TISSUE-SPECIFIC STEM CELLS

Size: px
Start display at page:

Download "TISSUE-SPECIFIC STEM CELLS"

Transcription

1 TISSUE-SPECIFIC STEM CELLS Chromatin-Remodeling Factors Allow Differentiation of Bone Marrow Cells into Insulin-Producing Cells THATAVA TAYARAMMA, a BIN MA, a MANFRED ROHDE, b HUBERT MAYER a a Department of Gene Regulation and Differentiation and b Department of Microbial Pathogenesis, German Research Center for Biotechnology, Braunschweig, Germany Key Words. Bone marrow Histone deacetylation inhibitors Trichostatin A Insulin-producing cells Diabetes ABSTRACT Type 1 diabetes is caused by the destruction of pancreatic -cells by T cells of the immune system. Islet transplantation is a promising therapy for diabetes mellitus. Bone marrow stem cells (BMSC) have the capacity to differentiate into various cell lineages including endocrine cells of the pancreas. To investigate the conditions that allow BMSC to differentiate into insulin-producing cells, a novel in vitro method was developed by using the histone deacetylase inhibitor, trichostatin A (TSA). BMSC, cultured in presence of TSA, differentiated into isletlike clusters under appropriate culture conditions. These isletlike clusters were similar to the cells of the islets of the pancreas. The islet-like clusters showed endocrine gene expression typical for pancreatic -cell development and function, such as insulin (I and II), glucagon, somatostatin, GLUT-2, pancreatic duodenal homeobox-1 (PDX-1), and Pax 4. Immunocytochemistry confirmed islet-like clusters contained pancreatic hormones. The colocalization of insulin and C-peptide was also observed. Enzyme-linked immunosorbent assay analysis demonstrated that insulin secretion was regulated by glucose. Western blot analysis demonstrated the presence of stored insulin. Electron microscopy of the islet-like cells revealed an ultrastructure similar to that of pancreatic -cells, which contain insulin granules within secretory vesicles. These findings suggest that histone-deacetylating agents could allow the differentiation of BMSC into insulin-producing -cells. STEM CELLS 2006;24: INTRODUCTION Diabetes mellitus (DM) is a common metabolic disorder affecting millions of people worldwide and is characterized by abnormally high levels of glucose in blood. Type 1 diabetes (insulin-dependent) is an autoimmune disease, resulting from the body s own immune system destroying pancreatic -cells and causing absolute insulin deficiency. An effective treatment for Type 1 diabetes is islet cell transplantation [1]. However, the limited supply of suitable donors for pancreatic islets severely limits this approach. Alternatively, much effort has been made to increase -cell mass by stimulating endogenous regeneration of islets or generating islet-like cells by in vitro differentiation procedures [2 5]. Multipotent stem cells within pancreatic islets and in nonendocrine compartments of the pancreas [6 10] have been described to differentiate into pancreatic islet-like structures in vitro. Various tissue precursor cells, such as hepatic oval cells [11] and splenocytes [12], have been reported to differentiate into insulin-producing cells. In addition, embryonic stem (ES) cells and bone marrowderived stem cells (BMSC) are reported as an alternative cell source for obtaining pancreatic endocrine hormone-producing cells under appropriate in vitro and in vivo conditions [13 16]. The key goals of stem cell research are to understand the manner in which differentiation is controlled and the direction that cellular differentiation will take. This should result in a better understanding of stem cell biology and allow optimal use of these cells in cell therapy. Stem cell plasticity depends on many factors, such as chromatin structure. The actual chromatin structure and its remodeling is an important mode of the epigenetic control of gene expression. The chromatin modulation includes histone acetylation and DNA methylation. Histone acetylation or DNA methylation modifiers modulate a wide variety of cellular functions, including cell differentiation. Histone deacetylase (HDAC) inhibitors are known as agents that modulate the expression of genes by increasing histone acetylation, thereby regulating chromatin structure and transcription [17, 18]. These HDAC inhibitors induce differentiation and inhibit cell proliferation. Trichostatin A (TSA) is a hydroxamic acid and a potent HDAC inhibitor that has been identified as having potential therapeutic value against cancer in screens for agents that induce differentiation of murine erythroleukemia cells [19, 20]. Correspondence: Thatava Tayaramma, Ph.D., German Research Center for Biotechnology, Department of Gene Regulation and Differentiation, Mascheroder weg-1, D-38124, Braunschweig, Germany. Telephone: ; Fax: ; or Received February 25, 2006; accepted for publication August 22, 2006; first published online in STEM CELLS EXPRESS September 21, AlphaMed Press /2006/$20.00/0 doi: /stemcells STEM CELLS 2006;24:

2 Tayaramma, Ma, Rohde et al We have evaluated the effect of TSA on the differentiation of BMSC into insulin-producing cells. We have found that treatment with TSA and subsequent cell culture conditions can induce the differentiation of BMSC into insulin-producing cells and other cell types typical of endocrine pancreas. Here we show that differentiated bone marrow cells express transcription factors specific for development of endocrine pancreas, such as PDX-1, hepatocyte nuclear factor (HNF)-3, and Pax 4. The bone marrow-derived islet-like cells secrete insulin in response to glucose stimulus. This is a novel and efficient method for the differentiation of bone marrow cells into insulin-producing cells within a short time period of 10 days. These cells could be a potentially unlimited source for the transplantation of insulinproducing cells into Type 1 diabetes patients. MATERIALS AND METHODS Mice C57BL/6 female mice of 6 10-weeks old were purchased from the Harlan Winklemann (GmbH, Borchen, Deutschland, and maintained in a specific pathogen-free facility until used. Mice were treated in accordance with institute guidelines. BMSC Isolation and In Vitro Differentiation Conditions Bone marrow (BM) was flushed out with Dulbecco s modified Eagle s medium (DMEM) (MP Biomedicals, Germany, in the presence of 10% fetal bovine serum from the tibias and femurs of C57BL/6 mice. The BM cells were plated at a density of cells/cm 2 in 6-well plate in normal DMEM containing 10% fetal bovine serum, 100 U/ml penicillin, 100 g/ml streptomycin, and 100 U/ml glutamine and allowed to adhere to the cell culture plate. After 12 hours of incubation, nonadherent cells were washed out with fresh serum-free DMEM medium. The cells were treated with TSA (kindly donated by Prof. Dr. Jürgen Bode, GBF, Braunschweig) at a concentration of 55 nm in serum-free DMEM for 3 days. For the induction of differentiation, TSA was withdrawn from the medium, and the cells were then cultured for an additional 7 days in specific induction medium containing a 1:1 ratio of DMEM:DMEM/F12 (Gibco, Grand Island, NY, invitrogen.com) supplemented with 10% fetal bovine serum and 10 nm glucagon-like peptide-1 (GLP-1), in presence of high (25 mm) glucose. Islet Isolation from Pancreas Mouse pancreatic islets were isolated as described previously [21]. Briefly, 6 10-week-old female C57BL/6 mice were killed by cervical dislocation. The pancreata were removed, without ductal injection or distention, cut into small pieces, and washed three times with ice-cold Hanks balanced salt solution (HBSS) to remove released trypsin. The resulting pieces were suspended in 5 ml of HBSS, containing 2,500 U of collagenase Type 2 (Worthington Biochemical Corporation, Lakewood, NJ, and digested with shaking at 37 C for 30 min. The digested sample was washed three times with cold HBSS. Islet purification was performed by centrifugation at 800g for 15 min at 4 C on a discontinuous Ficoll (Sigma, St. Louis, (1.08 mg/ml)/ HBSS gradient. Islets were aspirated from the Ficoll/HBSS interface and washed with cold HBSS. Islet cell viability was confirmed by trypan blue exclusion. Dithizone Staining Dithizone (DTZ) (Merck & Co., Whitehouse Station, NY, stock solution was prepared as previously reported [22] by dissolving 50 mg of DTZ in 5 ml of dimethyl sulfoxide, was sterile-filtered through a 0.2 m nylon filter, and was stored at 20 C. In vitro DTZ staining was performed by adding 10 l of stock solution to 1 ml of culture medium. The culture dishes were then incubated at 37 C for 30 min in DTZcontaining medium. After the dishes were rinsed three times with HBSS, crimson-red-stained clusters were examined with a stereomicroscope, and the number of DTZ-stained cells in cultures were determined. Fluorescence Labeling with Newport Green DCF The ester form of Newport Green (Molecular Probes Europe; Leiden, The Netherlands, (diacetate form, NG-Ac) is cell-permeable. Inside the cell, this ester is cleaved by esterases to yield a cell-impermeant fluorescent indicator able to bind zinc ions. Cells in HBSS were exposed for 30 min at 37 C to 25 mm NG-Ac and 1.5 l/ml Pluronic F127 (Molecular Probes) to enhance the penetration of the probe. After being washed in HBSS, the cells were analyzed by confocal microscopy. Immunocytochemistry Immunocytochemistry was performed to detect the expression of insulin and other pancreas-specific hormones in differentiated cells. Cells cultured in Lab-Tek chambered slides (Nunc International, Rochester, NY, were fixed with 4% paraformaldehyde in phosphatebuffered saline processed for immunofluorescence microscopy. The primary antibodies used for analysis were rabbit anti-insulin (sc-9168, Santa Cruz Biotechnology, Santa Cruz, CA, goat anti-glucagon (C-18) (sc Santa Cruz Biotechnology), rabbit anti-somatostatin (FL-116) (catalog number sc Santa Cruz Biotechnology), and goat anti-rat-c-peptide (Linco Research, catalog number ), goat monoclonal anti-insulin A (C-12), (catalog number sc-7839 Santa Cruz Biotechnology), rabbit anti-ngn3 (kind gift from Prof. Michael S. German, UCSF Diabetes Center). The following secondary antibodies were used according to the manufacturer s recommendations: antigoat IgG (whole molecule-cy3 conjugate (catalog number C 2821, Sigma), anti-rabbit IgG (whole molecule)-cy3 conjugated (catalog number C2306, Sigma), donkey anti-rabbit IgG (H L) labeled with Alexa Fluor 488 (catalog number A21206, Molecular Probes Inc., Eugene, OR, invitrogen.com), and donkey anti-goat IgG-rhodamine (sc- 2094, Santa Cruz Biotechnology). Goat anti-rabbit IgG, Fc fragment-specific (Jackson ImmunoResearch Laboratories, West Grove, PA, code number ), and rabbit anti-goat IgG (Nordic Immunological Laboratories, The Netherlands, nordiclabs.nl/index.htm) were used as isotype controls. Paraffin sections of adult mouse pancreas were taken as positive controls for the pancreatic hormones insulin, glucagon, and somatostatin. Paraffin sections from 16.5-day mouse em-

