IGF-1R: A key linker between chemoresistance and cancer stem cells in epithelial ovarian cancer cells
|
|
- Elfreda Norton
- 7 years ago
- Views:
Transcription
1 IGF-1R: A key linker between chemoresistance and cancer stem cells in epithelial ovarian cancer cells Ram Kumar Singh, Ankit Jinager, Ajit Dhadwe, Abhijit De and Pritha Ray* Advanced Centre for Treatment Research and Education in Cancer, Tata Memorial Centre, Navi Mumbai, India 5 th Asia Pacific Summit on Cancer Therapy, 20 th 22 nd July 2015
2 Ovarian Cancer Ovarian cancer (OC) is the 4 th leading cause of gynecological deaths around the world. (Siegel et al., Cancer J Clin, 2012) As per the Tata Memorial Center, Mumbai s registry India, it is the third most lethal cancer amongst women. Types Germ cell OC (3-5%) Epithelial OC (85-90%) Sex-cord stromal cell OC (5-7%) Chemotherapy Platinum (cisplatin and carboplatin) Taxane (paclitaxel) Subtypes: Epithelial Ovarian Carcinoma Though the patients show response to 1 st line therapy, % ultimately exhibit recurrence and finally succumb to the disease.
3 Key players behind drug resistance There are subset of cells within the heterogeneous tumor designated as cancer stem cells. These CSCs have high DNA repair efficiency and chemo resistance property.
4 Ovarian cancer and chemoresistance Ovarian cancer-stem-like side population cells are tumorigenic and chemoresistant. (Hu et. al., British Journal of cancer, 2010) In vivo and in vitro studies have showed the role of Insulin Growth Factor -1Receptor (IGF-1R) cross-talk in chemoresistance and have proven that IGF-1R inhibitors can overcome cytotoxic resistance. (Wong et. al., Gynecologic Oncology, 2012).
5 Neoadjuvent therapy Debulking Surgery Adjuvant Chemotherapy Tumor Relapse Chemo resistance Tumor Relapse Early detection of Chemo resistance Chemo resistance Targeting Right population Cancer Stem Cells IGF-1R Axis
6 Schematic representation of development of cellular resistant models in A2780 cells
7 Understanding the role of the biological and molecular players during induction of drug resistance CSC characterization SP assay Biomarker assay Spheroid assay Tumor xenograft assay Cell line used A2780/APFT OAW42 SKOV3 Hey
8 Side population assay Cisplatin Model Paclitaxel Model Combination Model 2 5 p = P e rc e n t S id e P o p u la tio n p = p < p = p = p < A P F T C IS -E R C IS -L R P A C -E R P A C -L R C O M B I-E R C O M B I-L R
9 Self Renewal and Chemoresistance Property P e r c e n t V ia b ility A A S PN u m b e r o f s p h e ro id s * * * = P < * * * A N S P C IS E R S P * * * * * * C IS E R N S P C IS L R S P C IS L R N S P P A C E R S P * * * * * * P A C E R N S P P A C L R S P * * * * * * P A C L R N S P C O M B I E R S P C O M B I E R N S P C O M B I L R S P C O M B I L R N S P Number of spheroids B A2780 P= P= P= P= CIS ER CIS LR P= P= PAC ER PAC LR COMB ER COMB LR C * * * * M P S P N S P A P F T C IS -L R P A C -L R C O M B I-L R
10 Stemness gene expression across the resistant models Relative gene expression (2 - ct ) APFT CIS-ER CIS-LR PAC-ER *** PAC-LR *** COMBI-ER COMBI-LR * * ** * OCT4A *** * SOX2 ** ** Pluripotent Genes ns ns NANOG ** * ns
11 Biomarker analysis across the resistant models
12 Knock down of Oct4 gene using pll3.7 lentilox vector Oct4 target Sequence adapted from Zaheres et al, Stem Cells, I Sense Loop antisense Terminator TAACATGTGTAAGCTGCGGCCCTTCAAGAGAGGGCCGCAGCTTACACATGTTTTTTTTGC ATTGTACACATTCGACGCCGGGAAGTTCTCTCCCGGCGTCGAATGTGTACAAAAAAAACGCCGG
13 Effect of oct4 KD on its self renewal and drug resistance N u m b e r o f s e r ia l p a s s a g e A Spheroid formation assay B Spheroid formation at multiple passage Number of spheroids * P<0.05 ** P<0.005 *** P< ** *** ** ** *** * * * * * * * * * * * * * = P < * * * = P < A2780 Oct4-KD CIS ER Oct4-KD CIS LR Oct4-KD PAC ER Oct4-KD PAC LR Oct4-KD A P F T A P F T -s h O C T 4 C IS -E R C IS -E R s h O C T 4 C IS -L R C IS -L R s h O C T 4 P A C -E R P A C -E R s h O C T 4 P A C -L R P A C -L R s h O C T 4 C Oct4 KD and SP phenotype D MTT assay to monitor drug resistance E Oct4 KD and P-AKT 100 Percent Viability APFT APFT OCT4 KD CISLR CISLR OCT4 KD PAC LR PACLR OCT4 KD
