Fall 2016 Due October 13. Bi/Ch110 Problem Set 1
|
|
- Betty Reynolds
- 7 years ago
- Views:
Transcription
1 Bi/Ch110 Problem Set 1 Problem 1: DNA Structure (25 points) a) Of what is DNA comprised? Please draw and label each component and label major functional groups, location and type of binding (that comprises the backbone), and list bases for DNA and RNA. (10 points) Deoxyribonucleic acid is comprised of a sugar backbone (0.5 point), phosphate group (0.5 point), and nucleotide (0.5 point). Binding occurs at asymmetric/directional ends of DNA strands (the five prime (5 ) and three prime (3 )). The 5 end contains a terminal phosphate group and the 3 end a terminal hydroxyl group, which bind adjacent DNA via phosphodiester bonds, forming a phospho-deoxyribose backbone. (2 points) The bases (DNA) include Cytosine, Guanine, Adenine, and Thymine (depicted below) (2 points, 0.5 pt for each). In RNA Uracil takes the place of Thymine. (0.5 point). Note: A free, unincorporated nucleotide usually exists in a triphosphate form; that is, it contains a chain of three phosphates. In DNA, however, it loses two of these phosphate groups, so that only one phosphate is incorporated into a strand of DNA. When nucleotides are incorporated into DNA, adjacent nucleotides are linked by a phosphodiester bond: a covalent bond is formed between the 5 phosphate group of one nucleotide and the 3 -OH group of another (see below). 1
2 2
3 (4 point for drawings : 1.5 components of DNA, 2 DNA bases + ½ Uracil) b) Describe the structure of DNA-- what form does it take? What are the chemical interactions that take place to create, stabilize or destabilize the structure? (6 points) Double helix! (1 point) In the DNA double helix, the two strands of DNA are held together/stabilized by hydrogen bonds (1 point) between the specific base pairs: the nucleotides on one strand base pairs with the nucleotide on the other strand (A-T) & (G-C). (1 point) Weak van der waals (1 point) interactions/stacking interactions between bases contribute to overall structure of the helix. Note: these are much weaker interactions than the covalent ones that exist between carbon-carbon or carbon-nitrogen that form the backbone (1 point). Repulsive ionic interactions that destabilize the helix occur between negatively charged phosphate groups. (1 point) c) What are the two categories of bases? Which nitrogenous bases comprise each? What differentiates the two groups? Draw an example of each type. (6 points) Purines and Pyrimidines. (1 point) AG purines, CTU pyrimidines (1 point) 3
4 Pyrimidine drawings (2 points) purine Purine: A pyrimidine ring fused to a imidazole ring. Contains two carbon-nitrogen ring and four nitrogen atoms. (1 point) Pyrimidine: Contains one carbon-nitrogen ring Contains one carbon-nitrogen ring and two nitrogen atoms. (1 point) d) Which of the strands below is the most stable? Why? (Please include drawing in explanation) (3 points) Strand 1: GATCTATCGATTTCAGGCATTC Strand 2: GGCGTAAGCAGTACACCGTCG Strand 2 (1 point). The structure of GC bonds allows for an extra hydrogen bond (3 vs 2), which confers additional stability to GC rich sequences (1 point). 4
5 (1 point drawing) Problem 2: Translation (16 pts) You stumble upon the following sequence of DNA: 5 TATCTGTGGATCTATAAAGCTCGCTCATTAATCATGATCACTGGGCA 3 a) What is the complementary strand? 5 TGCCCAGTGATCATGATTAATGAGCGAGCTTTATAGATCCACAGATA 3 2 points for correctness; 1 point for labeling 5' and 3' b) What is the mrna sequence generated from the original sequence? 5 UGCCCAGUGAUCAUGAUUAAUGAGCGAGCUUUAUAGAUCCACAGAUA 3 2 points for correctness; 1 point for labeling 5' and 3' c) What is the protein generated by this sequence of DNA? Use the one letter code. 5
6 MINERAL 3 points if correct; subtract 1 point if they didn't find the start codon and 1 point for continuing after the stop codon d) Say the original strand has a mutation! TATCTGTGGATCTATAAAGCTAGCTCATTAATCATGATCACTGGGCA What kind of mutation is this? What is the protein sequence? Substitution/Missense mutation; MINELAL 3 points for completely correct answer: 1 points for correct mutation; 2 points for protein if correct; subtract 1 point if they didn't find the start codon and 1 point for continuing after the stop codon e) What if, in addition to this mutation, there is a base pair that disappears? TATCTGTGGATCTATAAAGCTAG TCATTAATCATGATCACTGGGCA What kind of mutation is this? What is the protein sequence? Deletion/Frameshift Mutation; MIND 3 points for completely correct answer: 1 point for correct mutation; 2 points for protein if correct; subtract 1 point if they didn't find the start codon and 1 point for continuing after the stop codon f) Which of the two mutations presented here is worse, and why? The second mutation, as the frameshift mutation can alter every amino acid coming after it. In this case, the frameshift mutation even resulted in a truncated protein. 3 points total; 1 for identifying the correct one and 2 for the correct explanation. Problem 3: Protein Primary and Secondary Structure (23 pts) a) (4 pts) You will be required to memorize all of the amino acids names, their side chains, and their 1 letter and 3 letter codes. Take the time to practice here by writing the full name (1pt), structure (1pt), 1 letter (1pt), and 3 letter codes (1pt) of all of the natural amino acids. 6
