DNA & RNA. Chapter 10
|
|
- Owen McBride
- 7 years ago
- Views:
Transcription
1 DNA & RNA Chapter 10
2 DNA Deoxyribonucleic Acid RNA Ribonucleic Acid
3 Where does DNA live? The NUCLEUS!
4 Why is DNA so Important? * DNA is a nucleic acid that contains the genetic information used in the development and functioning of all living things and some viruses. * DNA is like blueprints, instructions, or a code for making proteins * DNA s codes are converted/changed into messages (mrna) for ribosomes to read and then make proteins. * Proteins do most of the hard work of keeping us alive
5 DNA Sequence for Hemoglobin TACCACGACAGAGGACGGCTGTTCTGGTTGCAGTTCCGGCGGACCCCGTTCCAACCGCGCGTGCGAC CGCTCATACCACGCCTCCGGGACCTCTCCTACAAGGACAGGAAGGGGTGGTGGTTCTGGATGAAGGG CGTGAAGCTGGACTCGGTGCCGAGACGGGTCCAATTCCCGGTGCCGTTCTTCCACCGGCTGCGCGAC TGGTTGCGGCACCGCGTGCACCTGCTGTACGGGTTGCGCGACAGGCGGGACTCGCTGGACGTGCGC GTGTTCGAAGCCCACCTGGGCCAGTTGAAGTTCGAGGATTCGGTGACGGACGACCACTGGGACCGGC GGGTGGAGGGGCGGCTCAAGTGGGGACGCCACGTGCGGAGGGACCTGTTCAAGGACCGAAGACACT CGTGGCACGACTGGAGGTTTATGGCAATTCGACCTCGGAGCCATCGTCAAGGAGGACGGTCTACCCGG AGGGTTGCCCGGGAGGAGGGGAGGAACGTGGCCGGGAAGGACCAGAAACTTATTTCAGACTCACCCG CCTACCCACGTGGACTGAGGACTCCTCTTCAGACGCCAATGACGGGACACCCCGTTCCACTTGCACCT ACTTCAACCACCACTCCGGGACCCGTCCGACGACCACCAGATGGGAACCTGGGTCTCCAAGAAACTCA GGAAACCCCTAGACAGGTGAGGACTACGTCAATACCCGTTGGGATTCCACTTCCGAGTACCGTTCTTTC ACGAGCCACGGAAATCACTACCGGACCGAGTGGACCTGTTGGAGTTCCCGTGGAAACGGTGTGACTC ATCGACGTGACACTGTTCGACGTGCACCTAGGACTCTTGAAGTCCGAGGACCCGTTGCACGACCAGAC ACACGACCGGGTAGTGAAACCGTTTCTTAAGTGGGGTGGTCACGTCCGACGGATAGTCTTTCACCACC GACCACACCGATTACGGGACCGGGTGTTCATAGTGATT
6
7
8 What are the parts of DNA? * The Backbone Has 2 Parts 2 Strands called: Double Helix D = Deoxyribose (SUGAR) P = Phosphate
9 What are the parts of DNA? The * Rungs The Nitrogen Bases A = Adenine T = Thymine C = Cytosine G = Guanine
10 What are the parts of DNA? * Nucleotides: 1 Sugar 1 Phosphate 1 Nitrogen Base
11
12
13 How to remember Complementary Bonding Rules: A bonds with T Think: A T & T phone company
14 How to remember Complementary Bonding Rules: C bonds with G Think: Half circles
15 Lets Practice: What are the complementary nitrogen bases in this sequence of DNA? ATT CGT TAT CGT CTG AAA ACG TAA GCA ATA GCA GAC TTT TGC Yes! We made DNA! What did we just do?