3 2860 Murine Bone Marrow-Derived Insulin-Producing Cells Table 1. Primers for polymerase chain reaction Sr. no Gene Primer sequence Length of the gene Annealing temperature 1 Glut-2 5 -ACAGAGCTACAATGCAACGTGG 221 bp CAACCAGAATGCCAATGACGAT 2 IAPP 5 -TGATATTGCTGCCTCGGACC 233 bp GGAGGACTGGACCAAGGTTG 3 Isl-1 5 -GTTTGTACGGGATCAAATGC 514 bp ATGCTGCGTTTCTTGTCCTT 4 Ngn3 5 -TGGCGCCTCATCCCTTGGATG 157 bp AGTCACCCACTTCTGCTTCG 5 Pax 4 5 -ACCAGAGCTTGCACTGGACT 236 bp CCCATTTCAGCTTCTCTTGC 6 Pdx-1 5 -TGGATAAGGGAATTGCTTAACCT 582 bp TTGGAACGCTCAAGTTTGTA 7 HNF-3 5 -AGAAGCAACTGGCACTGAAGGA 464 bp GTAGTGCATGACCTGTTCGTAG 8 Proinsulin I 5 -GTTGGTGCACTTCCTACCCCTG 300 bp GTAGAGGGAGCAGATGCTGGTG 9 Proinsulin II 5 -GTGGATGCGCTTCCTGCCCCTG 300 bp GTAGAGGGAGCAGATGCTGGTG 10 Glucagon 5 -CACTCACAGGGCACATTCACC 221 bp ACCAGCCACGCAATGAATTCCTT 11 Pancreatic polypeptide 5 -CTGCCTCTCCCTGTTTCTC 337 bp GGCTGAAGACAAGAGAGGC 12 Somatostatin 5 -GACCTGCGAACTAGACTGAC 294 bp TTTGGGGGAGAGGGATCAG 13 M-Sur1 5 -CCAGACCAAGGGAAGATTCA 236 bp GTCCTGTAGGATGATGGACA 14 -Actin 5 -GTCGTCGACAACGGCTCCGGCATGTG TG 220 bp CATTGTAGAAGGTGTGGTGCCAGATC Abbreviations: bp, base pair; HNF, hepatocyte nuclear factor; Ngn3, neurogenin 3. No. of cycles bryos were taken as positive controls for Ngn3. Stained cells were analyzed by using confocal laser-scanning microscope (LSM META510 confocal scanning laser system consisting of an Axiovert 200 M microscope). Glucose-Regulated Insulin Secretion To estimate secreted insulin levels, differentiated bone marrow cells were preincubated for 3 hours at 37 C in Krebs Ringerbicarbonate Hepes (KRBH) buffer containing 118 mm sodium chloride, 4.7 mm potassium chloride, 1.1 mm potassium dihydrogen phosphate, 25 mm sodium hydrogen carbonate, 3.4 mm calcium chloride, 2.5 mm magnesium sulfate, 10 mm Hepes, and 2 mg/ml bovine serum albumin (BSA) supplemented with 3.8 mm glucose. For high-glucose-induced insulin release, cells were further incubated in KRBH buffer supplemented with 7, 12, and 27.7 mm glucose, and 10 M tolbutamide (Sigma) for 2 hours at 37 C. The control was incubated with 3.8 mm glucose. Determination of secreted insulin was performed by using an ultrasensitive mouse insulin enzyme-linked immunosorbent assay (ELISA) kit (Mercodia, Uppsala, Sweden, according to the manufacturer s instructions. Statistical analysis was performed by Student s t-test. Immunoprecipitation and Western Blotting Differentiated cells were assayed for the presence of intracellular insulin. The intracellular insulin was detected by cell extraction with lysis buffer and a combination of immunoprecipitation and Western blotting as described by Yang et al. [11]. Specifically, the presence of insulin in the differentiated cell lysate was determined by immunoprecipitation with the rabbit polyclonal anti-insulin antibody (sc-9168), followed by separation on 18% SDS-polyacrylamide gel, transfer to nylon membranes, and blotting with anti-insulin antibody. Cell lysate (200 g) was subjected to immunoprecipitation. Insulin protein was visualized by chemiluminescence. RNA Extraction and Reverse Transcription- Polymerase Chain Reaction Analysis Total cellular RNA was extracted from whole bone marrow and differentiated cells by using TRIzol (Gibco/BRL), and reverse transcription was performed with primer oligo(dt) (Invitrogen, Carlsbad, CA, com). cdna samples were subjected to polymerase chain reaction (PCR) amplification with FastStart Taq DNA Polymerase (Roche Diagnostics, Basel, Switzerland, roche-applied-science.com) in 1.5 mmol/l magnesium chloride and 0.2 mmol/l dntps. The following transcription factors involved in endoderm development: PDX-1, Pax-4, and Ngn-3. Pancreas-specific genes, such as islet amyloid polypeptide, isl-1, insulin gene I and II, and glucose transporter two (GLUT-2) were analyzed by PCR. The cycling parameters were as follows: denaturation at 94 C for 4 min, annealing at 50ºC 64 C for 1 min (depending on the primer), and elongation at 72 C for 1 min (35 cycles). (Primers are listed in Table 1). PCR products of insulin gene I, insulin gene II, and PDX-1 were sequenced.