7 (minus selenocysteine which is not a natural amino acid) b) (2pts) What group of amino acids would you expect to see in a membrane protein? Hydrophobic amino acids (AVILMFYW) c) (2pts) What secondary structure is most common in membrane proteins and why? Alpha helical: Internally hydrogen bonded without the need to interact with another secondary structure like a beta-sheet (i.e. beta-sheets need to interact with one another to complete hydrogen bonding networks whereas alpha-helices are internally hydrogen bonded). d) (2pts) What amino acids would you expect to be involved in electrostatic interactions? Charged amino acids (RHKDE) e) (2pts) What is the effect of high salt on electrostatic protein interactions? High salt breaks electrostatic interactions because the salt ions outcompete the charged amino acids. 7
8 f) (6pts) In class you did a demo in which you built models of alpha helices and beta sheets. How are the following amino acids compatible with each of those secondary structures: i. Proline (1pt): Helix breaker because of ring; does not affect beta-sheets ii. Glycine (1pt): Helix breaker because it is small and does not hydrogen bond well in a helix; flexible and good for turns (e.g. beta-turns) in beta-sheets iii. beta-branched amino acids (1pt): Sterically hindering in alpha helices; does not affect iv. beta-sheets large aromatic amino acids (1pt): Also sterically hindering in alpha helices; does not affect beta-sheets v. Alanine (1pt): Compatible with both alpha helices and beta-sheets vi. Leucine (1pt): Compatible with both alpha helices and beta-sheets g) (2.5 pts) Single amino acid substitutions can cause dramatic effects in protein function. The peptide sequence for normal hemoglobin is: VHLTPEEKSAVT. The peptide sequence for sickle cell hemoglobin is VHLTPVEKSAVT. What kind of an amino acid change is this and how might it effect protein interaction? This is an E V amino acid change (0.5 pts). Going from a charged amino acid to a hydrophobic one could break an electrostatic interaction or introduce an incorrect hydrophobic interaction. (2pts for explanation that emphasizes change from electrostatic to hydrophobic interaction) h) (2.5 pts) Another common theme in human disease is protein aggregation. Alzheimer s involves the aggregation of the peptide amyloid-beta What protein secondary structure is found in amyloid-beta 1-42 fibrils? What types of bonding interactions are involved in fibrillization? Beta-sheets are the predominant structure in beta-amyloid fibrils. (1 pt) Because amyloid-beta peptide is a membrane protein, hydrophobic interactions dominate its aggregation. (1.5 pts) Problem 4: ph/pk a s (16 points) a) (8 points) Draw the deprotonation reaction of histidine, and sketch the corresponding titration curve. Label the pk a s on the titration curve. Please use the pk a values listed in the back of the textbook. b) (2 points) What is a zwitterion? Which species in your reaction above is the zwitterion? c) (3 points) What is an isoelectric point? Calculate the isoelectric point of histidine. d) (3 points) You have a peptide with the following sequence in a buffered solution: TLIHYVEWCGPK. What is the net charge of the peptide at ph 7.0? At ph 5.0? Problem 4: ph/pk a s (16 points) a) (8 points) Draw the deprotonation reactions of histidine, and sketch the corresponding titration curve. Label the pk a s on the titration curve. Please use the pk a values listed in the back of the textbook. 8
9 b) (2 points) What is a zwitterion? Which species in your reaction above is the zwitterion? A zwitterion is a molecule that is overall neutral but has positive and negative charges. The zwitterion is labeled above. c) (3 points) What is an isoelectric point? Calculate the isoelectric point of histidine. The isoelectric point is the ph at which the molecule has a net charge of zero. To calculate the isoelectric point, pi, of histidine, we average the two pkas that flank the neutral species. pi = / 2 = 7.0 d) (3 points) You have a peptide with the following sequence in a buffered solution: TLIHYVEWCGPK. What is the net charge of the peptide at ph 7.0? At ph 5.0? 9
10 Problem 5: Amino acid analysis and protein folding (20 pts) Plot 1 Plot 2 Plot 3 The Ramachadran plots shown above represent the allowed conformational dihedral angles of (an) amino acid residue(s) in a protein structure. a) (3 pts) Which amino acids are characterized by each of the above Ramachandran plots and explain why there is a distinction in the allowed dihedral angles. Plot 1: Glycine Plot 2: All amino acids minus glycine, proline Plot 3: Proline 10
