Identification of Different Classes of Luminal Progenitor Cells within Prostate Tumors
|
|
- Muriel Chase
- 7 years ago
- Views:
Transcription
1 Cell Reports Supplemental Information Identification of Different Classes of Luminal Progenitor Cells within Prostate Tumors Supreet Agarwal, Paul G. Hynes, Heather S. Tillman, Ross Lake, Wassim G. Abou-Kheir, Lei Fang, Orla M. Casey, Amir H. Ameri, Philip L. Martin, Juan Juan Yin, Phillip J. Iaquinta, Wouter R. Karthaus, Hans C. Clevers, Charles L. Sawyers, and Kathleen Kelly
2 Figure S1, related to Figure 1 WT Pten -/-,TP53 -/- Sca-1 - PE EpCAM - APC WT Pten -/-,TP53 -/- CD24 - PE EpCAM - APC
3 Figure S2, related to Figure 1 FACS Gating Strategy Viability Doublet Discrimination Lineage neg Selection Post-Sort Purity Scans Pre-Sort Sample CD49f hi CD49f - PE CD49f - PE PROM1 + PROM1 - APC EpCAM pos Selection CD49f lo PROM1 - APC
4 Figure S3, related to Figures 2, CD49f hi Sphere Formation PROM1 + Ductal Structure Formation PHASE PHASE
5 Figure S4, related to Figure 4 KRT8 PROM1 + Adenosquamous Tumor KRT5 DAPI KRT5/KRT8/DAPI
6 Figure S5, related to Figure 6 A B % ClC3 Positive Cell mrna Levels Clu Intact Castrated Post castration (days) 0.0 CD49f hi PROM1 + CD49f lo Cell Fraction TP63 C %OFU NS 40 Intact Castrated CD49f hi mrna Levels CD49f hi PROM1 + CD49f lo Cell Fraction Intact Castrated
7 SUPPLEMENTAL FIGURE LEGENDS Figure S1. FACS separation profiles for SCA-1 and CD24. Representative FACS plots of Sca-1 and EpCAM (top panel) and CD24 and EpCAM (bottom panel) co-staining of primary WT and Pten -/-,TP53 -/- prostate cells. Figure S2. FACS gating strategy. FACS gating strategy for isolation of primary Pten -/-,TP53 -/- prostate cells based on CD49f and PROM1 expression. Post-purity scans demonstrate purity of cell fractions. Figure S3. Time lapse images of organoid development. (A) Time-lapse images of Pten -/-,TP53 -/ - CD49f hi organoid formation. (B) Time-lapse images of Pten -/-,TP53 -/ - PROM1 + organoid formation leading to a twined structure. Organoid formation was imaged hourly over 4 days. Representative images are shown at 6 hour increments over 4 days. Figure S4. Individual keratin staining profiles in an adenosquamous tumor. KRT5, KRT8, and DAPI labeling of a representative adenosquamous tumor section. Note double-labeled cells within several areas of adenocarcinoma and squamous transitions (arrowheads). Figure S5. Histopathological and gene expression consequences of castration in Pten - /- Tp53 -/- tumors. (A) Quantification of cleaved CASP3 (ClC3) positive cells in Pten -/-,Tp53 -/- prostate tissue between 0-42 days post-castration. (B) qrt-pcr analysis of Clu and TP63 expression in CD49f hi, PROM1 + and CD49f lo cell fractions obtained from intact and 14 day castrated Pten -/-,Tp53 -/- prostate tissue. (C) G1 organoid formation from intact and castrated Pten -/-,Tp53 -/- CD49f hi cells. Data is reported as mean % OFU ± SEM. Movie S1 Time-lapse movie of CD49f hi organoid growth. Growth was captured hourly over 105 hours. Movie S2 Time-lapse movie of Prom-1 + organoid growth. Growth was captured hourly over 105 hours.