14 p /s /c m ²/s r T u m o r V o lu m e (c m 3 ) In vivo imaging of PAC ER SP/NSP cells for tumor formation S P N S P D a y 0 D a y 1 5 D a y 2 5 D a y D A y 1 5 D a y 2 5 D a y 4 0
15 In vivo imaging of PAC LR SP/NSP cells for tumor formation p/s/cm²/sr p/s/cm²/sr 1.00E+05 SP Tumor Xenograft 1.00E+08 NSP Tumor Xenograft 1.00E E E+03 Day 0 Day 25 Day 40 Day 60 Day 80 Mouse1 Mouse2 Mouse3 1.00E E E+04 Day 0 Day 25 Day 40 Day 60 Day 80 Mouse 1 Mouse 2 Mouse 3
16 p /s /c m ²/s r T u m o r V o lu m e (c m 3 ) In vivo imaging of CIS LR SP/NSP cells for tumor formation S P N S P SP D a y 0 D a y 2 0 D a y 3 0 D a y 5 0 D a y 8 0 D a y 9 0 D a y D a y D a y 8 0 D a y 9 0 D a y D a y 1 1 0
17 IGF Signaling in ovarian follicular development IGF-1 -/- : Small Ovaries IGF1-R -/- : Infertile Joanne s. Richards et al., Recent Prog Horm Res The insulin-like growth factor (IGF) family is an essential growth factor system in the development of tissues or organs and postnatal growth, and maintenance of normal function of many cell types of the body (Li and Geng, 2010). IGF may sustain the stem cell's capacity of self-renewal and differentiation, promote their survival and migration, and prevent senescence acting downstream to PI3K pathway (Li and Geng, 2010). Is IGF-1R crucial for initiation and maintenance of resistance and stemness phenotype in ovarian cancer?
18 Elevated expression of IGF-1R at early stages of drug resistance A B C D Singh et. al., Cancer Letters, 2014
19 Inhibition of IGF-1R signaling with PPP C PPP is a small molecule that selectively inhibits IGF-1R kinase activity without showing any effect against Insulin receptor and other RTKs. Singh et. al., Cancer Letters, 2014
20 Potentiation of cytotoxicity using picropodophylin (PPP) Cisplatin Model Paclitaxel Model Combination Model Singh et. al., Cancer Letters, 2014
21 Effect of IGF-1R inhibition on long term survival of cells through clonogenic assay A B Singh et. al., Cancer Letters, 2014
22 N u m b e r o f s p h e r o id s Correlation between IGF-1R signaling and stemness phenotype * * * = P < * * = P < * * * * * * * * * * * * * * * * * * * Fold change (2 - ct ) PAC-ER PAC-ER PPP *** *** *** Fold change (2 - ct ) PAC-LR PAC-LR + PPP ** *** * A P P P C IS E R P P P C IS L R P P P P A C E R P P P P A C L R P P P C O M B I-E R P P P C O M B I-L R P P P 0.0 OCT4 SOX2 NANOG 0.0 OCT4 SOX2 NANOG How do late resistant cells maintain their resistant and stemness phenotype?
23 Effect of AKT inhibition on stemness property
24 Regulation of stemness and chemoresistance at early and late resistant stage Early resistant stage IGF-1R Active IGF-1R signalling Late resistant stage IGF-1R Suppressed IGF-1R signalling AKT AKT Oct4 mrna Stemness/Chemoresistance Stemness/Chemoresistance
25 Acknowledgement ACTREC and UGC for Funding UGC Fellowship 25
How To Treat Mesothelioma With A Tumor Stem Cell Inhibitor
FAK INHIBITOR DEFACTINIB (VS-6063) TARGETS MESOTHELIOMA CANCER STEM CELLS Rationale for maintenance therapy after conventional therapy Jonathan Pachter, Ph.D. Vice President of Research, Verastem, Inc.
More informationCorporate Medical Policy
Corporate Medical Policy File Name: Origination: Last CAP Review: Next CAP Review: Last Review: hematopoietic_stem-cell_transplantation_for_epithelial_ovarian_cancer 2/2001 11/2015 11/2016 11/2015 Description
More informationTargeting Specific Cell Signaling Pathways for the Treatment of Malignant Peritoneal Mesothelioma
The Use of Kinase Inhibitors: Translational Lab Results Targeting Specific Cell Signaling Pathways for the Treatment of Malignant Peritoneal Mesothelioma Sheelu Varghese, Ph.D. H. Richard Alexander, M.D.