11 The allowed dihedral angles for the other amino acids (Plot 1) are a direct result of the steric interactions between the side groups eclipsing with the carbonyl oxygen. The larger the interacting group is the larger of a destabilizing steric interaction forms and disfavors that conformation. Glycine s R group is sterically small (just a Hydrogen), so there are more allowed conformations due to a smaller destabilization energy when Hydrogen is eclipsed with the carbonyl oxygen. This is why glycine is often incorporated in protein structures. Proline s R group is bonded to the backbone and is therefore rigid and confined to the observed dihedral angles. b) (4 pts) Shown below is a generalized Ramachandran plot. Describe the secondary structures that are associated with regions (A-C), providing a rationale for their placement on the diagram and insight towards why right handed α helices are more common than left handed α helices (a Newman projection may help). A β sheets, β turn B right handed α helix C left handed α helix Their placement is directly related to the allowed conformations reasoned from a Newman projection and steric arguments about bond angles in the bonding secondary structure. A right handed α helix is more favored than the left handed α helix because: 1) Restrictions on angles on the backbone. 2) Restriction on angles between the side and main chain bonds. Note that in the right handed helix, the carbonyl oxygen is eclipsing the hydrogen rather than the bulky R group in the left handed helix. This implies a smaller steric repulsion destabilization term. 3) Increased Steric Hindrance resulting from a smaller separation distance of 2.4 Å in left handed α helices as opposed to 3.2 Å in right handed α helices. 11
12 c) (3 pts) Explain what factors affect or drive protein folding (3 factors minimum). Hydrophobic Effect Hydrogen Bonding Ionic Bonding/Polar Interactions Van Der Waals Forces Disulfide Bridges d) (4 pts) Site-directed mutagenesis experiments may elucidate important structural information. Explain the possible consequences of targeting multiple residues at the core of a protein with each of the following mutations: Valine -> Leucine, Valine -> Phenylalanine, Valine -> Asaparagine, Valine -> Arginine. 12
13 Valine -> Leucine residue mutation is expected to have little consequence on the protein structure as we replace a hydrophobic residue with another hydrophobic residue of similar size Valine -> Phenylalanine, while still a hydrophobic residue, is much bulkier and thus can generate large steric interactions that destabilize the protein structural core. Valine -> Asparagine mutation is expected to have some consequence toward protein structure in that core structural hydrophobic interactions are disrupted. Valine -> Arginine mutation is expected to have similar consequences to the hydrophobic -> polar residue mutations but more extreme as we are introducing a charged residue. Interactions with water will destabilize the native structure. e) (6 pts) Protein denaturation may result from numerous factors. Please explain reason(s) for denaturation under the following conditions (heat denaturation, pressure denaturation, and ph denaturation) and identify predominant interactions that are affected (H-bonds, ion-ion, ion-dipole, π-stacking, and ion-π interactions). (2pts/condition) Heat denaturation: At high temperatures, water loses its well-defined lattice structure and the added thermal energy will largely effect the hydrogen bonding network. Further stabilizing interactions are disrupted by the thermal energy causing protein unfolding and denaturation. Predominant Interactions: Hydrophobic effect/interactions at the core of the protein. H- bonding, ion-ion networks broken during denaturation, and ion-dipole disruptions can be remediated by interactions with surrounding water. Pressure denaturation: Often, water can be present in the structure of a protein. Pressure may force water into highly dense complexes that increases the solvation of the internal nonpolar residues. Predominant Interactions: Hydrophobic effect is dominant as hydrogen bonding and ionion networks broken can be reformed with water. ph denaturation: Loss of positive charges leads to loss of favorable electrostatic interactions but also increases protein-water interactions. Disorder in both protein and water due to less hydrogen bonding gives rise to protein unfolding. Predominant Interactions: Electrostatic (ion-ion, ion-dipole, H-bonding) interactions. 13
Proteins and Nucleic Acids
Proteins and Nucleic Acids Chapter 5 Macromolecules: Proteins Proteins Most structurally & functionally diverse group of biomolecules. : o Involved in almost everything o Enzymes o Structure (keratin,
More informationA disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage.