8 Table S1 Primer Itga6 (CD49f) For Itga6 (CD49f) Rev PROM1 For PROM1 Rev KRT 5 For KRT 5 Rev KRT 14 For KRT 14 Rev KRT 18 For KRT 18 Rev TP63 For TP63 Rev GAPDH For GAPDH Rev Clu For Clu Rev FKBP5 For FKBP5 Rev Sequence ACGGTGTTTCCCTCAAAGAC GAAGAAGCCACACTTCCACA CACCAACACCAAGAACAAGG TTGGTCTGTTTGATGGCTGT AACGTCAAGAAGCAGTGTGC TCCAGCTCTGTCAGCTTGTT GATGACTTCCGGACCAAGTT TGAGGCTCTCAATCTGCATC TTGCGAATTCTGTGGACAAT ATCTACCACCTTGCGGAGTC CAGTCAAGCACTGCCAAGTC CATCACCTTGATCTGGATGG CAGAACATCATCCCTGCATC CTGCTTCACCACCTTCTTGA GCCAGCAGCTAGAGGAGTTT CATCCAGGACTTGGCTCTG CTGTGGTGGAAGGACATTTG AAACCATAGCGTGGTCCAA
9 Table S2 Antibody Target Supplier & Cat # KRT5 Covance (PRB-160P) ; (SIG-3475) KRT8 Covance (MMS-162P) PTEN Cell Signaling (9188) TP63 Santa Cruz (sc-8431) ; (sc-8343) AR Abcam (ab133273) KI67 Cell Signaling (9449) Cleaved CASPASE 3 Cell Signaling (9661) S6 240 Cell Signaling (4838)
10 SUPPLEMENTAL EXPERIMENTAL PROCEDURES RNA Extraction, cdna Amplification and Quantitative Real-Time PCR RNA extraction, cdna synthesis and qrt-pcr were performed as previously described (Casey et al., 2012). Primers used are listed in Supplementary Table 1. Subcutaneous Tumor Initiation Assays FACS sorted cells were counted and re-suspended in PrEGM medium (Lonza) with 50% MatrigelTM (BD Biosciences). All subcutaneous injections were performed in four to six week old NOD/SCID mice. Mice that showed no evidence of tumor formation after 9 months were considered negative for tumor initiation. Histology, Immunohistochemistry and Immunofluoresence. Cells were prepared for cytospin staining as previously described (Abou-Kheir et al.). Preparation of prostate tissue and subcutaneous tumors for histological analysis was performed as previously described (Abou-Kheir et al., 2010). Immunohistochemical and immunofluorescence staining was performed as previously described (Abou-Kheir et al., 2010). Antibodies used for staining are listed in Supplementary Table 2. Confocal microscopy was performed using a Carl Zeiss LSM 510 Meta Mk4 confocal microscope with a Plan-Apochromat 63x/, NA 1.40 DIC oil objective. Images were acquired and analysed using Carl Zeiss LSM image software. Time-lapse imaging was performed using an Olympus Viva View FL Incubator Microscope with a 40X UPLSAPO40X, NA 0.95 objective. Images were acquired using Olympus metamorph software. Brightfield and multi-channel fluorescence imaging was performed using either a Carl Zeiss Axio Observer.Z71 inverted microscope with EC Plan Neofluar 40x,
11 NA 1.3 oil and N-Achroplan 10x, NA 0.25 objective and Axiovision software; a Carl Zeiss Axio Imager.1 microscope with Plan Neofluar 40X, NA 0.7 objective and Axiovision software; or a Carl Zeiss Axio Scan.Z1 slide scanner with a Plan-Apochromat 20X, NA 0.8 objective and Zen software. 2
Supplemental Information. McBrayer et al. Supplemental Data
1 Supplemental Information McBrayer et al. Supplemental Data 2 Figure S1. Glucose consumption rates of MM cell lines exceed that of normal PBMC. (A) Normal PBMC isolated from three healthy donors were
More informationONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue
ONLINE SUPPLEMENTAL MATERIAL Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue Sungmi Park 1, Ko-Ting Lu 1, Xuebo Liu 1, Tapan K. Chatterjee 2, Steven M. Rudich 3, Neal
More informationThe heart specimens were fixed with formalin, embedded in paraffin, and sectioned at 6-