More informationTHE CANCER STEM CELL INHIBITORS VS-6063 AND VS-5584 EXHIBIT SYNERGISTIC ANTICANCER ACTIVITY IN PRECLINICAL MODELS OF MESOTHELIOMA
THE CANCER STEM CELL INHIBITORS VS-6063 AND VS-5584 EXHIBIT SYNERGISTIC ANTICANCER ACTIVITY IN PRECLINICAL MODELS OF MESOTHELIOMA Mitchell Keegan, Ph.D. Vice President of Development, Verastem, Inc. 1
More informationCellular, Molecular, and Biochemical Targets in Breast Cancer
Cellular, Molecular, and Biochemical Targets in Breast Cancer Kristy Kummerow Ingrid Meszoely December 12, 2012 VUMC Resident Bonus Conference One size fits all surgical treatment of breast cancer Wilhelm
More informationH. Richard Alexander, Jr., M.D. Department of Surgery and The Greenebaum Cancer Center University of Maryland School of Medicine Baltimore, Md
Major Advances in Cancer Prevention, Diagnosis and Treatment~ Why Mesothelioma Leads the Way H. Richard Alexander, Jr., M.D. Department of Surgery and The Greenebaum Cancer Center University of Maryland
More informationInternational Symposium on Stem Cell Biology
International Symposium on Stem Cell Biology Expanding Horizons in Stem Cell Biology - January 30, 2012 - VENUE: ACTREC (Advanced Centre for Treatment, Research and Education in Cancer) Kharghar, Navi
More informationTargeted Therapy What the Surgeon Needs to Know
Targeted Therapy What the Surgeon Needs to Know AATS Focus in Thoracic Surgery 2014 David R. Jones, M.D. Professor & Chief, Thoracic Surgery Memorial Sloan Kettering Cancer Center I have no disclosures
More informationOvarian cancer. A guide for journalists on ovarian cancer and its treatment
Ovarian cancer A guide for journalists on ovarian cancer and its treatment Contents Contents 2 3 Section 1: Ovarian Cancer 4 i. Types of ovarian cancer 4 ii. Causes and risk factors 5 iii. Symptoms and
More informationBrigham and Women s Hospital, Boston, MA, USA; 2 Verastem, Inc., Boston, MA, USA
Determination of Biomarker Response in a Phase II Window of Opportunity Study of Defactinib (VS 6063), a Focal Adhesion Kinase (FAK) Inhibitor, in Patients with Resectable Malignant Pleural Mesothelioma
More informationUpdate on Clinical Trials and Foundation Funded Grants
Update on Clinical Trials and Foundation Funded Grants Mary Hesdorffer, MS, APRN-BC Medical Liaison Meso Foundation www.curemeso.org Delivering the Diagnosis Delivering the Diagnosis Day 1 Taking control
More informationPersonalized Medicine for Triple Negative Breast Cancer - New Dimensions in Therapeutic Individualization
Personalized Medicine for Triple Negative Breast Cancer - New Dimensions in Therapeutic Individualization Bryan P. Schneider & Milan Radovich Medicine & Medical Molecular Genetics Indiana University School
More informationMiquel Àngel Seguí Palmer
Miquel Àngel Seguí Palmer HER2+ Breast Cancer is characterized by overexpression of HER2 receptors HER2+ Breast Cancer is characterized by overexpression of HER2 receptors HER2+ status is associated with
More informationFertility Preservation in Women with Cancer. Objectives. Patient #1 10/24/2011. The audience will understand: How cancer therapy affects fertility.
Fertility Preservation in Women with Cancer Leslie R. DeMars Dartmouth-Hitchcock Medical Center Objectives The audience will understand: How cancer therapy affects fertility. Who should be considered for
More informationPharmacogenomic Approaches. Luis Paz-Ares Hospital Universitario Virgen del Rocio Seville, Spain
Pharmacogenomic Approaches Luis Paz-Ares Hospital Universitario Virgen del Rocio Seville, Spain Pharmacogenetics & Pharmacogenomics Medicine tailored to the individual Genetic information, including the
More informationExelixis Showcases R&D Pipeline at JPMorgan Healthcare Conference
Exelixis Showcases R&D Pipeline at JPMorgan Healthcare Conference Two New Clinical Programs and Significant Expansion of Cancer Pipeline Planned for 2004 SOUTH SAN FRANCISCO, Calif., Jan. 13 /PRNewswire-FirstCall/
More informationFuture Directions in Clinical Research. Karen Kelly, MD Associate Director for Clinical Research UC Davis Cancer Center
Future Directions in Clinical Research Karen Kelly, MD Associate Director for Clinical Research UC Davis Cancer Center Outline 1. Status of Cancer Treatment 2. Overview of Clinical Research at UCDCC 3.