4 Tayaramma, Ma, Rohde et al Electron Microscopy For the postembedding detection of insulin in differentiated cells, samples were fixed with 0.2% glutaraldehyde and 0.5% formaldehyde for 1 hour on ice, washed with PBS containing 10 mm glycine, and dehydrated with a graded series of ethanol following the progressive lowering of temperature protocol (PLT method). Samples were then embedded in Lowicryl K4M (catalog number 15,923, Polysciences, Inc., Warrington, PA, at 35 C, polymerized with UV light (366 nm, 2 days at 35 C, 2 days at room temperature), and ultrathin sections were cut with glass knives and collected onto formvar-coated copper grids (300 mesh). Sections were incubated with rabbit polyclonal anti-insulin antibody (sc-9168), (100 g IgG protein/ml) overnight at 4 C, washed with PBS, and incubated with gold markers (protein A/G gold, 15 nm in diameter from Biocell Cardiff, U.K., biocell.com) for 30 min at room temperature. After being washed with PBS containing 0.01% Triton X-100 and then with distilled water, samples were air-dried. Counterstaining was done with 4% uranyl acetate for 1 min. Samples were then examined in a Zeiss transmission electron microscope EM910 (Zeiss, Oberkochen, Germany, at an acceleration voltage of 80 kv. RESULTS Chromatin-Remodeling Factors Induce Bone Marrow Cells to Differentiate into Islet-Like Cell Clusters To evaluate the effect of chromatin-remodeling factor TSA in the differentiation of BMSC into insulin-producing cells, murine bone marrow cells were cultured in the presence of TSA for 3 days and then maintained for an additional 7 days in differentiation induction medium containing 10 nm GLP-1 and high (25 mm) glucose. After removal of TSA, cells cultured under highglucose medium started forming spheroid-like cell clusters from day 5 and attained their maximum size and maximal number at day 10. Bone marrow cells treated with TSA in the presence of high glucose formed islet-like clusters; this was not seen in control bone marrow cells cultured in the absence of TSA and high glucose (Fig. 1A). Cells cultured in the presence of TSA for 3 days had normal cell morphology (Fig. 1B). The threedimensional cellular morphology of the cell clusters after 10 days culturing resembled pancreatic islet-like clusters (Fig. 1C, 1D), as described [6, 11]. The number of clusters formed was per well in 6-well culture plates. The observed cellular morphology showed that bone marrow cells could differentiate into islet-like cells in the presence of TSA followed by culture in high-glucose medium. Detection of Insulin-Containing Cells in Islet-Like Clusters by Using Zinc-Chelating Dyes To evaluate the insulin-producing cells in cultures, we stained the differentiated cells with the zinc-chelating agent DTZ and zinc-dependent fluorescence indicator Newport green (NG-Ac). Zinc is an integral part of insulin crystals forming the 2-Zninsulin hexamer and is required by pancreatic -cells for packaging insulin. Free ionized zinc is present in the extragranular space as a reservoir for granular zinc. We took advantage of these zinc pools to identify cells harboring insulin synthesis in Figure 1. Chromatin-remodeling factors induce bone marrow cells to differentiate into islet-like cell clusters. Bone marrow (BM) cells were treated in serum-free medium for 3 days with histone deacetylase inhibitor trichostatin A (TSA) and then cultured in 10% fetal bovine serum, glucagon-like peptide-1, and high glucose (25 mm) for an additional 7 days. BM cells were cultured for 10 days without any specific treatment (A). BM cells were cultured for 3 days in the presence of TSA (B). BM cells cultured for 10 days (3 7), 3 days in presence of TSA and subsequently cultured for an additional 7 days in highglucose medium formed islet like clusters ( 10) (C). At higher magnification, a single islet-like cluster appears to have defined edges and structure ( 40) (D). Scale bar for (A C): 100 m and (D): 50 m. our cultures. DTZ is a zinc-binding substance, and pancreatic islets are known to stain crimson red after DTZ treatment. We first determined whether the isolated pancreatic islets from mouse were stained with DTZ and found that most islet cells were stained crimson red (data not shown). Differentiated individual cells and, in particular, cells in the islet-like clusters were distinctly stained crimson red by DTZ (Fig. 2A). Undifferentiated BMSC were not stained by DTZ (Fig. 2B). Newport Green (NG-Ac) ester stains living cells at enzymatic cleavage by cellular esterases and subsequent binding to Zn 2. Confocal images of differentiated cells stained with NG-Ac exhibited green fluorescence dots (Fig. 2C). Staining of individual cells revealed a heterogeneous intensity of fluorescence with cytoplasmic dots. The control culture did not show significant staining with NG-Ac (Fig. 2D). No nuclear staining was noted. The presence of positive cells for zinc-specific dyes such as DTZ and NG-Ac suggest that insulin-producing cells can be derived from BMSCs. Immunofluorescence Analysis for the Detection of Pancreas-Specific Hormones To investigate the expression of pancreatic hormones, immunofluorescence analysis was performed for insulin, C-peptide, glucagon, and somatostatin in differentiated cells. Immunostaining of individual islet-like clusters, which were formed in BMSC cultures treated with TSA and subsequently cultured under high-glucose conditions, revealed large numbers of insulin-positive cells. Double-immunofluorescence analysis showed insulin (Fig. 3A, left), C-peptide (Fig. 3A, middle), and colabeling (Fig. 3A, right) in the same cell of islet-like clusters. Cells were counterstained by 4,6-diamidino-2-phenylindole to

5 2862 Murine Bone Marrow-Derived Insulin-Producing Cells Figure 2. Detection of insulin-containing cells in islet-like clusters. Insulin-containing cells in islet-like clusters were detected by using zinc-chelating agents, dithizone (DTZ), and Newport green (NG-Ac). On day 10, cells distinctly stained crimson-red by DTZ are apparent in the differentiated islet-like clusters (A). Undifferentiated BM cells are not stained (B). Individual differentiated cells stained with NG-Ac, showing green fluorescence within cytoplasmic dots (C). Control differentiated cells for NG-Ac stain (D). Scale bar for (A, B): 20 m and for (C, D): 10 m. reveal the nucleus (Fig. 3A). The colocalization of C-peptide demonstrated de novo insulin synthesis and excluded the possibility that cells only absorbed and concentrated insulin from the medium. Glucagon- and somatostatin-expressing cells were also present in the culture. The staining for glucagon was found in the periphery of the cell (Fig. 3B), whereas somatostatin was dispersed in the cytoplasm (Fig. 3C). Costaining for insulin (Fig. 3D, left) and somatostatin (Fig. 3D, middle) showed that somatostatin-expressing cells were fewer in number than insulinexpressing cells in culture (Fig. 3D, right). Transcription factor Ngn3 was distinctly present in the nucleus of differentiated islet-like cells (Fig. 3E, middle and right). Matched isotype controls for rabbit IgG (Fig. 3F) and goat IgG (Fig. 3G) antibodies and without primary antibody (Fig. 3H) served as negative controls. These results indicate that (a) differentiated BMSC synthesize insulin de novo as indicated by the presence of C-peptide, (b) other pancreatic hormone-producing cells are also present in the culture after 10 days, and (c) the transcription factor Ngn3 is expressed by the islet-like cells. Adult mouse pancreas was used as a positive control for the hormones insulin, C-peptide, glucagon, and somatostatin (see supplemental materials). The transcription factor Ngn-3 was only detected at 16.5 days in mouse embryos (see supplemental materials), also as a positive control. Protein Analysis of Islet-Like Clusters To determine whether the differentiated BM cells were responsive to glucose challenge, insulin release upon exposure to high glucose was measured by using an ultrasensitive mouse insulin ELISA. To enhance the sensitivity of these cells to the highglucose challenge, the differentiated cells were switched to KRBH buffer containing 0.5% BSA and incubated in the presence of 3.8 mm glucose for 3 hours, then stimulated by the addition of 7, 12, or 27.7 mm glucose to the medium for 2 hours in individual experiments. Bone marrow-derived islet-like cells, after exposure to high glucose, secreted insulin in a glucose concentration-dependent manner (Fig. 4A). These data demonstrate that islet-like cell clusters derived from BMSC can secrete insulin in a glucose-regulated manner under appropriate conditions. To analyze the synthesized and stored insulin in differentiated clusters, cell lysates of day 3 culture and day 10 cultures after TSA treatment were subjected to immunoprecipitation and Western blot analysis. Cell lysates of differentiated bone marrow cells contained stored insulin. The cell lysate of day 3 cultures contained an immunopositive band, and the band intensity increased in cell lysate at day 10 (Fig. 4B). Pancreatic tissue served as a positive control. In contrast, no corresponding band was detectable in untreated BMSC (Fig. 4B). The data of insulin protein analysis suggest that the differentiated BMSC in islet-like clusters synthesize and store insulin. Endocrine-Specific Gene Expression in Differentiated Islet-Like Clusters Pancreatic development and gene expression are regulated by specialized transcription factors. To determine whether endocrine-specific transcription factors and pancreas-specific genes were expressed during the differentiation into islet-like clusters, reverse transcription-polymerase chain reaction (RT-PCR) analysis was performed at different time points. Transcripts for PDX-1, Pax 4, HNF-3, and Isl-1 were not detectable in undifferentiated BMSC; in contrast, they were upregulated in differentiated cells (Fig. 5). PDX-1 and HNF-3 transcripts were expressed on day 3 after TSA treatment and increased by day 10. The PCR product of neurogenin 3 (Ngn-3) was visible in both undifferentiated and differentiated BMSCs. PCR products for insulin gene I and II were visible at day 3 and day 10. In contrast, other major islet-specific hormones, such as IAPP, glucagon, and somatostatin, were not detected on day 3 of differentiation and were expressed only on day 10. PCR products for the ATP-sensitive potassium channel-specific sulfonylurea receptor (SUR1) and glucose transporter gene (GLUT-2) were detectable only at day 10. Gene expression analysis in BMSC derived islet-like clusters was similar to that in the pancreas tissue and confirmed the differentiation of BMSC into islet-like cells in vitro upon treatment with TSA and subsequent culturing in high glucose. Ultrastructural Analysis of Insulin-Producing Cell Clusters Ultrastructural analysis of bone marrow derived insulin-producing clusters was also performed. Differentiated cells at low magnification revealed a structure typical of a secretory cell, with secretory vesicles containing dense granules (Fig. 6A). Immunogold electron microscopy showed insulin within the small secretary vesicles of the insulin-producing clusters (Fig. 6B). Gold-labeling detected faint globular structures of differing size filled with low-density material. Positive and negative controls for immunogold labeling are presented in Figure 6C

6 Tayaramma, Ma, Rohde et al Figure 3. Immunofluorescence analysis for detection of pancreas-specific hormones. Confocal microscopy of immunoassaying for insulin, C-peptide, glucagon, and somatostatin on day 10 islet-like clusters. Double-immunofluorescence analysis revealed insulin (green) (A), C-peptide (red), nuclear staining with DAPI (cyan); merging of both channels green (insulin) and red (C-peptide) was seen as yellow. Glucagon-positive cells (red) (B) and somatostatin-positive cells (red) (C) are present in the cultures. Costaining of insulin in green and somatostatin (D) in red was observed. Transcription factor Ngn3 was present in the nucleus of differentiated cells (E). In the isotype control for rabbit IgG (Isotype 1 [F]) and goat IgG (Isotype 2 [G]) and in the negative control (no primary antibody [H]), no immunostaining is observed; all were counterstained by using DAPI (cyan) for nuclear staining. Scale bar 10 m. Abbreviations: DAPI, 4,6-diamidino-2-phenylindole; Ngn3, neurogenin 3.