Hsu et al. 2010/958033 R2 SUPPLEMENTAL MATERIALS Supplemental methods: Immunohistochemistry The heart specimens were fixed with formalin, embedded in paraffin, and sectioned at 6- μm thickness. Formalin-fixed
More informationUNIVERSITY OF WROCŁAW
BIO-IMAGing in research INnovation and Education UNIVERSITY OF WROCŁAW Faculty of Biotechnology Tamka 2, Przybyszewskiego 63/77, WROCŁAW, POLAND Legend I. Confocal system (LSM510 META - Zeiss) - Laboratory
More informationREAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
More informationCD22 Antigen Is Broadly Expressed on Lung Cancer Cells and Is a Target for Antibody-Based Therapy
CD22 Antigen Is Broadly Expressed on Lung Cancer Cells and Is a Target for Antibody-Based Therapy Joseph M. Tuscano, Jason Kato, David Pearson, Chengyi Xiong, Laura Newell, Yunpeng Ma, David R. Gandara,
More informationHow To Get A Cell Print
QUICK CELL CAPTURE AND CHARACTERIZATION GUIDE FOR CELLSEARCH CUSTOMERS CellSave EDTA Blood sample Rare cell capture Enumeration Single protein marker Cell capture for molecular characterization CELLSEARCH
More informationZeiss Axioimager M2 microscope for stereoscopic analysis.
Zeiss Axioimager M2 microscope for stereoscopic analysis. This system is fully motorized and configured with bright field and multi-channel fluorescent. It works with Stereo Investigator, Neurolucida,
More informationA. FSC and SSC gating of total BM cells. B. Gating strategy used to identify the Lin -
Supplementary Figure legends Figure S1. Multiparametric analysis of HSC Populations. A. FSC and SSC gating of total BM cells. B. Gating strategy used to identify the Lin - cell population. BM cells were
More informationREAL TIME PCR SYBR GREEN
REAL TIME PCR SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM QUANTITATION
More informationP4 Distribution of Cetuximab in Models of Human Lung Cancer
Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, University of Tübingen, Robert Bosch Foundation Stuttgart, Germany FORSYS Partner Project Predictive Cancer Therapy Project Meeting 14.10.09
More informationEssentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
More informationCell, Tissue and Tumor Kinetics
Cell, issue and umor Kinetics Proliferation Kinetics: rate of growth of a population, change in total cell number. Adult tissues are in homeostasis. Children (and tumors) grow. I. Quantitative Assessment
More informationsirna Duplexes & RNAi Explorer
P r o d u c t S p e c i f i c a t i o n s Guaranteed RNAi Explorer kit with Fl/Dabcyl Molecular Beacon Catalog No.:27-6402-01 Guaranteed RNAi Explorer kit with Fluorescein/Tamra TaqMan Catalog No.:27-6402-01
More informationMicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control
MicroRNA formation mirna s are processed from several precursor stages Mammalian genomes seem to have 100 s of mirna s Nucleotides in positions 2-8 of an mirna are considered the mirna seed 5 Methyl-G
More informationAmaxa Mouse T Cell Nucleofector Kit
Amaxa Mouse T Cell Nucleofector Kit For T cells isolated from C57BL/6 & BALB/c mice Evaluated for murine T cells isolated from C57BL/6 & BALB/c mice This protocol is designed for murine lymphocytes or
More informationIKDT Laboratory. IKDT as Service Lab (CRO) for Molecular Diagnostics
Page 1 IKDT Laboratory IKDT as Service Lab (CRO) for Molecular Diagnostics IKDT lab offer is complete diagnostic service to all external customers. We could perform as well single procedures or complex