More informationNew Directions in Treatment of Ovarian Cancer. Amit M. Oza Princess Margaret Hospital University of Toronto
New Directions in Treatment of Ovarian Cancer Amit M. Oza Princess Margaret Hospital University of Toronto Newly diagnosed: scenario Ist line Surgery chemotherapy Cure If can t cure can we turn into chronic
More informationPI3K signaling pathway a new target for breast cancer treatment
PI3K signaling pathway a new target for breast cancer treatment Introduction At the 37 th annual San Antonio Breast Cancer Symposium, SABCS, a number of interesting research trends, novelties as well as
More informationBreast Cancer Treatment Guidelines
Breast Cancer Treatment Guidelines DCIS Stage 0 TisN0M0 Tamoxifen for 5 years for patients with ER positive tumors treated with: -Breast conservative therapy (lumpectomy) and radiation therapy -Excision
More informationINTERNATIONAL COURSE:
INTERNATIONAL COURSE: Novel mechanisms of signal transduction involved in cancer chemoresistance - Focus on IGF signaling integration and cross-talk. University Campus S Venuta - Catanzaro, Italy Lecture
More informationFuture Oncology: Technology, Products, Market and Service Opportunities
Brochure More information from http://www.researchandmarkets.com/reports/296370/ Future Oncology: Technology, Products, Market and Service Opportunities Description: Future Oncology is an analytical newsletter
More informationMetastatic Breast Cancer 201. Carolyn B. Hendricks, MD October 29, 2011
Metastatic Breast Cancer 201 Carolyn B. Hendricks, MD October 29, 2011 Overview Is rebiopsy necessary at the time of recurrence or progression of disease? How dose a very aggressive treatment upfront compare
More informationCancerStemCell Markers in Lung Cancers: Proofsof. Reservations. Lourdes Cortes-Dericks, PhD University of Hamburg Hamburg, Germany
CancerStemCell Markers in Lung Cancers: Proofsof ConceptsandSome Reservations Lourdes Cortes-Dericks, PhD University of Hamburg Hamburg, Germany Lung cancer: highest death rate and poorest patient survival
More informationSummary of Discussion on Non-clinical Pharmacology Studies on Anticancer Drugs
Provisional Translation (as of January 27, 2014)* November 15, 2013 Pharmaceuticals and Bio-products Subcommittees, Science Board Summary of Discussion on Non-clinical Pharmacology Studies on Anticancer
More informationLEUKEMIA LYMPHOMA MYELOMA Advances in Clinical Trials
LEUKEMIA LYMPHOMA MYELOMA Advances in Clinical Trials OUR FOCUS ABOUT emerging treatments Presentation for: Judith E. Karp, MD Advancements for Acute Myelogenous Leukemia Supported by an unrestricted educational
More informationLCFA/IASLC LORI MONROE SCHOLARSHIP IN TRANSLATIONAL LUNG CANCER RESEARCH
LCFA/IASLC LORI MONROE SCHOLARSHIP IN TRANSLATIONAL LUNG CANCER RESEARCH FUNDING OPPORTUNITY DESCRIPTION 2016 REQUEST FOR APPLICATION (RFA) Lung Cancer Foundation of America (LCFA) and the International
More informationProgress in Treating Advanced Triple Negative Breast Cancer
Progress in Treating Advanced Triple Negative Breast Cancer Lisa A. Carey, M.D. University of North Carolina at Chapel Hill Lineberger Comprehensive Cancer Center Triple Negative Breast Cancer by Subtype
More informationLung Cancer: More than meets the eye
Lung Cancer Education Program November 23, 2013 Lung Cancer: More than meets the eye Shantanu Banerji MD, FRCPC Presenter Disclosure Faculty: Shantanu Banerji Relationships with commercial interests: Grants/Research
More informationtreatments) worked by killing cancerous cells using chemo or radiotherapy. While these techniques can
Shristi Pandey Genomics and Medicine Winter 2011 Prof. Doug Brutlag Chronic Myeloid Leukemia: A look into how genomics is changing the way we treat Cancer. Until the late 1990s, nearly all treatment methods
More informationALCHEMIST (Adjuvant Lung Cancer Enrichment Marker Identification and Sequencing Trials)
ALCHEMIST (Adjuvant Lung Cancer Enrichment Marker Identification and Sequencing Trials) 3 Integrated Trials Testing Targeted Therapy in Early Stage Lung Cancer Part of NCI s Precision Medicine Effort in
More informationApplications of comprehensive clinical genomic analysis in solid tumors: obstacles and opportunities
Applications of comprehensive clinical genomic analysis in solid tumors: obstacles and opportunities Vincent A. Miller, M.D. Foundation Medicine, Inc. AACR Annual Meeting 2012 Current Concepts session
More informationHow To Use Berberine
Programa Cooperación Farma-Biotech Jornada II: Oncología Novel Berberine derivatives as antitumor agents for cancer Barcelona, 13 de abril de 2011 Programa Cooperación Farma-Biotech Jornada II: Oncología
More informationProtein kinase C alpha expression and resistance to neo-adjuvant gemcitabine-containing chemotherapy in non-small cell lung cancer
Protein kinase C alpha expression and resistance to neo-adjuvant gemcitabine-containing chemotherapy in non-small cell lung cancer Dan Vogl Lay Abstract Early stage non-small cell lung cancer can be cured
More informationLung Cancer Research: From Prevention to Cure!