7 2864 Murine Bone Marrow-Derived Insulin-Producing Cells Figure 4. Protein analysis of bone marrow derived islet-like clusters. Analysis of secretion of insulin following high glucose challenge of differentiated BM-derived islet-like cultures. (A): Enzyme-linked immunosorbent assay for insulin in Krebs Ringer-bicarbonate Hepes (KRBH) buffer from BM-derived islet-like clusters exposed to low- (3.8 mm) and high-glucose conditions 7, 12, and 27 mm for 2 hours. After exposure to high glucose, BM-derived islet-like clusters secreted insulin. Statistical significance tested by Student s t-test: *, p.05; **, p.01; ***, p.001. (B): Western blot analysis for insulin was performed for differentiated islet-like clusters following collection of cell lysates. Note the stronger band for insulin at day 10 after culturing in the presence of glucagon-like peptide-1. Abbreviations: BM, bone marrow; D, day. and 6D, respectively. Adult pancreatic -cells showed several positive immunogold particles per secretory granule (Fig. 6C). The pancreatic -cells were examined only to validate the assay and not to correlate insulin-positive signals between the -cells and the BM-derived insulin-producing clusters. Control bone marrow cells showed no specific labeling, but a few nonspecific particles were seen in the cytoplasm (Fig. 6D). The ultrastructural study of differentiated bone marrow cells showed features typical of an adult -cell, and insulin granules were observed within the secretory vesicles suggesting that these cells had differentiated into pancreatic -like cells capable of synthesizing insulin. Figure 5. Endocrine-specific gene expression in differentiated isletlike clusters. Reverse transcription-polymerase chain reaction (RT- PCR) analysis of pancreas-specific gene expression at several differentiation stages. Total RNA isolated from both undifferentiated and differentiated bone marrow cells was subjected to RT-PCR analysis with primers for the indicated genes. Lane BM: undifferentiated whole bone marrow. Lane D3: day 3 culture with trichostatin A only. Lane D10: day 10 culture with high glucose and glucagon-like peptide-1. Lane Pancreas: adult mouse pancreas (positive control). Lane -ve RT: No template (negative control). Abbreviations: BM, bone marrow; D, day. DISCUSSION Stem cells are a potential source for -cell replacement therapy. Fundamental processes in the determination of the differentiation pathways of stem cells remain to be elucidated and robust and reliable differentiation protocols need to be established. ES cells can be differentiated into insulin-producing cells by manipulating culture conditions [23, 24]. Rajagopal et al. have claimed that ES cells merely absorb insulin from the medium [25, 26]. However, the insulin detected by immunocytochemistry in the differentiated cells must be actively synthesized and secreted, rather than merely being taken up passively from the medium (see below). Nevertheless, many problems in the control of differentiation and teratoma formation in insulin-producing cells derived from ES cells remain to be overcome. Bone marrow transplantation generates islet cells in recipient mice. These cells express insulin and genetic markers of -cells [27, 28]. Few reports have shown that bone marrow cells can differentiate in vitro under controlled conditions into insulin-expressing cells. Such cells transplanted under the kidney capsule of diabetic animals have been demonstrated to regulate glucose levels in the blood [29]. ES cells contain potent chromatin-remodeling activities; observations suggest that chromatin dynamics may be especially important for early lineage decisions. Chromatin dynamics are also involved in the differentiation of adult stem cells. For a better understanding of stem cell differentiation, chromatin dynamics should be considered. The reprogramming of bone mar-

8 Tayaramma, Ma, Rohde et al Figure 6. Ultrastructural analysis of insulin-producing cell clusters. Postembedding immunogold staining for insulin in day 10 islet-like clusters. Secretory granules (arrow) are densely packed within the cytoplasm of the differentiated cell (A). At higher magnification, insulin granules (arrows) are seen in secretory vesicles (B). (C): Positive control for immunogold labeling: positive granules (arrows) in adult mouse pancreas. (D): Negative control. Abbreviation: N, nucleus. row cells to insulin-producing cells may depend on chromatin modulation. To evaluate whether chromatin reprogramming can contribute to the in vitro differentiation of BM cells into insulinproducing cells, we have added the histone deacetylase inhibitor (HDACi), TSA, to the culture medium. TSA is the best-studied HDACi [30]. TSA has been reported to suppress the growth of pancreatic adenocarcinoma cells [31]. Human hematopoietic stem cells (HSCs) and progenitor cells (HPCs), when exposed to 5-aza-2 -deoxycytidine and TSA in vitro, show significant expansion of a subset of CD34 cells [32]. It was reported at the site of insulin one promoter in pancreatic -cells, lysine acetylation of histone H3 is required for establishment of an open chromatin structure [33]. Lumelsky et al. also presented in a recent publication, the level of histone H3 acetylation at the site of insulin one gene promoter was significantly higher in long-term proliferating islet progenitor-like cells [34]. We have explored the possibility of using mouse BM cells as a source for insulin-producing cells following treatment with TSA and subsequently culturing in the presence of high glucose and GLP-1. Glucose is well known as a growth factor for -cells [35] and promotes -cell replication in vitro and in vivo at concentrations of mmol/l [36]. GLP-1 is an incretin hormone capable of converting intestinal epithelial cells into functional insulin-producing cells [37]. We have generated functional insulin-producing cells from bone marrow and confirmed the presence of insulin production by RT-PCR, immunofluorescence, Western blot, and electron microscopy combined with immunogold anti-insulin labeling. Furthermore, we have tested the functionality of the in vitro generated insulinproducing cells from BM by measuring insulin release in response to high glucose concentrations. Taken collectively, these studies provide evidence that the BM contains pluripotent cells capable of being reprogrammed in vitro by TSA to become functional insulin-producing cells. In addition, we have found transcripts for proinsulin I and II by RT-PCR. Transcripts for the component of the ATPsensitive K channel SUR1 and for GLUT-2, which participates in the signal-mediated secretion of insulin in pancreatic -cells, have also been detected. Moreover, transcription factors Isl 1, Pax 4, Ngn-3, and IAPP are present at later stages of differentiation. Pax4 is required for the development of cells restricted to the - and -cell lineages. Mice lacking Pax4 fail to develop any -cells and become diabetic [38]. We have also detected the expression of glucagon and somatostatin by PCR, and the respective proteins have been detected by immunocytochemistry. We have found fewer somatostatin-positive and glucagon-positive cells in culture by single-staining immunocytochemistry in contrast to the large number of insulin-positive cells in culture. Double-staining for insulin and somatostatin has confirmed the low numbers of somatostatin-containing cells. PDX-1 gene expression is low at earlier stages of differentiation; PDX-1 expression at these stages may initiate a cascade of events leading to insulin transcription. Although at later stages, high levels of PDX-1 transcript are found, we have failed to detect PDX-1 by immunocytochemistry. This is not surprising, because it is known that when the mrna for PDX-1 is highly abundant, immunoreactivity can hardly be detected [39]. During embryogenesis, only cells expressing Ngn-3 are islet progenitors [40]. Indeed, we have revealed the expression of the Ngn-3 transcription factor exclusively in the nucleus of the islet-like cells. Other reports [41] have shown that cells coexpressing glucagon, insulin, and Ngn-3 eventually become mature -cells. The islet-like clusters in our culture system express insulin, glucagon, and Ngn-3 and thus strongly resemble pancreatic precursor cells. This has been confirmed by our immunocytochemical results. The C-peptide expression in islet-like cells and glucosedependent insulin release provide evidence that these cells synthesize and release insulin. C-peptide is a by-product of insulin synthesis, and therefore the demonstration of C-peptide and the colocalization of insulin are reliable methods to investigate pancreatic differentiation in vitro. In our study, BM cell differentiate into cells coexpressing insulin and C-peptide; this rules out the uptake of insulin from the culture medium, as mentioned