More informationPeptide synthesis, radiolabelling and radiochemical analysis
SUPPLEMENTAL DATA MATERIALS AND METHODS Peptide synthesis, radiolabelling and radiochemical analysis Solid phase synthesis of peptides was carried out on using ABI 433A peptide synthesizer, on a preloaded
More informationMicroscopy. MICROSCOPY Light Electron Tunnelling Atomic Force RESOLVE: => INCREASE CONTRAST BIODIVERSITY I BIOL1051 MAJOR FUNCTIONS OF MICROSCOPES
BIODIVERSITY I BIOL1051 Microscopy Professor Marc C. Lavoie marc.lavoie@cavehill.uwi.edu MAJOR FUNCTIONS OF MICROSCOPES MAGNIFY RESOLVE: => INCREASE CONTRAST Microscopy 1. Eyepieces 2. Diopter adjustment
More informationIKDT Laboratory. IKDT as Service Lab (CRO) for Molecular Diagnostics
IKDT Laboratory IKDT as Service Lab (CRO) for Molecular Diagnostics IKDT lab offer is complete diagnostic service to all external customers. We could perform as well single procedures or complex examinations
More informationIntroduction to Flow Cytometry
Introduction to Flow Cytometry presented by: Flow Cytometry y Core Facility Biomedical Instrumentation Center Uniformed Services University Topics Covered in this Lecture What is flow cytometry? Flow cytometer
More informationJ. Cell Sci. 128: doi:10.1242/jcs.164566: Supplementary Material
Figure S1. Microtubule and microfilament drug treatments severely interfere with mitotic spindle morphology, length and positioning. (A) GFP-fused lamin-a/c, LAP2 or BAF1 localizes to the spindle and all
More informationInfluence of the skin mechanical and microbial properties on hair growth
Call for Interdisciplinary Projects Sevres 2014 A General Information Project title Influence of the skin mechanical and microbial properties on hair growth Acronym TADDEI: The Ambiguous Dupond and Dupont
More informationinform Advanced Image Analysis Software For Accurately Quantifying Biomarkers in Tissue Sections
P R O D U C T N O T E inform Advanced Image Analysis Key Features Quantitative analysis of biomarker epression in tissue sections and TMAs Separation of weakly epressing and overlapping markers Cellular
More informationCellCelector : enabling fast automated image-based isolation of pure single CTCs for personalized therapy
short version CellCelector : enabling fast automated image-based isolation of pure single CTCs for personalized therapy Titre Dr. Constantin Nelep - September, 2014 1 Who we are ALS Headquarters in Jena,
More informationIslet Viability Assessment by Single Cell Flow Cytometry
Islet Viability Assessment by Single Cell Flow Cytometry Page 1 of 8 Purpose: To comprehensively assess the viability of the islet cell preparation prior to transplantation. Tissue Samples: A sample containing
More informationThermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
More informationZ-Stacking and Z-Projection using a Scaffold-based 3D Cell Culture Model
A p p l i c a t i o n N o t e Z-Stacking and Z-Projection using a Scaffold-based 3D Cell Culture Model Brad Larson and Peter Banks, BioTek Instruments, Inc., Winooski, VT Grant Cameron, TAP Biosystems
More informationSupplemental Information for
Supplemental Information for Mechanism of Retinoic acid-induced transcription: histone code, DNA oxidation and formation of chromatin loops Candida Zuchegna 1, Fabiana Aceto 2, Alessandra Bertoni 3, Antonella
More informationUnderstand the Dynamic Processes of Life. Reach Out for Experience.