16 How does DNA tell the cell to make a specific kind of protein? * There are 2 major steps in this process * First: Transcription * Second: Translation
17 Why is mrna Important? * DNA is too big and CAN T leave the nucleus it must send messages * mrna is created by DNA in the nucleus * mrna contains the messages from the DNA and are sent to ribosomes for them to read the instructions for making proteins
18 What are the parts of RNA? * Just Like DNA, RNA has: Sugar Phosphate Nitrogen Base Nitrogen Bases (A,U, C, G) U stands for Uracil. a different nitrogen base
19 RNA Nitrogen Bases: A bonds with U THYMINE in RNA!! C bonds with G
20 How does DNA tell the cell to make a specific kind of protein? Transcription : Process in which mrna is synthesized from the DNA template. HINT: *** Transcription is when mrna is made from DNA.*** * mrna: (messenger RNA) holds the recipe for making proteins
21 How does Transcription work? * QUESTION have you been to court? * There is a person typing what is said and is creating a court transcript which is really a code shortened version and later the transcript is translated into all the words that were said for a record. SHORTENED CODE = mrna
22 Lets Practice: Create a RNA strand using this sequence of DNA? ATT CGT TAT CGT CTG AAA ACG UAA GCA AUA GCA GAC UUU UGC This is mrna! We just transcribed DNA into mrna!
23 Lets Practice This Again: Create a RNA strand using this sequence of DNA? ACA CGA TTA CGG ATA CGC ATC UGU GCU AAU GCC UAU GCG UAG Now What did we what? just do? YES! We transcribed/made mrna from DNA
24 synthesize/make proteins Now What?...Translation! Translation: Process in which mrna attaches to the ribosome and a protein is assembled/made. Words to know: * Codon: 3 base code in DNA or RNA * Amino Acid: Compounds joined by peptide bonds to build proteins. Different combinations of Amino Acids make different kinds of proteins. There are 20 different Amino Acids. * Ribosome: Reads mrna recipes so it can
25 Now What?...Translation! More Words to know: * trna: (transfer RNA) Type of RNA that transports amino acids to the ribosome * Anticodon: Nitrogen bases that can pair that corresponds with the codons on the mrna
26 What happens during translation?
27
28 Translating mrna codes into amino acids to create polypeptid chains (protein chains) #1. AUG GCA UCC UGA Methionine, Alanine, Serine, Stop #2. AUG CCC GGU UAG Methionine, Proline, Glycine, Stop #3. AUG AAG GUG UGA Methionine, Lysine, Valine, Stop
29 How can knowing amino acid sequences in organisms help biologists? We can use the sequences to see how organisms are related! Which of the following two organisms are MOST closely related? Fish Sequence: Methionine, Isoleucine, Arginine, Isoleucine, Glycine, Serine Lizard Sequence: Methionine, Isoleucine, Serine, Glycine, Alanine, Tyrosine Frog Sequence: Methionine, Isoleucine, Serine, Leuicine, Lysine, Lysine Bird Sequence: Methionine, Isoleucine, Serine, Glycine, Alanine, Valine
30 The end For now
31 DNA Mutations & Technology
32 What are genetic mutations? Mutation: Permanent change in a cell s DNA, ranging from changes in a single base pair to deletions of large sections of chromosomes. Causes of mutations include: * Viruses * Radiation * Chemicals * Errors during mitosis and meiosis
33 Are mutations harmful? Some mutations are harmful, some are beneficial, and some do nothing. Harmful example: - Some mutations cause cancer & genetic disorders
34 Are mutations harmful? Helpful example: - Sickle cell anemia prevents malaria
35 Are mutations harmful? Not harmful or helpful: - Peppered moths come in dark or light colors
36 What are some types of mutations? There are many different types: Chromosomal mutations 1. Insertion
37 What are some types of mutations? 2. Deletion
38 What are some types of mutations? 3. Translocation
39
40 What are some types of mutations? 4. Duplication
41 What are some types of mutations? Gene mutations Point mutations involve changes in one or a few nucleotides 1. Substitutions: one base is changed to a different base. Only affects one amino acid or has no effect at all.
42 What are some types of mutations? Gene mutations Point mutations involve changes in one or a few nucleotides 2. Insertions and deletions: one base is inserted or removed from the DNA sequence. These are called frameshift mutations because they shift the reading frame of the genetic message.
43 How has technology changed DNA? Genetic Engineering: Technology used to manipulate an organism s DNA by inserting the DNA of another organism. Transgenic Organism: Organism that is genetically engineered by inserting a gene from another organism.