CH 5 Structure & Function of Large Molecules: Macromolecules Molecules of Life All living things are made up of four classes of large biological molecules: carbohydrates, lipids, proteins, and nucleic
More informationHow To Understand The Chemistry Of Organic Molecules
CHAPTER 3 THE CHEMISTRY OF ORGANIC MOLECULES 3.1 Organic Molecules The chemistry of carbon accounts for the diversity of organic molecules found in living things. Carbon has six electrons, four of which
More informationBuilt from 20 kinds of amino acids
Built from 20 kinds of amino acids Each Protein has a three dimensional structure. Majority of proteins are compact. Highly convoluted molecules. Proteins are folded polypeptides. There are four levels
More informationPRACTICE TEST QUESTIONS
PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.
More informationPeptide bonds: resonance structure. Properties of proteins: Peptide bonds and side chains. Dihedral angles. Peptide bond. Protein physics, Lecture 5
Protein physics, Lecture 5 Peptide bonds: resonance structure Properties of proteins: Peptide bonds and side chains Proteins are linear polymers However, the peptide binds and side chains restrict conformational
More informationSTRUCTURES OF NUCLEIC ACIDS
CHAPTER 2 STRUCTURES OF NUCLEIC ACIDS What is the chemical structure of a deoxyribonucleic acid (DNA) molecule? DNA is a polymer of deoxyribonucleotides. All nucleic acids consist of nucleotides as building
More informationAmino Acids and Proteins
Amino Acids and Proteins Proteins are composed of amino acids. There are 20 amino acids commonly found in proteins. All have: N2 C α R COO Amino acids at neutral p are dipolar ions (zwitterions) because
More informationPreliminary MFM Quiz
Preliminary MFM Quiz 1. The major carrier of chemical energy in all cells is: A) adenosine monophosphate B) adenosine diphosphate C) adenosine trisphosphate D) guanosine trisphosphate E) carbamoyl phosphate
More informationName Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
More informationPaper: 6 Chemistry 2.130 University I Chemistry: Models Page: 2 of 7. 4. Which of the following weak acids would make the best buffer at ph = 5.0?
Paper: 6 Chemistry 2.130 University I Chemistry: Models Page: 2 of 7 4. Which of the following weak acids would make the best buffer at ph = 5.0? A) Acetic acid (Ka = 1.74 x 10-5 ) B) H 2 PO - 4 (Ka =
More informationAmino Acids. Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain. Alpha Carbon. Carboxyl. Group.
Protein Structure Amino Acids Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain Alpha Carbon Amino Group Carboxyl Group Amino Acid Properties There are
More information4. Which carbohydrate would you find as part of a molecule of RNA? a. Galactose b. Deoxyribose c. Ribose d. Glucose
1. How is a polymer formed from multiple monomers? a. From the growth of the chain of carbon atoms b. By the removal of an OH group and a hydrogen atom c. By the addition of an OH group and a hydrogen
More informationIV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins
IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon A. Acid/Base properties 1. carboxyl group is proton donor! weak acid 2. amino group is proton acceptor! weak base 3. At physiological ph: H
More informationH H N - C - C 2 R. Three possible forms (not counting R group) depending on ph
Amino acids - 0 common amino acids there are others found naturally but much less frequently - Common structure for amino acid - C, -N, and functional groups all attached to the alpha carbon N - C - C
More informationLecture Overview. Hydrogen Bonds. Special Properties of Water Molecules. Universal Solvent. ph Scale Illustrated. special properties of water
Lecture Overview special properties of water > water as a solvent > ph molecules of the cell > properties of carbon > carbohydrates > lipids > proteins > nucleic acids Hydrogen Bonds polarity of water
More informationLecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure
Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure Nucleic acids play an important role in the storage and expression of genetic information. They are divided into
More information2007 7.013 Problem Set 1 KEY
2007 7.013 Problem Set 1 KEY Due before 5 PM on FRIDAY, February 16, 2007. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Where in a eukaryotic cell do you
More informationPipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell?