Understand the Dynamic Processes of Life. Reach Out for Experience. Subject Coverage Antibodies Bioinformatics/Genomics DNA Delivery/Gene Transfer Now you can see results of the finest methods in action
More informationReal-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
More informationCD34+ CD45- Cells Isolated from Human Blood Have Molecular and Functional Characteristics of Vascular Endothelial Progenitors
CD34+ CD45- Cells Isolated from Human Blood Have Molecular and Functional Characteristics of Vascular Endothelial Progenitors Yajuan Jiang 1, Alexander M. Tsankov 2, Alexander Meissner 2 and David W. O
More informationAnalysis of gene expression data. Ulf Leser and Philippe Thomas
Analysis of gene expression data Ulf Leser and Philippe Thomas This Lecture Protein synthesis Microarray Idea Technologies Applications Problems Quality control Normalization Analysis next week! Ulf Leser:
More informationIntroduction to flow cytometry
Introduction to flow cytometry Flow cytometry is a popular laser-based technology. Discover more with our introduction to flow cytometry. Flow cytometry is now a widely used method for analyzing the expression
More informationIntroduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
More informationSupplementary Information
Supplementary Information Table of Contents Figure S1 1 H NMR spectrum for chromomycin A2 (1) in CDCl3. Figure S2 1 H NMR spectrum expansion for chromomycin A2 (1) in CDCl3. Figure S3 HR-ESI-MS spectrum
More informationFirst Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
More information1.Gene Synthesis. 2.Peptide & Phospho-P. Assembly PCR. Design & Synthesis. Advantages. Specifications. Advantages
1.Gene Synthesis Assembly PCR Looking for a cdna for your research but could not fish out the gene through traditional cloning methods or a supplier? Abnova provides a gene synthesis service via assembly
More informationAPPLICATION INFORMATION
DRAFT: Rev. D A-2045A APPLICATION INFORMATION Flow Cytometry 3-COLOR COMPENSATION Raquel Cabana,* Mark Cheetham, Jay Enten, Yong Song, Michael Thomas,* and Brendan S. Yee Beckman Coulter, Inc., Miami FL
More informationThermo Scientific ArrayScan XTI High Content Analysis Reader. revolutionizing cell biology with the power of high content
Thermo Scientific ArrayScan XTI High Content Analysis Reader revolutionizing cell biology with the power of high content learn more about your cells using high content technology Thermo Scientific High
More informationhydrocortisone (5 mg/ml), EGF (10 µg/ml) and Heparin (5000 U/ml). Antibodies against the N-terminal peptide of MEK1 (MEK1-N) and against Flotillin 1
SUPPLEMENTARY METHODS Cells HUVEC (Human Umbilical Vein Endothelial Cells) were grown in complete Medium 199 (Gibco) supplemented with glutamax, 10% foetal calf serum, BBE (9 mg/ml), hydrocortisone (5
More informationHigh Throughput Robotic Production of Monoclonal Antibodies at MATF. Ed Nice, Daniel Layton, Caroline Laverty, Natasha Dodge,
High Throughput Robotic Production of Monoclonal Antibodies at MATF Ed Nice, Daniel Layton, Caroline Laverty, Natasha Dodge, Bronwyn Briers and Jean Tang Monash Antibody Technology Facility Clayton Victoria
More informationMIRAX SCAN The new way of looking at pathology
Microscopy from Carl Zeiss MIRAX SCAN The new way of looking at pathology Greater reliability. Greater efficiency. Virtual microscopy for research & analysis. Better. More efficient. Quality as the basis
More informationINTERPRETATION INFORMATION SHEET
Creative Testing Solutions 2424 West Erie Dr. 2205 Highway 121 10100 Martin Luther King Jr. St. No. Tempe, AZ 85282 Bedford, TX 76021 St. Petersburg, FL 33716 INTERPRETATION INFORMATION SHEET Human Immunodeficiency
More informationWestern Blot Analysis with Cell Samples Grown in Channel-µ-Slides
Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Polyacrylamide gel electrophoresis (PAGE) and subsequent analyses are common tools in biochemistry and molecular biology. This Application
More informationSupplementary Figure 1 Characterization of 5xFAD derived hippocampal cultures. A-B) Average total numbers of cells per hippocampus as well as average
Supplementary Figure 1 Characterization of 5xFAD derived hippocampal cultures. A-B) Average total numbers of cells per hippocampus as well as average total numbers of cells per field of view were similar
More informationSupporting Information
Supporting Information Kondo et al. 1.173/pnas.787415 SI Methods Conventional and Quantitative RT-PCR. Total RNA was extracted from cultured ES cells or ES-derived cells using the RNeasy Minikit (Qiagen).
