Next Generation Sequencing Update

Transcription

1 Next Generation Sequencing Update Karl V. Voelkerding, MD Professor of Pathology University of Utah Medical Director for Genomics and Bioinformatics ARUP Laboratories AACC-AMP 2012 Molecular Pathology Course

2 Disclosures Grant/Research Support: NIH Salary/Consultant Fees: None Committees: College of American Pathologists Stocks/Bonds: None Honorarium/Expenses: None Intellectual Property/Royalty Income: None

3 Learning Objectives Explain Principles of NGS Describe Current and Future NGS Platform Options Discuss Spectrum of NGS Clinical Applications

4 First Next Generation Sequencing Publication 454 Life Sciences Nature 437 (7057)

5 Paradigm Shift Sanger Sequencing Electrophoretic Separation of Chain Termination Products Next Generation Sequencing Sequence Clonally Amplified DNA Templates in a Flow Cell Massively Parallel Configuration

6 Process Genomic DNA or Enriched Genes Fragmentation ( bp) End Repair and Adapter Ligation Fragment Library Adapter Fragment A Adapter Adapter Fragment B Adapter Adapter Fragment C Adapter

7 Process A Fragment Library B C Clonal Amplification of Each Fragment Emulsion Bead PCR Surface Clusters A B A B C C Sequencing of Clonal Amplicons in a Flow Cell

8 Process Sequencing of Clonal Amplicons in a Flow Cell Pyrosequencing 454 Sequencing by Ligation SOLiD Reversible Dye Terminators Illumina Generation of Luminescent or Fluorescent Images Conversion to Sequence

9 454/Roche Solexa/Illumina Bead Emulsion PCR Surface Bridge PCR Pyrosequencing Reversible dye terminators base reads base reads

10 A T C G Solexa/Illumina Sequencing

11 Qualitative and Quantitative Information Ref Seq G>A Illumina Coverage

12 Next Generation Sequencing Sequence up to billions of fragments simultaneously Iterative/cyclic sequencing Luminescence (Roche) Fluorescence (Illumina,SOLiD) ph Detection (Ion Torrent) Signal to Noise Processing Cyclic Base Calls C G A T G C Base Quality Scores C 30 G 28 A 33 T 30 G 28 C

13 Next Generation Sequencing Data Primary Sequence Alignment BWA Refined Sequence Alignment GATK/Picard Variant Calling CAATCGAATGGAATTATCGAATGCAATCGA ATAGAATCATCGAATGGACTCGAATGGAAT CATCGAA + ggfggggggggggggfgggggggfgegggg fdfeefeggggggggegbgegegggdeyed ATCTGTTCTTGTCTTTAACTCTCAAGGCAC CACCTTCCATGGTCAATAATGAACAACGCC AGCATGC + effffggggggggggggfgggggggggggg gdggggfgggfgdggaffffgfggffgdgg GAGGAGAGATATTTTGACTTCCTCTCTTCA TATTTGGATGCTTTTTACTTATCTCTCTTG ACTAATT + dzdddbxc`_ccccbeeedbeaedeeeee^ aeeedcazca_`^c[eeeeed]eeecd[dd ^eeba[d FastQ File Format Variant Annotation Annovar Variant g t>c in TPM1

14 Next Generation Sequencers First Wave Second Wave - SMS 454/Roche 2004/5 Solexa/Illumina 2006/7 ABI/Life Tech 2007/8 Helicos Pacific Biosciences GS FLX Genome Analyzer SOLiD HeliScope SMRT Third Wave GS Junior GAIIx GAIIe HiScanSQ HiSeq SOLiD 5500 SOLiD 5500xl Ion Torrent Life Technologies PGM 2011 MiSeq 2011 Clinical Dissemination

15 Illumina HiSeq Independent Flow Cells 8 Lanes per Flow Cell 2 X 100 base pairs Gb Output 8-11 Day Sequencing Run Multiple Gene Panel Samples per Lane 2-3 Exome(s) per Lane 2 Genomes per Flow Cell

16 Illumina MiSeq 2 X 150 bp Gb Output 2 X 250 bp ~27 Hrs Sequencing Run Multi-Gene Panels Genetics Oncology Microbiology Reversible Dye Terminators Viral and Bacterial Genomes Transcriptomes

17 Illumina MiSeq Transcriptome Sequencing GAPDH Sequence Reads

18 Ion Torrent Hydrogen Ion Monitors H+ Release Pyrophosphate

19 Ion Torrent base pairs 10 Mb 1.0 Gb Output ~2 Hrs Sequencing Run Multi-Gene Panels Genetics Oncology Microbiology Monitors H+ Release Viral and Bacterial Genomes Transcriptomes

20 Ion Torrent BRAF, c.1799t>a, p.v600e 26.5% mutant alleles

21 Technology Advances for 2012/13

22 Illumina HiSeq 2000 Late 2012 Upgrade Module 120 Gb 27+ Hours 2 X 100 base pairs Gb Output 11 Day Sequencing Run Single Genome in 27+ Hours Multiple Exomes in 27+ Hours