44 How has technology changed DNA? Gel Electrophoresis: Process that involves using electric current to separate certain biological molecules by size. We use this to see DNA fragments to create a DNA fingerprint - DNA fingerprints have 2 major uses: 1.Solve crimes 2.Figuring out who s the baby s daddy
45 DNA Fingerprinting Who did it? Which of the following are his/her parents?
46 What is the human genome? Genome: Total DNA in each cell nucleus of an organism The Human Genome Project: * Began in 1990 and completed in 2003 * Found that we have 3 BILLION chemical base pairs * Used to understand genetic disorders
47 What is cloning? Cloning: Process in which large numbers of identical recombinant DNA molecules are produced. Dolly the sheep was the first cloned animal
48 Clicker Question #1 These are 2 examples of nucleic acids: A. Chloroplasts & Mitochondria B. Carbohydrates & Lipids C. DNA & RNA D. Nucleus & Ribosomes
49 Clicker Question #2 DNA holds the instructions for making: A. Energy B. Proteins C. Carbon dioxide D. Deoxyribose
50 Clicker Question #3 If 20% of a DNA s strand contains Thymine, then: A. it also has 80% Guanine B. it also has 50% Cytosine C. it also has 80% Adenine D. it also has 20% Adenine
51 Clicker Question #4 What type of sugar is found in DNA? A. Phosphorous B. Thymine C. Ribose D. Deoxyribose
52 Clicker Question #6 What 3 things make up a nucleotide? A. Nucleus, DNA, & RNA B. Adenine, Thymine, & Cytosine C. Sugar, Phosphate, & a Nitrogen base D. Chromosomes, Genes, & DNA
53 Clicker Question #5 The DNA s code is converted into so it can be sent to ribosomes to make the proteins. A. DNA B. mrna C. trna D. ATP
54 Clicker Question #7 Where is mrna made? A. In the nucleus B. In the cytoplasm C. In the mitochondria D. In the ribosomes
55 Clicker Question #8 What type of sugar does RNA have? A. Deoxyribose B. Carbohydrate C. Ribonucleic acid D. Ribose
56 Clicker Question #9 Which of the following nitrogen bases does RNA not have? A. Uracil B. Thymine C. Adenine D. Cytosine
57 What does mrna do? A. It carries the instructions from DNA to ribosomes to make proteins B. It carries instructions from the ribosomes to the nucleus to make DNA C. It carries the instructions from the nucleus to the mitochondria to make energy D. It carries instructions from the nucleus to the cytoplasm to make energy
58 Clicker Question #10 If a strand of DNA contains 40% of Cytosine, then A. it also contains 40% Guanine B. it also contains 60% Thymine C. it also contains 40% Cytosine D. it also contains 60% Guanine
59 Clicker Question #12 What is transcription? A. The process of making energy B. The process of making proteins C. The process of making DNA D. The process of making mrna
60 Clicker Question #13 Where does translation occur? A. In the nucleus B. In the mitochondria C. In the DNA D. In the ribosome
61 Clicker Question #14 What is made during translation? A. DNA B. mrna C. Protein D. Energy
PRACTICE TEST QUESTIONS
PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.
More informationDNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
More informationa. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled
Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino
More informationCoding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein
Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of
More informationDNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
More informationProvincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.
Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.
More informationTranscription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
More informationThymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown
1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains
More informationGenetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
More informationFrom DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
More informationName Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
More informationMolecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
More information13.2 Ribosomes & Protein Synthesis
13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More information3120-1 - Page 1. Name:
Name: 1) Which series is arranged in correct order according to decreasing size of structures? A) DNA, nucleus, chromosome, nucleotide, nitrogenous base B) chromosome, nucleus, nitrogenous base, nucleotide,
More informationAcademic Nucleic Acids and Protein Synthesis Test
Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination
More informationStructure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
More informationGenetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
More informationRNA and Protein Synthesis
Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic
More information2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
More informationProtein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary
Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page
More informationMolecular Facts and Figures
Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are
More information12.1 The Role of DNA in Heredity
12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin
More informationMs. Campbell Protein Synthesis Practice Questions Regents L.E.
Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide
More informationMultiple Choice Write the letter that best answers the question or completes the statement on the line provided.
Name lass Date hapter 12 DN and RN hapter Test Multiple hoice Write the letter that best answers the question or completes the statement on the line provided. Pearson Education, Inc. ll rights reserved.
More informationCellular Respiration Worksheet 1. 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain.