More informationPROTOCOL. Immunocytochemistry (ICC) MATERIALS AND EQUIPMENT REQUIRED
PROTOCOL Immunocytochemistry (ICC) 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 11-07 MATERIALS AND EQUIPMENT REQUIRED Materials: MitoSciences primary monoclonal antibody/antibodies Fluorophore-conjugated
More informationUser Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
More informationMystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C
microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr
More informationCell Cycle Tutorial. Contents
Cell Cycle Tutorial Contents Experimental Requirements...2 DNA Dyes...2 Protocols...3 PI Parameter & Analysis Setup...4 PI Voltage Adjustments...6 7-AAD Parameter Setup...6 To-Pro3 Parameter Setup...6
More informationZEISS Microscopy Course Catalog
ZEISS Microscopy Course Catalog ZEISS Training and Education Expand Your Possibilities Practical microscopy training has a long tradition at ZEISS. The first courses were held in Jena as early as 1907,
More informationPrimePCR Assay Validation Report
Gene Information Gene Name sorbin and SH3 domain containing 2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORBS2 Human Arg and c-abl represent the mammalian
More informationTITLE: The Single Prostate Cell Transcriptome as Biological Assay
AD Award Number: DAMD17-98-1-8499 TITLE: The Single Prostate Cell Transcriptome as Biological Assay PRINCIPAL INVESTIGATOR: Peter S. Nelson, M.D. CONTRACTING ORGANIZATION: University of Washington Seattle,
More informationInvestigating the role of a Cryptosporidium parum apyrase in infection
Investigating the role of a Cryptosporidium parum apyrase in infection David Riccardi and Patricio Manque Abstract This project attempted to characterize the function of a Cryptosporidium parvum apyrase
More informationGene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene
More informationAnimal Cell Culture. Third Edition. A Practical Approach OXJORD VNIVVRSITY 1'RVSS
Animal Cell Culture Third Edition A Practical Approach Edited by John R. W. Masters 3rd Floor Research Laboratories, University College London OXJORD VNIVVRSITY 1'RVSS Contents List of protocols page xiii
More informationUser Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse)
User Manual/Hand book qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse) Kit Components Cat. No. MA003...Human Whole Genome mirna qpcr Profiling Kit (-20 C) The following components are sufficient
More informationImmunohistochemistry. Services & Products. Indivumed GmbH Falkenried 88, Bldg. D 20251 Hamburg Germany
Services & Products Indivumed GmbH Falkenried 88, Bldg. D 20251 Hamburg Germany Phone Europe: +49-40-41 33 83-0 Fax Europe: +49-40-41 33 83-14 Phone USA: +1-301-588-4650 info@indivumed.com www.indivumed.com
More information123count ebeads Catalog Number: 01-1234 Also known as: Absolute cell count beads GPR: General Purpose Reagents. For Laboratory Use.
Page 1 of 1 Catalog Number: 01-1234 Also known as: Absolute cell count beads GPR: General Purpose Reagents. For Laboratory Use. Normal human peripheral blood was stained with Anti- Human CD45 PE (cat.
More informationMeasuring the Point Spread Function of a Fluorescence Microscope
Frederick National Laboratory Measuring the Point Spread Function of a Fluorescence Microscope Stephen J Lockett, PhD Principal Scientist, Optical Microscopy and Analysis Laboratory Frederick National
More informationGM23226*A. Certificate of Analysis
GM23226*A Certificate of Analysis Product Description Human fibroblast line reprogrammed with four factors (Oct 4, Sox 2, c-myc and Klf-4) using retroviral vector Publication(s) describing ipsc establishment
More informationmicrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved
microrna 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions of target mrnas Act as negative
More informationGlobal MicroRNA Amplification Kit
Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in
More informationPractical Cell Analysis
Practical Cell Analysis Dimitri Pappas Dept of Chemistry & Biochemistry, Texas Tech University, USA WILEY A John Wiley and Sons, Ltd, Publication Contents Preface Acknowledgments xiii xix 1 Getting Started
More informationSDS gel electrophoresis was performed using a 4% by 20% gradient gel 8. Quantification of Western blots was performed using Image J Processing and
Supplemental Material: Western blot: SDS gel electrophoresis was performed using a 4% by 20% gradient gel 8. Quantification of Western blots was performed using Image J Processing and Analysis (NIH). Quantitative
More informationThe How Do Guide to AxioVision. Author: Brian Svedberg Image Analysis Specialist Carl Zeiss MicroImaging, Inc.
