Institute, Cancer

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Genetics 301 Sample Final Examination Spring 2003

Genetics 301 Sample Final Examination Spring 2003 Genetics 301 Sample Final Examination Spring 2003 50 Multiple Choice Questions-(Choose the best answer) 1. A cross between two true breeding lines one with dark blue flowers and one with bright white flowers

More information

RNA and Protein Synthesis

RNA and Protein Synthesis Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic

More information

Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat

Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat Bioinformatique et Séquençage Haut Débit, Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat 1 RNA Transcription to RNA and subsequent

More information

Von Mäusen und Menschen E - 1

Von Mäusen und Menschen E - 1 Von Mäusen und Menschen E - 1 Mus musculus: Genetic Portrait of the House Mouse E - 3 Outline Mouse genome Mouse life cycle Transgenic protocols Addition of genes by nuclear injection Removal of genes

More information

Arabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham

Arabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham Arabidopsis A Practical Approach Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham OXPORD UNIVERSITY PRESS List of Contributors Abbreviations xv xvu

More information

Biological Sequence Data Formats

Biological Sequence Data Formats Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA

More information

Question 4 /29 points. Total /100 points

Question 4 /29 points. Total /100 points MIT Department of Biology 7.28, Spring 2005 - Molecular Biology 7.28 Spring 2005 Exam Three Question 1 Question 2 Question 3 /30 points /20 points /21 points Question 4 /29 points Total /100 points 1 Question

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

The following chapter is called "Preimplantation Genetic Diagnosis (PGD)".

The following chapter is called Preimplantation Genetic Diagnosis (PGD). Slide 1 Welcome to chapter 9. The following chapter is called "Preimplantation Genetic Diagnosis (PGD)". The author is Dr. Maria Lalioti. Slide 2 The learning objectives of this chapter are: To learn the

More information

Immunology Ambassador Guide (updated 2014)

Immunology Ambassador Guide (updated 2014) Immunology Ambassador Guide (updated 2014) Immunity and Disease We will talk today about the immune system and how it protects us from disease. Also, we ll learn some unique ways that our immune system

More information

Clinical Research Infrastructure

Clinical Research Infrastructure Clinical Research Infrastructure Enhancing UK s Clinical Research Capabilities & Technologies At least 150m to establish /develop cutting-edge technological infrastructure, UK wide. to bring into practice

More information

What Is Genetic Counseling? Helping individuals and families understand how genetics affects their health and lives

What Is Genetic Counseling? Helping individuals and families understand how genetics affects their health and lives What Is Genetic Counseling? Helping individuals and families understand how genetics affects their health and lives What does the career involve? Explore family histories to identify risks Reducing risks

More information

History of DNA Sequencing & Current Applications

History of DNA Sequencing & Current Applications History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied

More information

First generation" sequencing technologies and genome assembly. Roger Bumgarner Associate Professor, Microbiology, UW Rogerb@u.washington.

First generation sequencing technologies and genome assembly. Roger Bumgarner Associate Professor, Microbiology, UW Rogerb@u.washington. First generation" sequencing technologies and genome assembly Roger Bumgarner ssociate Professor, Microbiology, UW Rogerb@u.washington.edu Why discuss a technology that appears to be being replaced? Next

More information

2 The Human Genome Project

2 The Human Genome Project 2 The Human Genome Project LAP CHEE TSUI STEVE W. SCHERER Toronto, Canada 1 Introduction 42 2 Chromosome Maps 42 2.1 Genetic Maps 43 2.2 Physical Maps 44 3 DNA Sequencing 45 3.1 cdna Sequencing 47 3.2

More information

An Overview of DNA Sequencing

An Overview of DNA Sequencing An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure

More information

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web

More information

Genome 361: Fundamentals of Genetics and Genomics Fall 2015

Genome 361: Fundamentals of Genetics and Genomics Fall 2015 Genome 361: Fundamentals of Genetics and Genomics Fall 2015 Instructor Frances Cheong, kcheong3@uw.edu Teaching Assistants Michael Bradshaw, mjb34@uw.edu Colby Samstag, csamstag@uw.edu Emily Youngblom,

More information

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,

More information

Chapter 18 Regulation of Gene Expression

Chapter 18 Regulation of Gene Expression Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection

More information

An Introduction to Genomics and SAS Scientific Discovery Solutions

An Introduction to Genomics and SAS Scientific Discovery Solutions An Introduction to Genomics and SAS Scientific Discovery Solutions Dr Karen M Miller Product Manager Bioinformatics SAS EMEA 16.06.03 Copyright 2003, SAS Institute Inc. All rights reserved. 1 Overview!

More information

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information