Fall 2016 Due October 13. Bi/Ch110 Problem Set 1

Transcription

1 Bi/Ch110 Problem Set 1 Problem 1: DNA Structure (25 points) a) Of what is DNA comprised? Please draw and label each component and label major functional groups, location and type of binding (that comprises the backbone), and list bases for DNA and RNA. (10 points) Deoxyribonucleic acid is comprised of a sugar backbone (0.5 point), phosphate group (0.5 point), and nucleotide (0.5 point). Binding occurs at asymmetric/directional ends of DNA strands (the five prime (5 ) and three prime (3 )). The 5 end contains a terminal phosphate group and the 3 end a terminal hydroxyl group, which bind adjacent DNA via phosphodiester bonds, forming a phospho-deoxyribose backbone. (2 points) The bases (DNA) include Cytosine, Guanine, Adenine, and Thymine (depicted below) (2 points, 0.5 pt for each). In RNA Uracil takes the place of Thymine. (0.5 point). Note: A free, unincorporated nucleotide usually exists in a triphosphate form; that is, it contains a chain of three phosphates. In DNA, however, it loses two of these phosphate groups, so that only one phosphate is incorporated into a strand of DNA. When nucleotides are incorporated into DNA, adjacent nucleotides are linked by a phosphodiester bond: a covalent bond is formed between the 5 phosphate group of one nucleotide and the 3 -OH group of another (see below). 1

2 2

3 (4 point for drawings : 1.5 components of DNA, 2 DNA bases + ½ Uracil) b) Describe the structure of DNA-- what form does it take? What are the chemical interactions that take place to create, stabilize or destabilize the structure? (6 points) Double helix! (1 point) In the DNA double helix, the two strands of DNA are held together/stabilized by hydrogen bonds (1 point) between the specific base pairs: the nucleotides on one strand base pairs with the nucleotide on the other strand (A-T) & (G-C). (1 point) Weak van der waals (1 point) interactions/stacking interactions between bases contribute to overall structure of the helix. Note: these are much weaker interactions than the covalent ones that exist between carbon-carbon or carbon-nitrogen that form the backbone (1 point). Repulsive ionic interactions that destabilize the helix occur between negatively charged phosphate groups. (1 point) c) What are the two categories of bases? Which nitrogenous bases comprise each? What differentiates the two groups? Draw an example of each type. (6 points) Purines and Pyrimidines. (1 point) AG purines, CTU pyrimidines (1 point) 3

4 Pyrimidine drawings (2 points) purine Purine: A pyrimidine ring fused to a imidazole ring. Contains two carbon-nitrogen ring and four nitrogen atoms. (1 point) Pyrimidine: Contains one carbon-nitrogen ring Contains one carbon-nitrogen ring and two nitrogen atoms. (1 point) d) Which of the strands below is the most stable? Why? (Please include drawing in explanation) (3 points) Strand 1: GATCTATCGATTTCAGGCATTC Strand 2: GGCGTAAGCAGTACACCGTCG Strand 2 (1 point). The structure of GC bonds allows for an extra hydrogen bond (3 vs 2), which confers additional stability to GC rich sequences (1 point). 4

5 (1 point drawing) Problem 2: Translation (16 pts) You stumble upon the following sequence of DNA: 5 TATCTGTGGATCTATAAAGCTCGCTCATTAATCATGATCACTGGGCA 3 a) What is the complementary strand? 5 TGCCCAGTGATCATGATTAATGAGCGAGCTTTATAGATCCACAGATA 3 2 points for correctness; 1 point for labeling 5' and 3' b) What is the mrna sequence generated from the original sequence? 5 UGCCCAGUGAUCAUGAUUAAUGAGCGAGCUUUAUAGAUCCACAGAUA 3 2 points for correctness; 1 point for labeling 5' and 3' c) What is the protein generated by this sequence of DNA? Use the one letter code. 5