The How Do Guide to AxioVision Author: Brian Svedberg Image Analysis Specialist Carl Zeiss MicroImaging, Inc. How do I grab a single image? How do I grab a single image? Click on the Camera icon to switch
More informationValidating Microarray Data Using RT 2 Real-Time PCR Products
Validating Microarray Data Using RT 2 Real-Time PCR Products Introduction: Real-time PCR monitors the amount of amplicon as the reaction occurs. Usually, the amount of product is directly related to the
More informationReal-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
More informationStepcount. Product Description: Closed transparent tubes with a metal screen, including a white matrix at the bottom. Cat. Reference: STP-25T
Product Description: Closed transparent tubes with a metal screen, including a white matrix at the bottom Cat. Reference: STP-25T Reagent provided:: 25 Stepcount tubes for 25 test INTENDED USE. Immunostep
More informationCOMPENSATION MIT Flow Cytometry Core Facility
COMPENSATION MIT Flow Cytometry Core Facility Why do we need compensation? 1) Because the long emission spectrum tail of dyes causes overlap like with the fluorophores FITC and PE. 2) For sensitivity reasons,
More informationSupplementary Online Content
Supplementary Online Content Harshman, LC, Wang X, Nakabayashi M, et al. Statin use at the time of initiation of androgen deprivation therapy and time to progression in patients with hormone-sensitive
More informationRelative Quantification of mirna Target mrnas by Real-Time qpcr. 1 Introduction. Gene Expression Application Note No. 4
Gene Expression Application Note No. 4 Relative Quantification of mirna Target mrnas by Real-Time qpcr Ute Ernst, Jitao David Zhang, Anja Irsigler, Stefan Wiemann, Ulrich Tschulena Division: Molecular
More informationEffects of Herceptin on circulating tumor cells in HER2 positive early breast cancer
Effects of Herceptin on circulating tumor cells in HER2 positive early breast cancer J.-L. Zhang, Q. Yao, J.-H. Chen,Y. Wang, H. Wang, Q. Fan, R. Ling, J. Yi and L. Wang Xijing Hospital Vascular Endocrine
More informationIntroduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
More informationELITE Custom Antibody Services
ELITE Custom Antibody Services ELITE Custom Antibody Services Experience, confidence, and understanding As a manufacturer and service provider, we have the experience, confidence, and understanding to
More informationSmartFlare RNA Detection Probes: Principles, protocols and troubleshooting
Technical Guide SmartFlare RNA Detection Probes: Principles, protocols and troubleshooting Principles of SmartFlare technology RNA detection traditionally requires transfection, laborious sample prep,
More informationAn Overview of Cells and Cell Research
An Overview of Cells and Cell Research 1 An Overview of Cells and Cell Research Chapter Outline Model Species and Cell types Cell components Tools of Cell Biology Model Species E. Coli: simplest organism
More informationUsing TaqMan Endogenous Control Assays to select an endogenous control for experimental studies
APPLICATION NOTE TaqMan Gene Expression Assays Using TaqMan Endogenous Control Assays to select an endogenous control for experimental studies Introduction Quantitative real-time PCR (qpcr) allows for
More informationCell Cycle Phase Determination Kit
Cell Cycle Phase Determination Kit Item No. 10009349 Customer Service 800.364.9897 * Technical Support 888.526.5351 www.caymanchem.com TABLE OF CONTENTS GENERAL INFORMATION 3 Materials Supplied 3 Safety
More informationApplication Note. Single Cell PCR Preparation
Application Note Single Cell PCR Preparation From Automated Screening to the Molecular Analysis of Single Cells The AmpliGrid system is a highly sensitive tool for the analysis of single cells. In combination
More informationALLEN Mouse Brain Atlas
TECHNICAL WHITE PAPER: QUALITY CONTROL STANDARDS FOR HIGH-THROUGHPUT RNA IN SITU HYBRIDIZATION DATA GENERATION Consistent data quality and internal reproducibility are critical concerns for high-throughput
More informationApplication Note 10. Measurement of Cell Recovery. After Sorting with a Catcher-Tube-Based. Cell Sorter. Introduction