Lung Cancer Research: From Prevention to Cure! Ravi Salgia, M.D, Ph.D Associate Professor of Medicine Director, Thoracic Oncology Research Program Department of Medicine Section of Hematology/Oncology
More informationIdentification of CD4+ T cell epitopes specific for the breast cancer associated antigen NY-BR-1
9/8/2015 Identification of CD4+ T cell epitopes specific for the breast cancer associated antigen NY-BR-1 Stefan Eichmüller, PhD GMP & T Cell Therapy Unit, German Cancer Research Center, Heidelberg, Germany
More informationa Phase 2 prostate cancer clinical trial is ongoing. Table 2: Squalamine vs Standard-of-care literature
PRODUCT FACT SHEET Spring 2007 MISSION STATEMENT Genaera Corporation is a biopharmaceutical company with a focus on metabolic and respiratory diseases. The compounds in the Genaera pipeline address signal
More informationCONTRACTING ORGANIZATION: University of Alabama at Birmingham Birmingham, AL 35294
AD Award Number: W81XWH-08-1-0030 TITLE: Regulation of Prostate Cancer Bone Metastasis by DKK1 PRINCIPAL INVESTIGATOR: Gregory A. Clines, M.D., Ph.D. CONTRACTING ORGANIZATION: University of Alabama at
More informationSuccesses and Limitations of Targeted Cancer Therapy in Lung Cancer
Successes and Limitations of Targeted Cancer Therapy in Lung Cancer Kenichi Suda a, b Tetsuya Mitsudomi a a Division of Thoracic Surgery, Department of Surgery, Kinki University Faculty of Medicine, Osaka-Sayama,
More informationUpdate in Hematology Oncology Targeted Therapies. Mark Holguin
Update in Hematology Oncology Targeted Therapies Mark Holguin 25 years ago Why I chose oncology People How to help people with possibly the most difficult thing they may have to deal with Science Turning
More informationPaclitaxel-Loaded Expansile Nanoparticles Enhance Chemotheraputic Drug-delivery in Mesothelioma 3D Multicellular Spheroids
Paclitaxel-Loaded Expansile Nanoparticles Enhance Chemotheraputic Drug-delivery in Mesothelioma 3D Multicellular Spheroids Hongyi Lei 1, Rong Liu 1, Aaron Colby 2, Mark W. Grinstaff 2, Yolonda L. Colson
More informationLung cancer is not just one disease. There are two main types of lung cancer:
1. What is lung cancer? 2. How common is lung cancer? 3. What are the risk factors for lung cancer? 4. What are the signs and symptoms of lung cancer? 5. How is lung cancer diagnosed? 6. What are the available
More informationCytotoxic and Biotherapies Credentialing Programme Module 2
Cytotoxic and Biotherapies Credentialing Programme Module 2 1. The Cell Cycle 2. Cancer Therapies 3. Adjunctive Therapies On completion of this module the RN will State the difference between a normal
More informationGUIDELINES ADJUVANT SYSTEMIC BREAST CANCER
GUIDELINES ADJUVANT SYSTEMIC BREAST CANCER Author: Dr Susan O Reilly On behalf of the Breast CNG Written: December 2008 Agreed at CNG: June 2009 & June 2010 Review due: June 2011 Guidelines Adjuvant Systemic
More informationNew Trends & Current Research in the Treatment of Lung Cancer, Pt. II
New Trends & Current esearch in the Treatment of Lung Cancer, Pt. II Howard (Jack) West, MD President & CEO, GACE Medical Director, Thoracic Oncology Program Swedish Cancer Institute Seattle, WA Cancer
More informationComplex Systems BioMedicine: Molecules, Signals, Networks, Diseases
The International School of Advanced Molecular BioMedicine Complex Systems BioMedicine: Molecules, Signals, Networks, Diseases AciTrezza (Catania), Italy, October 2nd-6th, 2009 Hieronymus Bosch: Garden
More informationPrediction of individual response to anticancer therapy: historical and future perspectives
Cell. Mol. Life Sci. (2015) 72:729 757 DOI 10.1007/s00018-014-1772-3 Cellular and Molecular Life Sciences REVIEW Prediction of individual response to anticancer therapy: historical and future perspectives
More informationPOLICY A. INDICATIONS
Alimta (pemetrexed) Line(s) of Business: HMO; PPO; QUEST Integration Akamai Advantage Original Effective Date: 09/01/2007 Current Effective Date: 10/01/2015 POLICY A. INDICATIONS The indications below
More informationmicrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved
microrna 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions of target mrnas Act as negative
More informationAdjuvant Therapy with Trastuzumab
Adjuvant Therapy with Trastuzumab Hiroji Iwata, M.D. Department of Breast Oncology, Aichi Cancer Center Hospital Although this presentation includes information regarding pharmaceuticals (including products
More informationIn vivo dose response assays
In vivo dose response assays Tumor assays 1. Tumor growth measurements; tumor growth delay. After irradiation, the tumor is measured daily to determine the mean diameter, or volume. Plot tumor size versus
More informationChemotherapy in Ovarian Cancer. Dr R Jones Consultant Medical Oncologist South Wales Gynaecological Oncology Group
Chemotherapy in Ovarian Cancer Dr R Jones Consultant Medical Oncologist South Wales Gynaecological Oncology Group Adjuvant chemotherapy for early stage EOC Fewer than 30% women present with FIGO stage
More informationFrequently Asked Questions About Ovarian Cancer
Media Contact: Gerri Gomez Howard Cell: 303-748-3933 gerri@gomezhowardgroup.com Frequently Asked Questions About Ovarian Cancer What is ovarian cancer? Ovarian cancer is a cancer that forms in tissues
More informationSommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle
Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle TITLE PROJET NOM HOPITAL Assessment of tumor angiogenesis using PET/CT with 18 F-Galacto- RGD. (PNC_29_001) Division of
More informationwith ovarian cancer exhibit an initial response. 5 In addition, the majority of
Research ONCOLOGY Impact of a chemoresponse assay on treatment costs for recurrent ovarian cancer Laura J. Havrilesky, MD, MHSc; Thomas C. Krivak, MD; John W. Mucenski, PharmD; Evan R. Myers, MD, MPH OBJECTIVE:
More informationSTEM CELL FELLOWSHIP
Module I: The Basic Principles of Stem Cells 1. Basics of Stem Cells a. Understanding the development of embryonic stem cells i. Embryonic stem cells ii. Embryonic germ cells iii. Differentiated stem cell
More informationBreast cancer research and a changing treatment pathway
Breast cancer research and a changing treatment pathway Stuart McIntosh Clinical Senior Lecturer in Surgical Oncology, QUB Consultant Breast Surgeon, BCH What is the breast surgeon s role in 2016? Surgery
More informationNormal values of IGF1 and IGFBP3. Kučera R., Vrzalová J., Fuchsová R., Topolčan O., Tichopád A.