Pipe Cleaner Proteins GPS: SB1 Students will analyze the nature of the relationships between structures and functions in living cells. Essential question: How does the structure of proteins relate to their
More informationDNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms!
Biological Sciences Initiative HHMI DNA omponents and Structure Introduction Nucleic acids are molecules that are essential to, and characteristic of, life on Earth. There are two basic types of nucleic
More informationChapter 3 Molecules of Cells
Bio 100 Molecules of cells 1 Chapter 3 Molecules of Cells Compounds containing carbon are called organic compounds Molecules such as methane that are only composed of carbon and hydrogen are called hydrocarbons
More informationCombinatorial Biochemistry and Phage Display
Combinatorial Biochemistry and Phage Display Prof. Valery A. Petrenko Director - Valery Petrenko Instructors Galina Kouzmitcheva and I-Hsuan Chen Auburn 2006, Spring semester COMBINATORIAL BIOCHEMISTRY
More informationDNA Worksheet BIOL 1107L DNA
Worksheet BIOL 1107L Name Day/Time Refer to Chapter 5 and Chapter 16 (Figs. 16.5, 16.7, 16.8 and figure embedded in text on p. 310) in your textbook, Biology, 9th Ed, for information on and its structure
More informationChapter 5. The Structure and Function of Macromolecule s
Chapter 5 The Structure and Function of Macromolecule s Most Macromolecules are polymers: Polymer: (poly: many; mer: part) Large molecules consisting of many identical or similar subunits connected together.
More informationHydrogen Bonds The electrostatic nature of hydrogen bonds
Hydrogen Bonds Hydrogen bonds have played an incredibly important role in the history of structural biology. Both the structure of DNA and of protein a-helices and b-sheets were predicted based largely
More informationDNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
More informationProteins. Proteins. Amino Acids. Most diverse and most important molecule in. Functions: Functions (cont d)
Proteins Proteins Most diverse and most important molecule in living i organisms Functions: 1. Structural (keratin in hair, collagen in ligaments) 2. Storage (casein in mother s milk) 3. Transport (HAEMOGLOBIN!)
More informationAP BIOLOGY 2008 SCORING GUIDELINES
AP BIOLOGY 2008 SCORING GUIDELINES Question 1 1. The physical structure of a protein often reflects and affects its function. (a) Describe THREE types of chemical bonds/interactions found in proteins.
More informationAmino Acids, Peptides, Proteins
Amino Acids, Peptides, Proteins Functions of proteins: Enzymes Transport and Storage Motion, muscle contraction Hormones Mechanical support Immune protection (Antibodies) Generate and transmit nerve impulses
More informationDisaccharides consist of two monosaccharide monomers covalently linked by a glycosidic bond. They function in sugar transport.
1. The fundamental life processes of plants and animals depend on a variety of chemical reactions that occur in specialized areas of the organism s cells. As a basis for understanding this concept: 1.
More informationNucleotides and Nucleic Acids
Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated
More informationShu-Ping Lin, Ph.D. E-mail: splin@dragon.nchu.edu.tw
Amino Acids & Proteins Shu-Ping Lin, Ph.D. Institute te of Biomedical Engineering ing E-mail: splin@dragon.nchu.edu.tw Website: http://web.nchu.edu.tw/pweb/users/splin/ edu tw/pweb/users/splin/ Date: 10.13.2010
More informationMs. Campbell Protein Synthesis Practice Questions Regents L.E.
Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide
More informationAdvanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK
Advanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK Dai Lu, Ph.D. dlu@tamhsc.edu Tel: 361-221-0745 Office: RCOP, Room 307 Drug Discovery and Development Drug Molecules Medicinal
More informationNon-Covalent Bonds (Weak Bond)
Non-Covalent Bonds (Weak Bond) Weak bonds are those forces of attraction that, in biological situations, do not take a large amount of energy to break. For example, hydrogen bonds are broken by energies
More informationCarbohydrates, proteins and lipids
Carbohydrates, proteins and lipids Chapter 3 MACROMOLECULES Macromolecules: polymers with molecular weights >1,000 Functional groups THE FOUR MACROMOLECULES IN LIFE Molecules in living organisms: proteins,
More information18.2 Protein Structure and Function: An Overview
18.2 Protein Structure and Function: An Overview Protein: A large biological molecule made of many amino acids linked together through peptide bonds. Alpha-amino acid: Compound with an amino group bonded
More informationThe Molecules of Cells
The Molecules of Cells I. Introduction A. Most of the world s population cannot digest milk-based foods. 1. These people are lactose intolerant because they lack the enzyme lactase. 2. This illustrates
More informationNO CALCULATORS OR CELL PHONES ALLOWED
Biol 205 Exam 1 TEST FORM A Spring 2008 NAME Fill out both sides of the Scantron Sheet. On Side 2 be sure to indicate that you have TEST FORM A The answers to Part I should be placed on the SCANTRON SHEET.