23 Late 2012 Ion Torrent - Proton Exomes/Genome Several Hours

24 Oxford Nanopore Technologies Processive Enzyme Protein Nanopore in Polymer Membrane MinION Late 2012 Current Disruption Based Electronic Signal

25 The Meeting Place Biotechnology Bioinformatics Sequence Generation Sequence Analysis Interpretation Biomedical Question What is the Genetic Landscape of a Tumor What Pathogen is Responsible for an Outbreak What Genetic Contributors Account for a Phenotype

26 Clinical Applications Whole Genome Whole Exome Multi-Gene Diagnostics Increasing Complexity

27 Multi-Gene Diagnostics Clinical Phenotype Multiple Genes Mutational Spectrum Locus Heterogeneity Allelic Heterogeneity

28 Multi-Gene Diagnostics New First Tier Genetic Testing Scaling Increases Interpretive Complexity Can Yield Non-Definitive Results Gateway to Exome/Genome

29 Multi-Gene Diagnostics Genomic DNA Target Genes Enrichment NGS Library Preparation Next Generation Sequencing Interpretation Bioinformatics

30 Gene Enrichment Approaches Genomic DNA Amplification Based Array Capture Based PCR or LR-PCR RainDance epcr Fluidigm HaloGenomics Solid Surface or In Solution Enriched Genes NGS

31 Gene Enrichment Approaches Genomic DNA Amplification Based Array Capture Based PCR or LR-PCR RainDance epcr Fluidigm HaloGenomics Solid Surface or In Solution Advantage: Enrichment Specificity Advantage: Scalable to Exome Drawbacks: Not as Scalable Instrument and Chip Costs Drawbacks: Homologous Sequence Capture Manually Complex

32 Clinical Applications Whole Genome Whole Exome Multi-Gene Diagnostics Increasing Complexity

33 Human Exome Journey to the Center of the Genome ~ 30+ Megabases (~ 1.5% of the genome) ~ 180,000 exons (~ 20,500 genes) Harbors Majority of Mendelian Mutations

34 Exome Sequencing History Genetic Diagnosis by Whole Exome Capture and Massively Parallel DNA Sequencing Choi et al PNAS 2009 Congenital Chloride Diarrhea ~45 Gene Discovery Publications May 2012 Recessive Dominant De Novo

35 Genomic DNA Library Preparation Next Generation Sequencing Library Hybridize to Exome Capture Probes Exome Enriched Library Next Generation Sequencing Bioinformatics Analysis

36 Comparison of Exome DNA Sequencing Technologies Clark et al Nature Biotech Vol 29(10) Oct 2011

37 Comparison of Exome DNA Sequencing Technologies Clark et al Nature Biotech Vol 29(10) Oct 2011

38 Exome Sequencing - Coverage of Coding Regions is Variable Coverage Aligned reads Reference Capture probes Exon 1 MAZ HLA-DOB Exon 1 Nimblegen Exome Capture and Illumina HiSeq

39 Exome Sequencing Performance Characteristics Define Proportion of Exome Adequately Covered Conversely Define Proportion of Exome Not Adequately Covered Dependent On Capture Technology Probe Design and Capture Efficiency Sequencing Depth

40 Exome Sequencing Performance Characteristics Define Proportion of Exome Accurately Sequenced Co-Capture Component Difficult to Sequence Regions Pseudogenes Repetitive Elements Paralogs and Homologs

41 Mendelian Disorders Working Hypothesis Seeking Rare Variants in a Single Gene(s) Needle(s) in the Haystack(s)

42 Bioinformatics Annotated Variants Prioritization by Heuristic Filtering Prioritization by Likelihood Prediction Filter Out Common Variants dbsnp/1000 genomes Variant frequency Intersects Pedigree Information Linkage/SGS/IBD VAAST Algorithm Variant Binning Pathogenicity Prediction Filtering SIFT/PolyPhen GERP Missense Nonsense/Frameshift/Splice Site/Indels Cross Reference Databases HGMD/OMIM/Locus Specific Candidate Genes/Potential Causative Variants

43 Genomic DNA Library Preparation Next Generation Sequencing Library Genome Sequencing Exome Enriched Library Hybridize to Exome Capture Probes Next Generation Sequencing Bioinformatics Analysis

44 Genomic DNA Library Preparation Next Generation Sequencing Library Next Generation Sequencing Bioinformatics Analysis Exome Sequencing vs Genome Sequencing Cost Coverage Complexity

45 Whole Genome Sequencing Chr 10: g.43,615,633c>g in RET

46 Horizon Continued Evolution of Sequencing and Bioinformatics College of American Pathologists Checklist Requirements for Next Generation Sequencing Professional Societies Guidelines for Clinical Next Generation Sequencing

47 Self Assessment Questions Describe Process Steps for NGS List NGS Platform Options and Capabilities Relate Spectrum of Clinical NGS Applications