Application Note 10 Measurement of Cell Recovery After Sorting with a Catcher-Tube-Based Cell Sorter Introduction In many experiments using sorted cells, it is important to be able to count the number
More informationRNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr)
RNA Extraction and Quantification, Reverse Transcription, and Real-time Preparation of Samples Cells: o Remove media and wash cells 2X with cold PBS. (2 ml for 6 well plate or 3 ml for 6cm plate) Keep
More informationCell culture and Sensor Ping-Pong assay. Ecotropic Phoenix HEK293T cells and Trp53 -
Supplemental Experimental Procedures Cell culture and Sensor Ping-Pong assay. Ecotropic Phoenix HEK293T cells and Trp53 - /- MEFs (1) were grown in DMEM supplemented with 10% fetal bovine serum (FBS),
More informationHuman Adult Mesothelial Cell Manual
Human Adult Mesothelial Cell Manual INSTRUCTION MANUAL ZBM0025.01 SHIPPING CONDITIONS Human Adult Mesothelial Cells Orders are delivered via Federal Express courier. All US and Canada orders are shipped
More informationNotes on titering antibodies
Home Events This Week Bulletin Boards Lab Personnel Lab Policies Protocols MolBio Tetramers Proteins Flow Cytometry Immunoassays Instruments Computers Lab Publications Scientiific Literature Science on
More informationRevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
More informationChapter 4. Microscopy, Staining, and Classification. Lecture prepared by Mindy Miller-Kittrell North Carolina State University
Chapter 4 Microscopy, Staining, and Classification 2012 Pearson Education Inc. Lecture prepared by Mindy Miller-Kittrell North Carolina State University Microscopy and Staining 2012 Pearson Education Inc.
More informationImmunophenotyping Flow Cytometry Tutorial. Contents. Experimental Requirements...1. Data Storage...2. Voltage Adjustments...3. Compensation...
Immunophenotyping Flow Cytometry Tutorial Contents Experimental Requirements...1 Data Storage...2 Voltage Adjustments...3 Compensation...5 Experimental Requirements For immunophenotyping with FITC and
More informationBD FACSComp Software Tutorial
BD FACSComp Software Tutorial This tutorial guides you through a BD FACSComp software lyse/no-wash assay setup run. If you are already familiar with previous versions of BD FACSComp software on Mac OS
More informationAll-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination
More informationMolecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN
More informationAbout Our Products. Blood Products. Purified Infectious/Inactivated Agents. Native & Recombinant Viral Proteins. DNA Controls and Primers for PCR
About Our Products Purified Infectious/Inactivated Agents ABI produces a variety of specialized reagents, allowing researchers to choose the best preparations for their studies. Available reagents include
More informationBD FACSDiva 4.1 - TUTORIAL TSRI FLOW CYTOMETRY CORE FACILITY
BD FACSDiva 4.1 - TUTORIAL TSRI FLOW CYTOMETRY CORE FACILITY IMPORTANT NOTES BEFORE READING THIS TUTORIAL This is a very expensive piece of equipment so PLEASE treat it with respect! After you are done
More informationCONFOCAL LASER SCANNING MICROSCOPY TUTORIAL
CONFOCAL LASER SCANNING MICROSCOPY TUTORIAL Robert Bagnell 2006 This tutorial covers the following CLSM topics: 1) What is the optical principal behind CLSM? 2) What is the spatial resolution in X, Y,
More informationMarch 19, 2014. Dear Dr. Duvall, Dr. Hambrick, and Ms. Smith,
Dr. Daniel Duvall, Medical Officer Center for Medicare, Hospital and Ambulatory Policy Group Centers for Medicare and Medicaid Services 7500 Security Boulevard Baltimore, Maryland 21244 Dr. Edith Hambrick,
More informationSupporting Online Material. Immunohistochemistry: Tissue sections were deparaffinized and rehydrated in
Supporting Online Material Materials and Methods: Immunohistochemistry: Tissue sections were deparaffinized and rehydrated in an ethanol series. Sections were blocked for non-specific binding with 3% normal
More informationQuando si parla di PCR quantitativa si intende:
Quando si parla di PCR quantitativa si intende: A. Una PCR che produce grandi quantità di DNA B. Una PCR che emette quanti di luce C. Una PCR che quantifica il numero di molecole stampo presenti all inizio
More information