9 2866 Murine Bone Marrow-Derived Insulin-Producing Cells above. The data confirm that BM cells are capable of differentiating into pancreatic cells producing insulin de novo. This secretion of insulin seems to be dependent upon the concentration of glucose in the medium; however, osmotic effects cannot be ruled out, although Lumelsky et al. [14] have found no such effects with sucrose. In summary, we have shown here that murine BM cells are reprogrammed into insulin-producing cells by treatment with the histone deacetylase inhibition factor, TSA, and following culture in a high-glucose medium. However, further research has to be carried out on chromatin-remodeling factors to understand the mechanisms that are involved in cell-fate determination. The insulin-producing cells secrete a substantial amount of insulin, and immunostaining and RT-PCR analysis have revealed that islet-like cells derived from bone marrow are similar to pancreatic cells. The development of new protocols to differentiate BM to pancreatic -like cells may enable the use of these cells for future cell therapy of type 1 diabetes. ACKNOWLEDGMENTS The work was supported by a Grant MA 852/7-3 from Deutsche Forschungsgemeinschaft (DFG). We thank P. Paul Müller and Dr. Theresa Jones for critically reading the manuscript and Prof. Michael S. German UCSF Diabetes Center, CA for providing aliquots of Ngn3 antibody. DISCLOSURES The authors indicate no potential conflicts of interest. REFERENCES 1 Shapiro AM, Lakey JR, Ryan EA et al. Islet transplantation in seven patients with type 1 diabetes mellitus using a glucocorticoid free immunosuppressive regimen. N Engl J Med 2000;343: Bonner-Weir S, Taneja M, Weir GC et al. In vitro cultivation of human islets from expanded ductal tissue. Proc Natl Acad Sci USA2000;97: Abraham EJ, Leech CA, Lin JC et al. Insulinotropic hormone glucagon-like peptide-1 differentiation of human pancreatic islet-derived progenitor cells into insulin producing cells. Endocrinology 2002;143: Schmied BM, Ulrich A, Matsuzaki H et al. Transdifferentiation of human islet cells in a long-term culture. Pancreas 2001;23: Lipsett M, Finegood DT. Beta-cell neogenesis during prolonged hyperglycemia in rats. Diabetes 2002;51: Ramiya VK, Maraist M, Arfors KE et al. Reversal of insulin-dependent diabetes using islets generated in vitro from pancreatic stem cells. Nat Med 2000;6: Schwitzgebel VM, Scheel DW, Conners JR et al. Expression of neurogenin3 reveals an islet cell precursor population in the pancreas. Development 2000;127: Zulewski H, Abraham EJ, Gerlach MJ et al. Multipotential nestinpositive stem cells isolated from adult pancreatic islets differentiate ex vivo into pancreatic endocrine, exocrine, and hepatic phenotypes. Diabetes 2001;50: Gao R, Ustinov J, Pulkkinen MA et al. Characterization of endocrine progenitor cells and critical factors for their differentiation in human adult pancreatic cell culture. Diabetes 2003;52: Hardikar AA, Marcus-Samuels B, Geras-Raaka E et al. Human pancreatic precursor cells secrete FGF2 to stimulate clustering into hormoneexpressing islet-like cell aggregates. Proc Natl Acad Sci USA2003; 100: Yang L, Li S, Hatch H et al. In vitro trans-differentiation of adult hepatic stem cells into pancreatic endocrine hormone producing cells. Proc Natl Acad Sci USA2002;99: Kodama S, Kuhtreiber W, Fujimura S et al. Islet regeneration during the reversal of autoimmune diabetes in NOD mice. Science 2003;302: Soria B, Roche E, Berna G et al. Insulin-secreting cells derived from embryonic stem cells normalize glycemia in streptozotocin-induced diabetic mice. Diabetes 2000;49: Lumelsky N, Blondel O, Laeng P et al. Differentiation of embryonic stem cells to insulin-secreting structures similar to pancreatic islets. Science 2001;292: Assady S, Maor G, Amit M et al. Insulin production by human embryonic stem cells. Diabetes 2001;50: Oh SH, Muzzonigro TM, Bae SH et al. Adult bone marrow-derived cells trans-differentiating into insulin-producing cells for the treatment of type I diabetes. Lab Invest 2004;84: Richon VM, O Brien JP. Histone deacetylase inhibitors: a new class of potential therapeutic agents for cancer treatment. Clin Cancer Res 2002; 8: Marks P, Rifkind RA, Richon VM et al. Histone deacetylases and cancer: causes and therapies. Nat Rev Cancer 2001;1: Yoshida M, Nomura S, Beppu T. Effects of trichostatins on differentiation of murine erythroleukemia cells. Cancer Res 1987;47: Yoshida M, Kijima M, Akita M et al. Potent and specific inhibition of mammalian histone deacetylase both in vivo and in vitro by trichostatin A. J Biol Chem 1990;265: Gotoh M, Maki T, Kiyoizumi T et al. An improved method for isolation of mouse pancreatic islets. Transplantation 1985;40: Shiroi A, Yoshikawa M, Yokota H et al. Identification of insulinproducing cells derived from embryonic stem cells by zinc-chelating dithizone. STEM CELLS 2002;20: León-Quinto T, Jones J, Skoudy A et al. In vitro directed differentiation of mouse embryonic stem cells into insulin-producing cells. Diabetologia 2004;47: Blyszczuk P, Czyz J, Kania G et al. Expression of Pax4 in embryonic stem cells promotes differentiation of nestin-positive progenitor and insulin-producing cells. Proc Natl Acad Sci USA2003;100: Rajagopal J, Anderson WJ, Kume S et al. Insulin staining of ES cell progeny from insulin uptake. Science 2003;299: Hansson M, Tonning A, Frandsen U et al. Artifactual insulin release from differentiated embryonic stem cells. Diabetes 2004;53: Ianus A, Holz GG, Theise ND et al. In vivo derivation of glucosecompetent pancreatic endocrine cells from bone marrow without evidence of cell fusion. J. Clin. Invest. 2003;111: Hess D, Li L, Martin M et al. Bone marrow-derived stem cells initiate pancreatic regeneration. Nat Biotechnol. 2003;21: Tang DQ, Cao LZ, Brant R et al. In vivo and in vitro characterization of insulin-producing cells obtained from murine bone marrow. Diabetes 2004;53: Xiao H, Hasegawa T, Isobe K. Both sp1 and sp3 are responsible for p21w af1 promoter activity induced by histone deacetylases inhibitor in NIH3T3 cells. J Cell Biochem 1999;73: Massimo D, Chiara C, Laura F et al. Trichostatin A, an inhibitor of histone deacetylases, strongly suppresses growth of pancreatic adenocarcinoma cells. Mol Carcinog 2003;38: Mohammed M, Nadim M, Donald L et al. Modification of hematopoietic stem cell fate by 5aza 2-deoxycytidine and trichostatin A. Blood 2004; 103: Chakrabarti SK, Francis J, Ziesmann SM et al. Covalent histone modifications underlie the developmental regulation of insulin gene transcription in pancreatic beta cells. J Biol Chem 2003;278:

10 Tayaramma, Ma, Rohde et al Ta M, Choi Y, Atouf F et al. The defined combination of growth factors controls generation of long-term-replicating islet progenitor-like cells from cultures of adult mouse pancreas. STEM CELLS 2006;24: Soria B. In-vitro differentiation of pancreatic beta cells. Differentiation 2001;68: Bonner-Weir S, Deery D, Leahy JL et al. Compensatory growth of pancreatic -cells in adult rats after short-term glucose infusion. Diabetes 1989;38: Suzuki A, Nakauchi H, Taniguchi H. Glucagon-like peptide 1 (1 37) converts intestinal epithelial cells into insulin-producing cells. Proc Natl Acad Sci USA2003;100: Sosa-Pineda B, Chowdhury K, Torres M et al. The Pax4 gene is essential for differentiation of insulin producing beta cells in the mammalian pancreas. Nature 1997;386: Stoffers DA, Heller RS, Miller CP et al. Developmental expression of the homeodomain protein IDX-1 in mice transgenic for an IDX-1 promoter/ lacz transcriptional reporter. Endocrinology 1999;140: Gu G, Dubauskaite J, Melton DA. Direct for the evidence for the pancreatic lineage: NGN 3 cells are islet progenitors and are distinct from duct progenitors. Development 2002;129: Chiang MK, Melton DA. Single-cell transcript analysis of pancreas development. Dev Cell 2003;4: See for supplemental material available online.

Stem Cell Therapy In Diabetes Mellitus. Professor Megahid Abuelmagd Diabetes And Endocrine Unit. Mansoura Faculty Of Medicine

Stem Cell Therapy In Diabetes Mellitus. Professor Megahid Abuelmagd Diabetes And Endocrine Unit. Mansoura Faculty Of Medicine Stem Cell Therapy In Diabetes Mellitus Professor Megahid Abuelmagd Diabetes And Endocrine Unit. Mansoura Faculty Of Medicine For many years, there has been great interest in approaches to the replacement

More information

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models

More information

Investigating the role of a Cryptosporidium parum apyrase in infection

Investigating the role of a Cryptosporidium parum apyrase in infection Investigating the role of a Cryptosporidium parum apyrase in infection David Riccardi and Patricio Manque Abstract This project attempted to characterize the function of a Cryptosporidium parvum apyrase

More information

Regenerative Medicine : A Promising Approach In Overcoming Diabetes As An Increasing Economic Health Burden

Regenerative Medicine : A Promising Approach In Overcoming Diabetes As An Increasing Economic Health Burden Journal of Emerging Economies and Islamic Research www.jeeir.com Regenerative Medicine : A Promising Approach In Overcoming Diabetes As An Increasing Economic Health Burden Nafeeza Mohd Ismail a, Renu

More information

Supplemental Information. McBrayer et al. Supplemental Data

Supplemental Information. McBrayer et al. Supplemental Data 1 Supplemental Information McBrayer et al. Supplemental Data 2 Figure S1. Glucose consumption rates of MM cell lines exceed that of normal PBMC. (A) Normal PBMC isolated from three healthy donors were

More information

PROTOCOL. Immunocytochemistry (ICC) MATERIALS AND EQUIPMENT REQUIRED

PROTOCOL. Immunocytochemistry (ICC) MATERIALS AND EQUIPMENT REQUIRED PROTOCOL Immunocytochemistry (ICC) 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 11-07 MATERIALS AND EQUIPMENT REQUIRED Materials: MitoSciences primary monoclonal antibody/antibodies Fluorophore-conjugated

More information

International Journal of Pharma and Bio Sciences STEM CELL TREATMENT FOR DIABETES SAKTHIVEL.K*, RAJESH.C AND SENTHAMARAI.R

International Journal of Pharma and Bio Sciences STEM CELL TREATMENT FOR DIABETES SAKTHIVEL.K*, RAJESH.C AND SENTHAMARAI.R International Journal of Pharma and Bio Sciences STEM CELL TREATMENT FOR DIABETES SAKTHIVEL.K*, RAJESH.C AND SENTHAMARAI.R Department of, Periyar College of Pharmaceutical Sciences for Girls Tiruchirappalli

More information

Basic Science in Medicine

Basic Science in Medicine Medical Journal of th e Islamic Republic of Iran Volume 18 Number 3 Fall 1383 November 2004 Basic Science in Medicine ] EXPANSION OF HUMAN CORD BLOOD PRIMITIVE PROGENITORS IN SERUM-FREE MEDIA USING HUMAN

More information

PROTOCOL. Immunostaining for Flow Cytometry. Background. Materials and equipment required.