Normal values of IGF1 and IGFBP3 Kučera R., Vrzalová J., Fuchsová R., Topolčan O., Tichopád A. Agenda of the presentation IGF1 and IGFBP3 basic characteristic Why normal values Groups of the persons and
More informationAvastin in breast cancer: Summary of clinical data
Avastin in breast cancer: Summary of clinical data Worldwide, over one million people are diagnosed with breast cancer every year 1. It is the most frequently diagnosed cancer in women 1,2, and the leading
More informationRilevanza dell innovazione tecnologica per la
Rilevanza dell innovazione tecnologica per la ricerca traslazionale e la terapia in oncologia Ruggero De Maria Dipartimento di Ematologia Oncologia e Medicina Molecolare, Istituto Superiore di Sanità Translational
More informationAvastin in breast cancer: Summary of clinical data
Avastin in breast cancer: Summary of clinical data Worldwide, over one million people are diagnosed with breast cancer every year 1. It is the most frequently diagnosed cancer in women 1,2, and the leading
More informationOI PARP ΑΝΑΣΤΟΛΕΙΣ ΣΤΟΝ ΚΑΡΚΙΝΟ ΤΟΥ ΜΑΣΤΟΥ ΝΙΚΟΛΑΙΔΗ ΑΔΑΜΑΝΤΙΑ ΠΑΘΟΛΟΓΟΣ-ΟΓΚΟΛΟΓΟΣ Β ΟΓΚΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ ΝΟΣ. ΜΗΤΕΡΑ
OI PARP ΑΝΑΣΤΟΛΕΙΣ ΣΤΟΝ ΚΑΡΚΙΝΟ ΤΟΥ ΜΑΣΤΟΥ ΝΙΚΟΛΑΙΔΗ ΑΔΑΜΑΝΤΙΑ ΠΑΘΟΛΟΓΟΣ-ΟΓΚΟΛΟΓΟΣ Β ΟΓΚΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ ΝΟΣ. ΜΗΤΕΡΑ Study Overview Inhibition of poly(adenosine diphosphate [ADP]-ribose) polymerase
More informationHematopoietic Stem-Cell Transplantation for Epithelial Ovarian Cancer
Hematopoietic Stem-Cell Transplantation for Epithelial Ovarian Cancer Policy Number: Original Effective Date: MM.07.014 04/01/2008 Line(s) of Business: Current Effective Date: HMO; PPO 01/23/2015 Section:
More informationHarmesh Naik, MD. Hope Cancer Clinic HOW DO I MANAGE STAGE 4 NSCLC IN 2012: STATE OF THE ART
Harmesh Naik, MD. Hope Cancer Clinic HOW DO I MANAGE STAGE 4 NSCLC IN 2012: STATE OF THE ART Goals Discuss treatment options for stage 4 lung cancer: New and old Discuss new developments in personalized
More informationUnderstanding CA 125 Levels A GUIDE FOR OVARIAN CANCER PATIENTS. foundationforwomenscancer.org
Understanding CA 125 Levels A GUIDE FOR OVARIAN CANCER PATIENTS foundationforwomenscancer.org Contents Introduction...1 CA 125................................... 1 The CA 125 Test...2 The Use of the CA
More informationCOMMISSIONING. for ULTRA-RADICAL SURGERY ADVANCED OVARIAN CANCER
COMMISSIONING for ULTRA-RADICAL SURGERY in ADVANCED OVARIAN CANCER WHY THIS MUST HAPPEN PERSPECTIVE COMMISSIONING FOR WHO, FOR WHAT? Biological Basis Surgical Basis International and national standards
More informationL Lang-Lazdunski, A Bille, S Marshall, R Lal, D Landau, J Spicer
Pleurectomy/decortication, hyperthermic pleural lavage with povidone-iodine and systemic chemotherapy in malignant pleural mesothelioma. A 10-year experience. L Lang-Lazdunski, A Bille, S Marshall, R Lal,
More informationWhat is New in Oncology. Michael J Messino, MD Cancer Care of WNC An affiliate of Mission hospitals
What is New in Oncology Michael J Messino, MD Cancer Care of WNC An affiliate of Mission hospitals Personalized Medicine Personalized Genomics Genomic Medicine Precision Medicine Definition Application
More informationCorporate Medical Policy
Corporate Medical Policy Ado-Trastuzumab Emtansine (Trastuzumab-DM1) for Treatment of File Name: Origination: Last CAP Review: Next CAP Review: Last Review: ado_trastuzumab_emtansine_(trastuzumab-dm1)_for_treatment_of_her-2_positivemalignancies
More informationBreast and Lung Cancer Biomarker Research at ASCO: Changing Treatment Patterns
July 2013 Edition Vol. 7, Issue 7 Breast and Lung Cancer Biomarker Research at ASCO: Changing Treatment Patterns By Julie Katz, MPH, MPhil Biomarkers played a prominent role in the research presented in
More informationRisk Factors and Symptoms
Ovarian Cancer Ovarian cancer is a cancer that begins in the ovaries or fallopian tubes. More than 21,000 women in the U.S. will be diagnosed with ovarian cancer this year. Research advances have made
More informationStem Cells Market Trends based on Primary Industry Analysis
GENReports: Market & Tech Analysis Stem Cells Market Trends based on Primary Industry Analysis > Enal Razvi, Ph.D. Biotechnology Analyst, Managing Director SELECTBIO US enal@selectbio.us > Gary Oosta,
More informationPrognostic and Predictive Factors in Oncology. Mustafa Benekli, M.D.