More informationIonization of amino acids
Amino Acids 20 common amino acids there are others found naturally but much less frequently Common structure for amino acid COOH, -NH 2, H and R functional groups all attached to the a carbon Ionization
More informationChapter 12 - Proteins
Roles of Biomolecules Carbohydrates Lipids Proteins 1) Catalytic 2) Transport 3) Regulatory 4) Structural 5) Contractile 6) Protective 7) Storage Nucleic Acids 12.1 -Amino Acids Chapter 12 - Proteins Amino
More information2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
More informationChapter 11: Molecular Structure of DNA and RNA
Chapter 11: Molecular Structure of DNA and RNA Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the major experiments that led to the discovery of DNA as
More informationBIOLOGICAL MOLECULES OF LIFE
BIOLOGICAL MOLECULES OF LIFE C A R B O H Y D R A T E S, L I P I D S, P R O T E I N S, A N D N U C L E I C A C I D S The Academic Support Center @ Daytona State College (Science 115, Page 1 of 29) Carbon
More informationProvincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.
Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.
More informationChapter 3: Biological Molecules. 1. Carbohydrates 2. Lipids 3. Proteins 4. Nucleic Acids
Chapter 3: Biological Molecules 1. Carbohydrates 2. Lipids 3. Proteins 4. Nucleic Acids Elements in Biological Molecules Biological macromolecules are made almost entirely of just 6 elements: Carbon (C)
More informationAmino Acids as Acids, Bases and Buffers:
Amino Acids as Acids, Bases and Buffers: - Amino acids are weak acids - All have at least 2 titratable protons (shown below as fully protonated species) and therefore have 2 pka s o α-carboxyl (-COOH)
More informationConcluding lesson. Student manual. What kind of protein are you? (Basic)
Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:
More informationBiological molecules:
Biological molecules: All are organic (based on carbon). Monomers vs. polymers: Monomers refer to the subunits that, when polymerized, make up a larger polymer. Monomers may function on their own in some
More informationElements in Biological Molecules
Chapter 3: Biological Molecules 1. Carbohydrates 2. Lipids 3. Proteins 4. Nucleic Acids Elements in Biological Molecules Biological macromolecules are made almost entirely of just 6 elements: Carbon (C)
More information2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
More informationChapter 5: The Structure and Function of Large Biological Molecules
Name Period Concept 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things fall into just four main classes. Name them. 2. Circle the three classes that are called
More informationStructure of proteins
Structure of proteins Primary structure: is amino acids sequence or the covalent structure (50-2500) amino acids M.Wt. of amino acid=110 Dalton (56 110=5610 Dalton). Single chain or more than one polypeptide
More informationCh18_PT MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Ch18_PT MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) All of the following can be classified as biomolecules except A) lipids. B) proteins. C)
More informationPeptide Bonds: Structure
Peptide Bonds: Structure Peptide primary structure The amino acid sequence, from - to C-terminus, determines the primary structure of a peptide or protein. The amino acids are linked through amide or peptide
More informationFrom DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
More informationA. A peptide with 12 amino acids has the following amino acid composition: 2 Met, 1 Tyr, 1 Trp, 2 Glu, 1 Lys, 1 Arg, 1 Thr, 1 Asn, 1 Ile, 1 Cys
Questions- Proteins & Enzymes A. A peptide with 12 amino acids has the following amino acid composition: 2 Met, 1 Tyr, 1 Trp, 2 Glu, 1 Lys, 1 Arg, 1 Thr, 1 Asn, 1 Ile, 1 Cys Reaction of the intact peptide
More informationRNA and Protein Synthesis
Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic
More informationI. Chapter 5 Summary. II. Nucleotides & Nucleic Acids. III. Lipids
I. Chapter 5 Summary A. Simple Sugars (CH 2 O) n : 1. One C contains a carbonyl (C=O) rest contain - 2. Classification by functional group: aldoses & ketoses 3. Classification by number of C's: trioses,
More informationStructures of Proteins. Primary structure - amino acid sequence
Structures of Proteins Primary structure - amino acid sequence Secondary structure chain of covalently linked amino acids folds into regularly repeating structures. Secondary structure is the result of
More informationDNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
More informationThe peptide bond is rigid and planar
Level Description Bonds Primary Sequence of amino acids in proteins Covalent (peptide bonds) Secondary Structural motifs in proteins: α- helix and β-sheet Hydrogen bonds (between NH and CO groups in backbone)
More informationBiochemistry of Cells
Biochemistry of Cells 1 Carbon-based Molecules Although a cell is mostly water, the rest of the cell consists mostly of carbon-based molecules Organic chemistry is the study of carbon compounds Carbon