PROTOCOL. Immunostaining for Flow Cytometry. Background. Materials and equipment required. PROTOCOL Immunostaining for Flow Cytometry 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 Rev.0 Background The combination of single cell analysis using flow cytometry and the specificity of antibody-based

More information

Purification and Expansion of Hematopoietic Stem Cells Based on Proteins Expressed by a Novel Stromal Cell Population

Purification and Expansion of Hematopoietic Stem Cells Based on Proteins Expressed by a Novel Stromal Cell Population Purification and Expansion of Hematopoietic Stem Cells Based on Proteins Expressed by a Novel Stromal Cell Population Our bodies are constantly killing old, nonfunctional, and unneeded cells and making

More information

Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a

Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a Ryan S. Stowers, 1 Jacqueline A. Callihan, 2 James D. Bryers 2 1 Department of Bioengineering, Clemson University, Clemson,

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure

More information

ISOLATION AND PROPERTIES OF SECRETORY GRANULES FROM RAT ISLETS OF LANGERHANS. II. Ultrastructure of the Beta Granule

ISOLATION AND PROPERTIES OF SECRETORY GRANULES FROM RAT ISLETS OF LANGERHANS. II. Ultrastructure of the Beta Granule ISOLATION AND PROPERTIES OF SECRETORY GRANULES FROM RAT ISLETS OF LANGERHANS II Ultrastructure of the Beta Granule MARIE H GREIDER, S L HOWELL, and P E LACY From the Department of Pathology, Washington

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems

More information

Original Article Effect of glucagon on insulin secretion through camp signaling pathway in MIN6 cells

Original Article Effect of glucagon on insulin secretion through camp signaling pathway in MIN6 cells Int J Clin Exp Pathol 2015;8(5):5974-5980 www.ijcep.com /ISSN:1936-2625/IJCEP0006716 Original Article Effect of glucagon on insulin secretion through camp signaling pathway in MIN6 cells Si-Yuan Li 1*,

More information

a future of glucoseresponsive secretion: bionics versus nature

a future of glucoseresponsive secretion: bionics versus nature science at the cutting edge a future of glucoseresponsive insulin secretion: bionics versus nature Pratik Choudhary, John Pickup, Peter Jones, Stephanie A Amiel people with diabetes constantly walk a tight

More information

Anti-ATF6 α antibody, mouse monoclonal (1-7)

Anti-ATF6 α antibody, mouse monoclonal (1-7) Anti-ATF6 α antibody, mouse monoclonal (1-7) 73-500 50 ug ATF6 (activating transcription factor 6) is an endoplasmic reticulum (ER) membrane-bound transcription factor activated in response to ER stress.

More information

Chondrogenical Differentiation of Umbilical Cord Lining. Stem Cells

Chondrogenical Differentiation of Umbilical Cord Lining. Stem Cells Chondrogenical Differentiation of Umbilical Cord Lining Stem Cells He Xi, Masilamani Jeyakumar, Phan Toan Thang Bioengineering, National University of Bioengineering Abstract Cartilage defects, such as

More information

ArC Amine Reactive Compensation Bead Kit

ArC Amine Reactive Compensation Bead Kit ArC Amine Reactive Compensation Bead Kit Catalog no. A1346 Table 1. Contents and storage information. Material Amount Composition Storage Stability ArC reactive beads (Component A) ArC negative beads (Component

More information

Custom Antibody Services

Custom Antibody Services prosci-inc.com Custom Antibody Services High Performance Antibodies and More Broad Antibody Catalog Extensive Antibody Services CUSTOM ANTIBODY SERVICES Established in 1998, ProSci Incorporated is a leading

More information

STEM CELL FELLOWSHIP

STEM CELL FELLOWSHIP Module I: The Basic Principles of Stem Cells 1. Basics of Stem Cells a. Understanding the development of embryonic stem cells i. Embryonic stem cells ii. Embryonic germ cells iii. Differentiated stem cell

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/311/5768/1778/dc1 Supporting Online Material for Immunological Reversal of Autoimmune Diabetes Without Hematopoietic Replacement of β Cells Anish Suri,* Boris Calderon,

More information

Supporting Information

Supporting Information Supporting Information Kondo et al. 1.173/pnas.787415 SI Methods Conventional and Quantitative RT-PCR. Total RNA was extracted from cultured ES cells or ES-derived cells using the RNeasy Minikit (Qiagen).

More information

KMS-Specialist & Customized Biosimilar Service

KMS-Specialist & Customized Biosimilar Service KMS-Specialist & Customized Biosimilar Service 1. Polyclonal Antibody Development Service KMS offering a variety of Polyclonal Antibody Services to fit your research and production needs. we develop polyclonal

More information

Serum- and feeder-free media

Serum- and feeder-free media Stem Cell Research Serum- and feeder-free media StemPro hesc SFM Human Embryonic Stem Cell Culture Medium Stem Cell Research StemPro hesc SFM a fully defined, serum- and feederfree medium (SFM) specially

More information

Control of Gene Expression

Control of Gene Expression Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

Running protein gels and detection of proteins

Running protein gels and detection of proteins Running protein gels and detection of proteins 1. Protein concentration determination using the BIO RAD reagent This assay uses a colour change reaction to give a direct measurement of protein concentration.

More information

Chromatin Immunoprecipitation

Chromatin Immunoprecipitation Chromatin Immunoprecipitation A) Prepare a yeast culture (see the Galactose Induction Protocol for details). 1) Start a small culture (e.g. 2 ml) in YEPD or selective media from a single colony. 2) Spin

More information

ab185915 Protein Sumoylation Assay Ultra Kit

ab185915 Protein Sumoylation Assay Ultra Kit ab185915 Protein Sumoylation Assay Ultra Kit Instructions for Use For the measuring in vivo protein sumoylation in various samples This product is for research use only and is not intended for diagnostic

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Modulating Glucose Uptake in Skeletal Myotubes:

Modulating Glucose Uptake in Skeletal Myotubes: icell Skeletal Myoblasts Application Protocol Introduction Modulating Glucose Uptake in Skeletal Myotubes: Insulin Induction with Bioluminescent Glucose Uptake Analysis The skeletal muscle is one of the

More information

protocol handbook 3D cell culture mimsys G hydrogel

protocol handbook 3D cell culture mimsys G hydrogel handbook 3D cell culture mimsys G hydrogel supporting real discovery handbook Index 01 Cell encapsulation in hydrogels 02 Cell viability by MTS assay 03 Live/Dead assay to assess cell viability 04 Fluorescent

More information

WESTERN BLOT PROTOCOL FOR LICOR ODYSSEY SCANNER (HAKE S LAB)

WESTERN BLOT PROTOCOL FOR LICOR ODYSSEY SCANNER (HAKE S LAB) WESTERN BLOT PROTOCOL FOR LICOR ODYSSEY SCANNER (HAKE S LAB) WESTERN BLOT FOR ANALYSIS ON LICOR ODYSSEY SCANNER. 1) The Licor Odyssey protein marker is optimal as it is visible on channel 700 (2ul is enough

More information

Chromatin Immunoprecipitation (ChIP)

Chromatin Immunoprecipitation (ChIP) Chromatin Immunoprecipitation (ChIP) Day 1 A) DNA shearing 1. Samples Dissect tissue (One Mouse OBs) of interest and transfer to an eppendorf containing 0.5 ml of dissecting media (on ice) or PBS but without

More information

Stamcelleforskning- helbreder diabetes? Diabetes, beta cells and stem cell based therapy

Stamcelleforskning- helbreder diabetes? Diabetes, beta cells and stem cell based therapy 1 Stamcelleforskning- helbreder diabetes? Diabetes, beta cells and stem cell based therapy Ole D. Madsen Senior Principal Scientist Diabetes Biology Novo Nordisk A/S Honorary Professor in Diabetes Stem

More information

AAGPs TM Anti-Aging Glyco Peptides. Enhancing Cell, Tissue and Organ Integrity Molecular and biological attributes of lead AAGP molecule

AAGPs TM Anti-Aging Glyco Peptides. Enhancing Cell, Tissue and Organ Integrity Molecular and biological attributes of lead AAGP molecule AAGPs TM Anti-Aging Glyco Peptides Enhancing Cell, Tissue and Organ Integrity Molecular and biological attributes of lead AAGP molecule 1 Acknowledgements This presentation was prepared by Dr. Samer Hussein

More information

Aviva Systems Biology

Aviva Systems Biology Aviva Custom Antibody Service and Price Mouse Monoclonal Antibody Service Package Number Description Package Contents Time Price Customer provides antigen protein $6,174 Monoclonal package1 (From protein

More information

Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides

Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Polyacrylamide gel electrophoresis (PAGE) and subsequent analyses are common tools in biochemistry and molecular biology. This Application

More information

THE His Tag Antibody, mab, Mouse

THE His Tag Antibody, mab, Mouse THE His Tag Antibody, mab, Mouse Cat. No. A00186 Technical Manual No. TM0243 Update date 01052011 I Description.... 1 II Key Features. 2 III Storage 2 IV Applications.... 2 V Examples - ELISA..... 2 VI

More information

Hoechst 33342 HSC Staining and Stem Cell Purification Protocol (see Goodell, M., et al. (1996) J Exp Med 183, 1797-806)

Hoechst 33342 HSC Staining and Stem Cell Purification Protocol (see Goodell, M., et al. (1996) J Exp Med 183, 1797-806) Hoechst 33342 HSC Staining and Stem Cell Purification Protocol (see Goodell, M., et al. (1996) J Exp Med 183, 1797-86) The Hoechst purification was established for murine hematopoietic stem cells (HSC)

More information

The Need for a PARP in vivo Pharmacodynamic Assay

The Need for a PARP in vivo Pharmacodynamic Assay The Need for a PARP in vivo Pharmacodynamic Assay Jay George, Ph.D., Chief Scientific Officer, Trevigen, Inc., Gaithersburg, MD For further infomation, please contact: William Booth, Ph.D. Tel: +44 (0)1235

More information

Classic Immunoprecipitation

Classic Immunoprecipitation 292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.