Prognostic and Predictive Factors in Oncology Mustafa Benekli, M.D. NCI Definitions ESMO Course -Essentials of Medical Oncology -Istanbul 2 Prognostic factor: NCI Definition A situation or condition, or
More informationThe following information is only meant for people who have been diagnosed with advanced non-small cell
Important information for people with advanced non-small cell lung cancer The following information is only meant for people who have been diagnosed with advanced non-small cell lung cancer (NSCLC). NSCLC
More informationBreakthrough Treatment Options for Breast Cancer
Breakthrough Treatment Options for Breast Cancer Guest Expert: Lyndsay, MD Associate Professor of Medical Oncology, Yale Cancer Center www.wnpr.org www.yalecancercenter.org Welcome to Yale Cancer Center
More informationNS5B Sequencing and Phenotypic Resistance Assays for HCV Subtypes 1a and 1b
NS5B Sequencing and Phenotypic Resistance Assays for HCV Subtypes 1a and 1b 5th Intl. Workshop on Hepatitis C Resistance & New Compounds Jacqueline Reeves NS5B Resistance Assays for HCV Subtypes 1a and
More information1 page Overview. CONCURRENT 1D, 1E, 1F Biology & Pathogenesis Multi-Modality Immunology 1
1 page Overview 21 Oct Tuesday 1500 on REGISTRATION 1800 Welcome Reception & Cocktails at the Cape Town International Conference Centre (CTICC) 22 Oct Wednesday 0730 REGISTRATION 0830 OPENING 0900 PLENARY
More informationEvaluation of the role of gene polymorphisms in anticancer drug efficacy using in vitro models
Group members and Contact details Jacques Robert graduated in medicine from the University of Strasbourg in 1974 and received hi Research projects: The objectives of our group are: (1) to identify preclinical
More informationTreatment options for recurrent ovarian cancer
Treatment options for recurrent ovarian cancer There are a number of treatment options for women with recurrent ovarian cancer. Chemotherapy is the treatment most commonly offered and on occasion, surgery
More informationAdjuvant Therapy Non Small Cell Lung Cancer. Sunil Nagpal MD Director, Thoracic Oncology Jan 30, 2015
Adjuvant Therapy Non Small Cell Lung Cancer Sunil Nagpal MD Director, Thoracic Oncology Jan 30, 2015 No Disclosures Number of studies Studies Per Month 12 10 8 6 4 2 0 1 2 3 4 5 6 7 8 9 10 11 12 1 2 3
More informationBiomarker Trends in Breast Cancer Research
WHITE PAPER Biomarker Trends in Breast Cancer Research Jason Hill, PhD, Associate Director, External Science Affairs, Quintiles Quintiles examines the novel drug combinations and mechanisms of action that
More informationCancer patients waiting for potentially live-saving treatments in UK
Cancer patients waiting for potentially live-saving treatments in UK 29 May 2005 UK patients are waiting too long for new treatments, according to a 'Dossier of Delay' compiled by information charity CancerBACUP.
More informationAbout chemotherapy for lung cancer
About chemotherapy for lung cancer This information is about chemotherapy for lung cancer. There are sections on What is chemotherapy? Chemotherapy for small cell lung cancer Chemotherapy for non-small
More informationCancer SBL101. James Gomes School of Biological Sciences Indian Institute of Technology Delhi
Cancer SBL101 James Gomes School of Biological Sciences Indian Institute of Technology Delhi All Figures in this Lecture are taken from 1. Molecular biology of the cell / Bruce Alberts et al., 5th ed.