More informationThe peptide bond Peptides and proteins are linear polymers of amino acids. The amino acids are
Introduction to Protein Structure Proteins are large heteropolymers usually comprised of 50 2500 monomer units, although larger proteins are observed 7. The monomer units of proteins are amino acids. The
More informationK'NEX DNA Models. Developed by Dr. Gary Benson Department of Biomathematical Sciences Mount Sinai School of Medicine
KNEX DNA Models Introduction Page 1 of 11 All photos by Kevin Kelliher. To download an Acrobat pdf version of this website Click here. K'NEX DNA Models Developed by Dr. Gary Benson Department of Biomathematical
More informationGenetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
More informationIn addition to being shorter than a single bond, the double bonds in ethylene don t twist the way single bonds do. In other words, the other atoms
In addition to being shorter than a single bond, the double bonds in ethylene don t twist the way single bonds do. In other words, the other atoms attached to the carbons (hydrogens in this case) can no
More informationChemical Basis of Life Module A Anchor 2
Chemical Basis of Life Module A Anchor 2 Key Concepts: - Water is a polar molecule. Therefore, it is able to form multiple hydrogen bonds, which account for many of its special properties. - Water s polarity
More information3120-1 - Page 1. Name:
Name: 1) Which series is arranged in correct order according to decreasing size of structures? A) DNA, nucleus, chromosome, nucleotide, nitrogenous base B) chromosome, nucleus, nitrogenous base, nucleotide,
More informationNafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush
Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush α-keratins, bundles of α- helices Contain polypeptide chains organized approximately parallel along a single axis: Consist
More informationDisulfide Bonds at the Hair Salon
Disulfide Bonds at the Hair Salon Three Alpha Helices Stabilized By Disulfide Bonds! In order for hair to grow 6 inches in one year, 9 1/2 turns of α helix must be produced every second!!! In some proteins,
More informationMyoglobin and Hemoglobin
Myoglobin and Hemoglobin Myoglobin and hemoglobin are hemeproteins whose physiological importance is principally related to their ability to bind molecular oxygen. Myoglobin (Mb) The oxygen storage protein
More informationRole of Hydrogen Bonding on Protein Secondary Structure Introduction
Role of Hydrogen Bonding on Protein Secondary Structure Introduction The function and chemical properties of proteins are determined by its three-dimensional structure. The final architecture of the protein
More informationAcademic Nucleic Acids and Protein Synthesis Test
Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination
More informationMCAT Organic Chemistry - Problem Drill 23: Amino Acids, Peptides and Proteins
MCAT rganic Chemistry - Problem Drill 23: Amino Acids, Peptides and Proteins Question No. 1 of 10 Question 1. Which amino acid does not contain a chiral center? Question #01 (A) Serine (B) Proline (C)
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More informationChapter 2 Chemical Principles
Chapter 2 Chemical Principles I. Chemistry. [Students should read this section on their own]. a. Chemistry is the study of the interactions between atoms and molecules. b. The atom is the smallest unit
More informationDNA. Discovery of the DNA double helix
DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:
More informationMolecular Cell Biology
Harvey Lodish Arnold Berk Paul Matsudaira Chris A. Kaiser Monty Krieger Matthew P. Scott Lawrence Zipursky James Darnell Molecular Cell Biology Fifth Edition Chapter 2: Chemical Foundations Copyright 2004
More informationAmino Acids, Proteins, and Enzymes. Primary and Secondary Structure Tertiary and Quaternary Structure Protein Hydrolysis and Denaturation
Amino Acids, Proteins, and Enzymes Primary and Secondary Structure Tertiary and Quaternary Structure Protein Hydrolysis and Denaturation 1 Primary Structure of Proteins H 3 N The particular sequence of
More information8/20/2012 H C OH H R. Proteins
Proteins Rubisco monomer = amino acids 20 different amino acids polymer = polypeptide protein can be one or more polypeptide chains folded & bonded together large & complex 3-D shape hemoglobin Amino acids
More informationATOMS AND BONDS. Bonds
ATOMS AND BONDS Atoms of elements are the simplest units of organization in the natural world. Atoms consist of protons (positive charge), neutrons (neutral charge) and electrons (negative charge). The
More informationThis class deals with the fundamental structural features of proteins, which one can understand from the structure of amino acids, and how they are
This class deals with the fundamental structural features of proteins, which one can understand from the structure of amino acids, and how they are put together. 1 A more detailed view of a single protein
More informationPart A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?)