More information

Understanding the immune response to bacterial infections

Understanding the immune response to bacterial infections Understanding the immune response to bacterial infections A Ph.D. (SCIENCE) DISSERTATION SUBMITTED TO JADAVPUR UNIVERSITY SUSHIL KUMAR PATHAK DEPARTMENT OF CHEMISTRY BOSE INSTITUTE 2008 CONTENTS Page SUMMARY

More information

The cell lines used in this study were obtained from the American Type Culture

The cell lines used in this study were obtained from the American Type Culture Supplementary materials and methods Cell culture and drug treatments The cell lines used in this study were obtained from the American Type Culture Collection (ATCC) and grown as previously described.

More information

Transfection reagent for visualizing lipofection with DNA. For ordering information, MSDS, publications and application notes see www.biontex.

Transfection reagent for visualizing lipofection with DNA. For ordering information, MSDS, publications and application notes see www.biontex. METAFECTENE FluoR Transfection reagent for visualizing lipofection with DNA For ordering information, MSDS, publications and application notes see www.biontex.com Description Cat. No. Size METAFECTENE

More information

Pure-IP Western Blot Detection Kit

Pure-IP Western Blot Detection Kit Product Manual Pure-IP Western Blot Detection Kit Catalog Number PRB-5002 20 blots FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction The technique of immunoprecipitation (IP) is used

More information

ELISA BIO 110 Lab 1. Immunity and Disease

ELISA BIO 110 Lab 1. Immunity and Disease ELISA BIO 110 Lab 1 Immunity and Disease Introduction The principal role of the mammalian immune response is to contain infectious disease agents. This response is mediated by several cellular and molecular

More information

ELITE Custom Antibody Services

ELITE Custom Antibody Services ELITE Custom Antibody Services ELITE Custom Antibody Services Experience, confidence, and understanding As a manufacturer and service provider, we have the experience, confidence, and understanding to

More information

RevertAid Premium First Strand cdna Synthesis Kit

RevertAid Premium First Strand cdna Synthesis Kit RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent

More information

Chapter 6. Antigen-Antibody Properties 10/3/2012. Antigen-Antibody Interactions: Principles and Applications. Precipitin reactions

Chapter 6. Antigen-Antibody Properties 10/3/2012. Antigen-Antibody Interactions: Principles and Applications. Precipitin reactions Chapter 6 Antigen-Antibody Interactions: Principles and Applications Antigen-Antibody Properties You must remember antibody affinity (single) VS avidity (multiple) High affinity: bound tightly and longer!

More information

HuCAL Custom Monoclonal Antibodies

HuCAL Custom Monoclonal Antibodies HuCAL Custom Monoclonal HuCAL Custom Monoclonal Antibodies Highly Specific, Recombinant Antibodies in 8 Weeks Highly Specific Monoclonal Antibodies in Just 8 Weeks HuCAL PLATINUM (Human Combinatorial Antibody

More information

Differentiation of bone marrow stem cells into functional pancreatic insulin-producing cells

Differentiation of bone marrow stem cells into functional pancreatic insulin-producing cells Differentiation of bone marrow stem cells into functional pancreatic insulin-producing cells Von der Fakultät für Lebenswissenschaften der Technischen Universität Carolo-Wilhelmina zu Braunschweig zur

More information

Chapter 18: Applications of Immunology

Chapter 18: Applications of Immunology Chapter 18: Applications of Immunology 1. Vaccinations 2. Monoclonal vs Polyclonal Ab 3. Diagnostic Immunology 1. Vaccinations What is Vaccination? A method of inducing artificial immunity by exposing

More information

Predict Reactivity Note Chicken (100%), Sheep (100%), Rhesus Monkey (100%), Chimpanzee (100%), Bovine (100%), Guinea pig (100%)

Predict Reactivity Note Chicken (100%), Sheep (100%), Rhesus Monkey (100%), Chimpanzee (100%), Bovine (100%), Guinea pig (100%) Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 info@genetex.com GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 infoasia@genetex.com Date :

More information

RPCI 004 v.002 Staining Procedure For all Directly Conjugated Reagents (Whole Blood Method)

RPCI 004 v.002 Staining Procedure For all Directly Conjugated Reagents (Whole Blood Method) Immune Tolerance Network RPCI 004 v.002 Staining Procedure For all Directly Conjugated Reagents (Whole Blood Method) Author: Paul Wallace, Director, RPCI Laboratory of Flow Cytometry Approved by: Paul

More information

Complex multicellular organisms are produced by cells that switch genes on and off during development.

Complex multicellular organisms are produced by cells that switch genes on and off during development. Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

TECHNICAL BULLETIN. TRI Reagent For processing tissues, cells cultured in monolayer or cell pellets. Catalog Number T9424 Store at room temperature.

TECHNICAL BULLETIN. TRI Reagent For processing tissues, cells cultured in monolayer or cell pellets. Catalog Number T9424 Store at room temperature. TRI Reagent For processing tissues, cells cultured in monolayer or cell pellets Catalog Number T9424 Store at room temperature. TECHNICAL BULLETIN Product Description TRI Reagent is a quick and convenient

More information

Mouse GLP-2 ELISA. For quantitative determination of mouse GLP-2 in serum or plasma samples.

Mouse GLP-2 ELISA. For quantitative determination of mouse GLP-2 in serum or plasma samples. Mouse GLP-2 ELISA For quantitative determination of mouse GLP-2 in serum or plasma samples. For Research Use Only. Not For Use In Diagnostic Procedures. Catalog Number: 48-GP2MS-E01 Size: 96 Wells Version:

More information

ChIP TROUBLESHOOTING TIPS

ChIP TROUBLESHOOTING TIPS ChIP TROUBLESHOOTING TIPS Creative Diagnostics Abstract ChIP dissects the spatial and temporal dynamics of the interactions between chromatin and its associated factors CD Creative Diagnostics info@creative-

More information

Chapter 2 Antibodies. Contents. Introduction

Chapter 2 Antibodies. Contents. Introduction Chapter 2 Antibodies Keywords Immunohistochemistry Antibody labeling Fluorescence microscopy Fluorescent immunocytochemistry Fluorescent immunohistochemistry Indirect immunocytochemistry Immunostaining

More information

CUSTOM ANTIBODIES. Fully customised services: rat and murine monoclonals, rat and rabbit polyclonals, antibody characterisation, antigen preparation

CUSTOM ANTIBODIES. Fully customised services: rat and murine monoclonals, rat and rabbit polyclonals, antibody characterisation, antigen preparation CUSTOM ANTIBODIES Highly competitive pricing without compromising quality. Rat monoclonal antibodies for the study of gene expression and proteomics in mice and in mouse models of human diseases available.