More informationAdjuvant Therapy for Breast Cancer: Questions and Answers
CANCER FACTS N a t i o n a l C a n c e r I n s t i t u t e N a t i o n a l I n s t i t u t e s o f H e a l t h D e p a r t m e n t o f H e a l t h a n d H u m a n S e r v i c e s Adjuvant Therapy for Breast
More informationWissenschaftliche Highlights der GSF 2007
H Forschungszentrum für Umwelt und Gesundheit GmbH in der Helmholtzgemeinschaft Wissenschaftlich-Technische Abteilung Wissenschaftliche Highlights der GSF 2007 Abfrage April 2007 Institut / Selbst. Abteilung
More informationChemotherapy or Not? Anthracycline or Not? Taxane or Not? Does Density Matter? Chemotherapy in Luminal Breast Cancer: Choice of Regimen.
Chemotherapy in Luminal Breast Cancer: Choice of Regimen Andrew D. Seidman, MD Attending Physician Breast Cancer Medicine Service Memorial Sloan Kettering Cancer Center Professor of Medicine Weill Cornell
More informationMaintenance therapy in in Metastatic NSCLC. Dr Amit Joshi Associate Professor Dept. Of Medical Oncology Tata Memorial Centre Mumbai
Maintenance therapy in in Metastatic NSCLC Dr Amit Joshi Associate Professor Dept. Of Medical Oncology Tata Memorial Centre Mumbai Definition of Maintenance therapy The U.S. National Cancer Institute s
More informationOncos Therapeutics: ONCOS THERAPEUTICS Personalized Cancer Immunotherapy. March 2015. Antti Vuolanto, COO and co-founder
Oncos Therapeutics: Personalized Cancer Immunotherapy ONCOS THERAPEUTICS Personalized Cancer Immunotherapy March 2015 Antti Vuolanto, COO and co-founder 1 History of Oncos Therapeutics 2002 2007 2009 Research
More informationTECHNICAL INSIGHTS TECHNOLOGY ALERT
TECHNICAL INSIGHTS TECHNOLOGY ALERT UNLOCKING BREAST CANCER TUMORS' DRUG RESISTANCE A troubling phenomenon in breast cancer treatment is that some patients tumors become resistant to treatments over time.
More informationBiofocus Molecular Diagnostic Panel
Biofocus Molecular Diagnostic Panel Dr. Lothar Prix Biofocus GmbH, Recklinghausen, Germany www.biofocus.de Molecular detection of infectious diseases Human & veterinary hereditary diseases / genetic predisposition
More informationNew developments and controversies in breast cancer treatment: PARP Inhibitors: a breakthrough?
New developments and controversies in breast cancer treatment: PARP Inhibitors: a breakthrough? F. Cardoso, MD Champalimaud Cancer Center Lisbon, Portugal BBM 2010 Thank you to A Tutt & PRIME Oncology
More informationMATHEMATICAL MODELS OF TUMOR GROWTH INHIBITION IN XENOGRAFT MICE AFTER ADMINISTRATION OF ANTICANCER AGENTS GIVEN IN COMBINATION
MATHEMATICAL MODELS OF TUMOR GROWTH INHIBITION IN XENOGRAFT MICE AFTER ADMINISTRATION OF ANTICANCER AGENTS GIVEN IN COMBINATION Nadia Terranova UNIVERSITÀ DI PAVIA New model development: course of action
More informationCLINICAL POLICY Department: Medical Management Document Name: Opdivo Reference Number: CP.PHAR.121 Effective Date: 07/15
Page: 1 of 6 IMPORTANT REMINDER This Clinical Policy has been developed by appropriately experienced and licensed health care professionals based on a thorough review and consideration of generally accepted
More informationguides BIOLOGY OF AGING STEM CELLS An introduction to aging science brought to you by the American Federation for Aging Research
infoaging guides BIOLOGY OF AGING STEM CELLS An introduction to aging science brought to you by the American Federation for Aging Research WHAT ARE STEM CELLS? Stem cells are cells that, in cell cultures
More informationGynäkologische Onkologie-Klinische Studien
Gynäkologische Onkologie-Klinische Studien Breast cancer A randomized, phase 2 trial of AEZS-108 in chemotherapy refractory triple negative (ER/PR/HER2-negative) LHRH-R positive metastatic breast cancer
More informationMonoclonal Antibodies in Cancer. Ralph Schwall, PhD Associate Director, Translational Oncology Genentech, Inc.
Monoclonal Antibodies in Cancer Ralph Schwall, PhD Associate Director, Translational Oncology Genentech, Inc. Disclaimer I had nothing to do with Herceptin Using lessons learned in new antibody projects
More informationSUMMARY. Randolph Fillmore, Florida Science Communications
SUMMARY Randolph Fillmore, Florida Science Communications The H. Lee Moffitt Cancer Center held its first Advanced Prostate Cancer Collaboration roundtable discussion November 24, 2008. The roundtable
More informationSupport structure for genetic material
Support structure for genetic material 1 Making proteins in the RER Making copies of humans 2 Making copies of cells Making copies of genetic material 3 Making copies of genetic material Making copies
More informationGenomic Medicine The Future of Cancer Care. Shayma Master Kazmi, M.D. Medical Oncology/Hematology Cancer Treatment Centers of America
Genomic Medicine The Future of Cancer Care Shayma Master Kazmi, M.D. Medical Oncology/Hematology Cancer Treatment Centers of America Personalized Medicine Personalized health care is a broad term for interventions
More information