ChemActivity 46 Amino Acids, Polypeptides and Proteins 1 ChemActivity 46 Part A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?) Model 1: The 20 Amino Acids at Biological p See
More informationAnswer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA.
Answer: 2. Uracil Adenine, Cytosine and Guanine are found in both RNA and DNA. Thymine is found only in DNA; Uracil takes its (Thymine) place in RNA molecules. Answer: 2. hydrogen bonds The complementary
More informationChapter 2 Polar Covalent Bonds; Acids and Bases
John E. McMurry http://www.cengage.com/chemistry/mcmurry Chapter 2 Polar Covalent Bonds; Acids and Bases Javier E. Horta, M.D., Ph.D. University of Massachusetts Lowell Polar Covalent Bonds: Electronegativity
More informationhttp://faculty.sau.edu.sa/h.alshehri
http://faculty.sau.edu.sa/h.alshehri Definition: Proteins are macromolecules with a backbone formed by polymerization of amino acids. Proteins carry out a number of functions in living organisms: - They
More informationBiological Molecules
Biological Molecules I won t lie. This is probably the most boring topic you have ever done in any science. It s pretty much as simple as this: learn the material deal with it. Enjoy don t say I didn t
More informationTranscription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
More informationChapter 5: The Structure and Function of Large Biological Molecules
Name Period Chapter 5: The Structure and Function of Large Biological Molecules Concept 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things fall into just four
More informationThe Organic Chemistry of Amino Acids, Peptides, and Proteins
Essential rganic Chemistry Chapter 16 The rganic Chemistry of Amino Acids, Peptides, and Proteins Amino Acids a-amino carboxylic acids. The building blocks from which proteins are made. H 2 N C 2 H Note:
More informationHelices From Readily in Biological Structures
The α Helix and the β Sheet Are Common Folding Patterns Although the overall conformation each protein is unique, there are only two different folding patterns are present in all proteins, which are α
More informationIntroduction, Noncovalent Bonds, and Properties of Water
Lecture 1 Introduction, Noncovalent Bonds, and Properties of Water Reading: Berg, Tymoczko & Stryer: Chapter 1 problems in textbook: chapter 1, pp. 23-24, #1,2,3,6,7,8,9, 10,11; practice problems at end
More informationPROTEINS THE PEPTIDE BOND. The peptide bond, shown above enclosed in the blue curves, generates the basic structural unit for proteins.
Ca 2+ The contents of this module were developed under grant award # P116B-001338 from the Fund for the Improvement of Postsecondary Education (FIPSE), United States Department of Education. However, those
More informationCellular Respiration Worksheet 1. 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain.
Cellular Respiration Worksheet 1 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain. 2. Where in the cell does the glycolysis part of cellular
More informationPolar Covalent Bonds and Hydrogen Bonds
Lesson 6.1: Polar Covalent Bonds and Hydrogen Bonds The last section of code will add hydrogen bonding functionality between molecules. To do so, we have to understand the chemistry of polar covalent bonds
More informationChemical Bonds and Groups - Part 1
hemical Bonds and Groups - Part 1 ARB SKELETS arbon has a unique role in the cell because of its ability to form strong covalent bonds with other carbon atoms. Thus carbon atoms can join to form chains.
More informationSection Activity #1: Fill out the following table for biology s most common elements assuming that each atom is neutrally charged.
LS1a Fall 2014 Section Week #1 I. Valence Electrons and Bonding The number of valence (outer shell) electrons in an atom determines how many bonds it can form. Knowing the number of valence electrons present
More informationMolecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
More information