More information

Chapter 18 Regulation of Gene Expression

Chapter 18 Regulation of Gene Expression Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection

More information

In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab)

In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab) In vitro analysis of pri-mirna processing by Drosha-DGCR8 complex (Narry Kim s lab) 1-1. Preparation of radiolabeled pri-mirna transcript The RNA substrate for a cropping reaction can be prepared by in

More information

Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus

Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus Introduction Protein extraction from tissues and cultured cells is the first step for many biochemical and analytical

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. (A) MicroRNA 212 enhances IS from pancreatic β-cells. INS-1 832/3 β-cells were transfected with precursors for mirnas 212, 375, or negative control oligonucleotides. 48 hrs after

More information

glucose and fatty acids to raise your blood sugar levels.

glucose and fatty acids to raise your blood sugar levels. Endocrine & Cell Communication Part IV: Maintaining Balance (Homeostasis) TEACHER NOTES needs coding 1 Endocrine & Cell Communication Part IV: Maintaining Balance (Homeostasis) 2 AP Biology Curriculum

More information

MEF Nucleofector Kit 1 and 2

MEF Nucleofector Kit 1 and 2 page 1 of 7 MEF Nucleofector Kit 1 and 2 for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the they are isolated

More information

Growth of Animal Cells in Culture

Growth of Animal Cells in Culture Growth of Animal Cells in Culture The ability to study cells depends largely on how readily they can be grown and manipulated in the laboratory. Although the process is technically far more difficult than

More information

MEF Starter Nucleofector Kit

MEF Starter Nucleofector Kit page 1 of 7 MEF Starter Nucleofector Kit for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the mice they are isolated

More information

Protocol for Western Blotting

Protocol for Western Blotting Protocol for Western Blotting Materials Materials used on Day 3 Protease inhibitor stock: 1 μg/μl pepstatin A in DMSO 200 μm leupeptin in OG Buffer 200 mm PMSF: Freshly made. Ex) 34.8 mg PMSF in 1 ml isopropanol

More information

Head of College Scholars List Scheme. Summer Studentship. Report Form

Head of College Scholars List Scheme. Summer Studentship. Report Form Head of College Scholars List Scheme Summer Studentship Report Form This report should be completed by the student with his/her project supervisor. It should summarise the work undertaken during the project

More information

No Disclosures. Learning Objectives 10/25/13

No Disclosures. Learning Objectives 10/25/13 No Disclosures Gregory A. Brent, MD Departments of Medicine and Physiology David Geffen School of Medicine at UCLA VA Greater Los Angeles Healthcare System Learning Objectives Describe the pathways that

More information

ab133073 7-AAD/CFSE Cell- Mediated Cytotoxicity Assay Kit

ab133073 7-AAD/CFSE Cell- Mediated Cytotoxicity Assay Kit ab133073 7-AAD/CFSE Cell- Mediated Cytotoxicity Assay Kit Instructions for Use To quantify the cytotoxic effect of immune effector cells at a single cell level. This product is for research use only and

More information

Covalent Conjugation to Cytodiagnostics Carboxylated Gold Nanoparticles Tech Note #105

Covalent Conjugation to Cytodiagnostics Carboxylated Gold Nanoparticles Tech Note #105 Covalent Conjugation to Cytodiagnostics Carboxylated Gold Nanoparticles Tech Note #105 Background Gold nanoparticle conjugates have been widely used in biological research and biosensing applications.

More information

Methionine Sulfoxide Immunoblotting Kit

Methionine Sulfoxide Immunoblotting Kit Methionine Sulfoxide Immunoblotting Kit Item No. 600160 Customer Service 800.364.9897 * Technical Support 888.526.5351 www.caymanchem.com TABLE OF CONTENTS GENERAL INFORMATION 3 Materials Supplied 4 Precautions

More information

DRUGS FOR GLUCOSE MANAGEMENT AND DIABETES

DRUGS FOR GLUCOSE MANAGEMENT AND DIABETES Page 1 DRUGS FOR GLUCOSE MANAGEMENT AND DIABETES Drugs to know are: Actrapid HM Humulin R, L, U Penmix SUNALI MEHTA The three principal hormones produced by the pancreas are: Insulin: nutrient metabolism:

More information

ONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue

ONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue ONLINE SUPPLEMENTAL MATERIAL Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue Sungmi Park 1, Ko-Ting Lu 1, Xuebo Liu 1, Tapan K. Chatterjee 2, Steven M. Rudich 3, Neal

More information

An Overview of Cells and Cell Research

An Overview of Cells and Cell Research An Overview of Cells and Cell Research 1 An Overview of Cells and Cell Research Chapter Outline Model Species and Cell types Cell components Tools of Cell Biology Model Species E. Coli: simplest organism

More information

Aviva Systems Biology

Aviva Systems Biology Aviva Custom Antibody Services and Prices Rabbit Polyclonal Antibody Service Package Number Description Package Contents Time Price Polyclonal package 1 (From protein to antiserum) Polyclonal package 2

More information

Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control

Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control is a is a state of the art transfection reagent, specifically designed for the transfer of sirna and mirna into a variety of eukaryotic cell types. is a state of the art transfection reagent, specifically

More information

SYBR Green Realtime PCR Master Mix -Plus-

SYBR Green Realtime PCR Master Mix -Plus- Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction

More information

Western Blotting. USA: proteintech@ptglab.com UK & Europe: europe@ptglab.com China: service@ptglab.com. www.ptglab.com

Western Blotting. USA: proteintech@ptglab.com UK & Europe: europe@ptglab.com China: service@ptglab.com. www.ptglab.com Western Blotting All steps are carried out at room temperature unless otherwise indicated. Recipes for all solutions highlighted bold are included at the end of the protocol. SDS-PAGE 1. Construct an SDS-PAGE

More information

Automation of Cell Staining Technical Information Bulletin

Automation of Cell Staining Technical Information Bulletin Automation of Cell Staining Technical Information Bulletin Automation of Cell Staining Using the Biomek 4000 Laboratory Automation Workstation Amy N. Yoder, Sr. Development Scientist and Li Liu, Sr. Development

More information

Support Program for Improving Graduate School Education Advanced Education Program for Integrated Clinical, Basic and Social Medicine

Support Program for Improving Graduate School Education Advanced Education Program for Integrated Clinical, Basic and Social Medicine Support Program for Improving Graduate School Education Advanced Education Program for Integrated Clinical, Basic and Social Medicine January 27, 2009 Dear Professors (representative) of departments, Subject:

More information

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

Ubiquitin Interact Kit

Ubiquitin Interact Kit Ubiquitin Interact Kit Item No. 15978 Customer Service 800.364.9897 * Technical Support 888.526.5351 www.caymanchem.com TABLE OF CONTENTS GENERAL INFORMATION 3 Materials Supplied 3 Precautions 4 If You

More information

Human Umbilical Cord-derived Multipotent Mesenchymal Stromal Cells (huc-msc) Handling Instructions

Human Umbilical Cord-derived Multipotent Mesenchymal Stromal Cells (huc-msc) Handling Instructions Human Umbilical Cord-derived Multipotent Mesenchymal Stromal Cells (huc-msc) Order No.: 19401-005, 19401-010 Handling Instructions For preclinical ex vivo use. Not intended for therapeutic use. Table of

More information

Hypoxyprobe -1 Plus Kit Kit contents:

Hypoxyprobe -1 Plus Kit Kit contents: Updated 2015 1 PRODUCT INSERT Hypoxyprobe, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Hypoxyprobe -1 Plus Kit Kit contents: Solid pimonidazole HCl (Hypoxyprobe -1) FITC conjugated

More information

The immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small

The immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small The immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small molecules that can elicit an immune response when linked

More information

Product name Company Cat # PowerPac Basic Power supply Bio Rad 165-6019 Mini Protean electrophoresis system Mini trans blot cell Bio Rad 170-3930

Product name Company Cat # PowerPac Basic Power supply Bio Rad 165-6019 Mini Protean electrophoresis system Mini trans blot cell Bio Rad 170-3930 SDS-PAGE and western blot for low molecular weight proteins (2-20kDa) Merav Marom Shamur, Smart Assays Aim: Analysis of low molecular weight proteins by SDS-PAGE and western blot under reducing conditions.

More information

Application Note. Single Cell PCR Preparation

Application Note. Single Cell PCR Preparation Application Note Single Cell PCR Preparation From Automated Screening to the Molecular Analysis of Single Cells The AmpliGrid system is a highly sensitive tool for the analysis of single cells. In combination

More information

Custom Antibodies Services. GeneCust Europe. GeneCust Europe

Custom Antibodies Services. GeneCust Europe. GeneCust Europe GeneCust Europe Laboratoire de Biotechnologie du Luxembourg S.A. 6 rue Dominique Lang L-3505 Dudelange Luxembourg Tél. : +352 27620411 Fax : +352 27620412 Email : info@genecust.com Web : www.genecust.com

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

Uses of Flow Cytometry

Uses of Flow Cytometry Uses of Flow Cytometry 1. Multicolour analysis... 2 2. Cell Cycle and Proliferation... 3 a. Analysis of Cellular DNA Content... 4 b. Cell Proliferation Assays... 5 3. Immunology... 6 4. Apoptosis... 7

More information

Laboratory Techniques I Oncology for Scientists I

Laboratory Techniques I Oncology for Scientists I Laboratory Techniques I Oncology for Scientists I September 9 th, 2015 Hayley Affronti, PhD Student Hayley.Affronti@roswellpark.org Dr. Sheila Figel too! When we first hit the lab there are so many things

More information

EdU Flow Cytometry Kit. User Manual

EdU Flow Cytometry Kit. User Manual User Manual Ordering information: (for detailed kit content see Table 2) EdU Flow Cytometry Kits for 50 assays: Product number EdU Used fluorescent dye BCK-FC488-50 10 mg 6-FAM Azide BCK-FC555-50 10 mg

More information

Fluorescein Isothiocyanate (FITC)- conjugated Antibodies

Fluorescein Isothiocyanate (FITC)- conjugated Antibodies USER GUIDE Fluorescein Isothiocyanate (FITC)- conjugated Antibodies Catalog Numbers R933-25, R953-25, R963-25 Document Part Number 25-0376 Publication Number MAN0000194 Revision 2.0 For Research Use Only.

More information

Osteoblast Differentiation and Mineralization

Osteoblast Differentiation and Mineralization Osteoblast Differentiation and Mineralization Application Note Background Osteoblasts are specialized fibroblasts that secrete and mineralize the bone matrix. They develop from mesenchymal precursors.

More information