6 MINERAL 3 points if correct; subtract 1 point if they didn't find the start codon and 1 point for continuing after the stop codon d) Say the original strand has a mutation! TATCTGTGGATCTATAAAGCTAGCTCATTAATCATGATCACTGGGCA What kind of mutation is this? What is the protein sequence? Substitution/Missense mutation; MINELAL 3 points for completely correct answer: 1 points for correct mutation; 2 points for protein if correct; subtract 1 point if they didn't find the start codon and 1 point for continuing after the stop codon e) What if, in addition to this mutation, there is a base pair that disappears? TATCTGTGGATCTATAAAGCTAG TCATTAATCATGATCACTGGGCA What kind of mutation is this? What is the protein sequence? Deletion/Frameshift Mutation; MIND 3 points for completely correct answer: 1 point for correct mutation; 2 points for protein if correct; subtract 1 point if they didn't find the start codon and 1 point for continuing after the stop codon f) Which of the two mutations presented here is worse, and why? The second mutation, as the frameshift mutation can alter every amino acid coming after it. In this case, the frameshift mutation even resulted in a truncated protein. 3 points total; 1 for identifying the correct one and 2 for the correct explanation. Problem 3: Protein Primary and Secondary Structure (23 pts) a) (4 pts) You will be required to memorize all of the amino acids names, their side chains, and their 1 letter and 3 letter codes. Take the time to practice here by writing the full name (1pt), structure (1pt), 1 letter (1pt), and 3 letter codes (1pt) of all of the natural amino acids. 6

7 (minus selenocysteine which is not a natural amino acid) b) (2pts) What group of amino acids would you expect to see in a membrane protein? Hydrophobic amino acids (AVILMFYW) c) (2pts) What secondary structure is most common in membrane proteins and why? Alpha helical: Internally hydrogen bonded without the need to interact with another secondary structure like a beta-sheet (i.e. beta-sheets need to interact with one another to complete hydrogen bonding networks whereas alpha-helices are internally hydrogen bonded). d) (2pts) What amino acids would you expect to be involved in electrostatic interactions? Charged amino acids (RHKDE) e) (2pts) What is the effect of high salt on electrostatic protein interactions? High salt breaks electrostatic interactions because the salt ions outcompete the charged amino acids. 7

8 f) (6pts) In class you did a demo in which you built models of alpha helices and beta sheets. How are the following amino acids compatible with each of those secondary structures: i. Proline (1pt): Helix breaker because of ring; does not affect beta-sheets ii. Glycine (1pt): Helix breaker because it is small and does not hydrogen bond well in a helix; flexible and good for turns (e.g. beta-turns) in beta-sheets iii. beta-branched amino acids (1pt): Sterically hindering in alpha helices; does not affect iv. beta-sheets large aromatic amino acids (1pt): Also sterically hindering in alpha helices; does not affect beta-sheets v. Alanine (1pt): Compatible with both alpha helices and beta-sheets vi. Leucine (1pt): Compatible with both alpha helices and beta-sheets g) (2.5 pts) Single amino acid substitutions can cause dramatic effects in protein function. The peptide sequence for normal hemoglobin is: VHLTPEEKSAVT. The peptide sequence for sickle cell hemoglobin is VHLTPVEKSAVT. What kind of an amino acid change is this and how might it effect protein interaction? This is an E V amino acid change (0.5 pts). Going from a charged amino acid to a hydrophobic one could break an electrostatic interaction or introduce an incorrect hydrophobic interaction. (2pts for explanation that emphasizes change from electrostatic to hydrophobic interaction) h) (2.5 pts) Another common theme in human disease is protein aggregation. Alzheimer s involves the aggregation of the peptide amyloid-beta What protein secondary structure is found in amyloid-beta 1-42 fibrils? What types of bonding interactions are involved in fibrillization? Beta-sheets are the predominant structure in beta-amyloid fibrils. (1 pt) Because amyloid-beta peptide is a membrane protein, hydrophobic interactions dominate its aggregation. (1.5 pts) Problem 4: ph/pk a s (16 points) a) (8 points) Draw the deprotonation reaction of histidine, and sketch the corresponding titration curve. Label the pk a s on the titration curve. Please use the pk a values listed in the back of the textbook. b) (2 points) What is a zwitterion? Which species in your reaction above is the zwitterion? c) (3 points) What is an isoelectric point? Calculate the isoelectric point of histidine. d) (3 points) You have a peptide with the following sequence in a buffered solution: TLIHYVEWCGPK. What is the net charge of the peptide at ph 7.0? At ph 5.0? Problem 4: ph/pk a s (16 points) a) (8 points) Draw the deprotonation reactions of histidine, and sketch the corresponding titration curve. Label the pk a s on the titration curve. Please use the pk a values listed in the back of the textbook. 8

9 b) (2 points) What is a zwitterion? Which species in your reaction above is the zwitterion? A zwitterion is a molecule that is overall neutral but has positive and negative charges. The zwitterion is labeled above. c) (3 points) What is an isoelectric point? Calculate the isoelectric point of histidine. The isoelectric point is the ph at which the molecule has a net charge of zero. To calculate the isoelectric point, pi, of histidine, we average the two pkas that flank the neutral species. pi = / 2 = 7.0 d) (3 points) You have a peptide with the following sequence in a buffered solution: TLIHYVEWCGPK. What is the net charge of the peptide at ph 7.0? At ph 5.0? 9

10 Problem 5: Amino acid analysis and protein folding (20 pts) Plot 1 Plot 2 Plot 3 The Ramachadran plots shown above represent the allowed conformational dihedral angles of (an) amino acid residue(s) in a protein structure. a) (3 pts) Which amino acids are characterized by each of the above Ramachandran plots and explain why there is a distinction in the allowed dihedral angles. Plot 1: Glycine Plot 2: All amino acids minus glycine, proline Plot 3: Proline 10

11 The allowed dihedral angles for the other amino acids (Plot 1) are a direct result of the steric interactions between the side groups eclipsing with the carbonyl oxygen. The larger the interacting group is the larger of a destabilizing steric interaction forms and disfavors that conformation. Glycine s R group is sterically small (just a Hydrogen), so there are more allowed conformations due to a smaller destabilization energy when Hydrogen is eclipsed with the carbonyl oxygen. This is why glycine is often incorporated in protein structures. Proline s R group is bonded to the backbone and is therefore rigid and confined to the observed dihedral angles. b) (4 pts) Shown below is a generalized Ramachandran plot. Describe the secondary structures that are associated with regions (A-C), providing a rationale for their placement on the diagram and insight towards why right handed α helices are more common than left handed α helices (a Newman projection may help). A β sheets, β turn B right handed α helix C left handed α helix Their placement is directly related to the allowed conformations reasoned from a Newman projection and steric arguments about bond angles in the bonding secondary structure. A right handed α helix is more favored than the left handed α helix because: 1) Restrictions on angles on the backbone. 2) Restriction on angles between the side and main chain bonds. Note that in the right handed helix, the carbonyl oxygen is eclipsing the hydrogen rather than the bulky R group in the left handed helix. This implies a smaller steric repulsion destabilization term. 3) Increased Steric Hindrance resulting from a smaller separation distance of 2.4 Å in left handed α helices as opposed to 3.2 Å in right handed α helices. 11

12 c) (3 pts) Explain what factors affect or drive protein folding (3 factors minimum). Hydrophobic Effect Hydrogen Bonding Ionic Bonding/Polar Interactions Van Der Waals Forces Disulfide Bridges d) (4 pts) Site-directed mutagenesis experiments may elucidate important structural information. Explain the possible consequences of targeting multiple residues at the core of a protein with each of the following mutations: Valine -> Leucine, Valine -> Phenylalanine, Valine -> Asaparagine, Valine -> Arginine. 12

13 Valine -> Leucine residue mutation is expected to have little consequence on the protein structure as we replace a hydrophobic residue with another hydrophobic residue of similar size Valine -> Phenylalanine, while still a hydrophobic residue, is much bulkier and thus can generate large steric interactions that destabilize the protein structural core. Valine -> Asparagine mutation is expected to have some consequence toward protein structure in that core structural hydrophobic interactions are disrupted. Valine -> Arginine mutation is expected to have similar consequences to the hydrophobic -> polar residue mutations but more extreme as we are introducing a charged residue. Interactions with water will destabilize the native structure. e) (6 pts) Protein denaturation may result from numerous factors. Please explain reason(s) for denaturation under the following conditions (heat denaturation, pressure denaturation, and ph denaturation) and identify predominant interactions that are affected (H-bonds, ion-ion, ion-dipole, π-stacking, and ion-π interactions). (2pts/condition) Heat denaturation: At high temperatures, water loses its well-defined lattice structure and the added thermal energy will largely effect the hydrogen bonding network. Further stabilizing interactions are disrupted by the thermal energy causing protein unfolding and denaturation. Predominant Interactions: Hydrophobic effect/interactions at the core of the protein. H- bonding, ion-ion networks broken during denaturation, and ion-dipole disruptions can be remediated by interactions with surrounding water. Pressure denaturation: Often, water can be present in the structure of a protein. Pressure may force water into highly dense complexes that increases the solvation of the internal nonpolar residues. Predominant Interactions: Hydrophobic effect is dominant as hydrogen bonding and ionion networks broken can be reformed with water. ph denaturation: Loss of positive charges leads to loss of favorable electrostatic interactions but also increases protein-water interactions. Disorder in both protein and water due to less hydrogen bonding gives rise to protein unfolding. Predominant Interactions: Electrostatic (ion-ion, ion-dipole, H-bonding) interactions. 13