Cellular Respiration Worksheet 1 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain. 2. Where in the cell does the glycolysis part of cellular
More informationNucleotides and Nucleic Acids
Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated
More information(http://genomes.urv.es/caical) TUTORIAL. (July 2006)
(http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA
More informationThe Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
More informationAnswer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA.
Answer: 2. Uracil Adenine, Cytosine and Guanine are found in both RNA and DNA. Thymine is found only in DNA; Uracil takes its (Thymine) place in RNA molecules. Answer: 2. hydrogen bonds The complementary
More informationISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination
More informationGenetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
More informationConcluding lesson. Student manual. What kind of protein are you? (Basic)
Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:
More informationProtein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
More information2006 7.012 Problem Set 3 KEY
2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each
More informationBasic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
More informationhttp://www.life.umd.edu/grad/mlfsc/ DNA Bracelets
http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct
More informationGene Finding CMSC 423
Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher
More informationTranslation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
More informationMutations and Genetic Variability. 1. What is occurring in the diagram below?
Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are
More informationProteins and Nucleic Acids
Proteins and Nucleic Acids Chapter 5 Macromolecules: Proteins Proteins Most structurally & functionally diverse group of biomolecules. : o Involved in almost everything o Enzymes o Structure (keratin,
More informationTo be able to describe polypeptide synthesis including transcription and splicing
Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain
More informationDNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms!
Biological Sciences Initiative HHMI DNA omponents and Structure Introduction Nucleic acids are molecules that are essential to, and characteristic of, life on Earth. There are two basic types of nucleic
More informationModeling DNA Replication and Protein Synthesis
Skills Practice Lab Modeling DNA Replication and Protein Synthesis OBJECTIVES Construct and analyze a model of DNA. Use a model to simulate the process of replication. Use a model to simulate the process
More informationFrom DNA to Protein
Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins
More informationRNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
More informationLab # 12: DNA and RNA
115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long
More informationA disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage.
CH 5 Structure & Function of Large Molecules: Macromolecules Molecules of Life All living things are made up of four classes of large biological molecules: carbohydrates, lipids, proteins, and nucleic
More informationPRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY
Name PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY Cell Structure Identify animal, plant, fungal and bacterial cell ultrastructure and know the structures functions. Plant cell Animal cell
More information1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
More information2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
More informationHands on Simulation of Mutation
Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their
More informationReview Packet- Modern Genetics
Review Packet- Modern Genetics Name 1. Base your answer to the following question on The type of molecule represented below is found in organisms. 3. The diagram below represents a structure found in most
More informationDNA. Discovery of the DNA double helix
DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:
More informationGene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)
Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A
More informationThe sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
More informationLecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
More informationMutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects
Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)
More informationUNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS
UIT (12) MLECULE F LIFE: UCLEIC ACID ucleic acids are extremely large molecules that were first isolated from the nuclei of cells. Two kinds of nucleic acids are found in cells: RA (ribonucleic acid) is
More informationHow To Understand The Chemistry Of Organic Molecules
CHAPTER 3 THE CHEMISTRY OF ORGANIC MOLECULES 3.1 Organic Molecules The chemistry of carbon accounts for the diversity of organic molecules found in living things. Carbon has six electrons, four of which
More informationLESSON 4. Using Bioinformatics to Analyze Protein Sequences. Introduction. Learning Objectives. Key Concepts
4 Using Bioinformatics to Analyze Protein Sequences Introduction In this lesson, students perform a paper exercise designed to reinforce the student understanding of the complementary nature of DNA and
More informationLecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure
Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure Nucleic acids play an important role in the storage and expression of genetic information. They are divided into
More informationGene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
More informationLecture Overview. Hydrogen Bonds. Special Properties of Water Molecules. Universal Solvent. ph Scale Illustrated. special properties of water
Lecture Overview special properties of water > water as a solvent > ph molecules of the cell > properties of carbon > carbohydrates > lipids > proteins > nucleic acids Hydrogen Bonds polarity of water
More informationBob Jesberg. Boston, MA April 3, 2014
DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double
More informationTranslation. Translation: Assembly of polypeptides on a ribosome
Translation Translation: Assembly of polypeptides on a ribosome Living cells devote more energy to the synthesis of proteins than to any other aspect of metabolism. About a third of the dry mass of a cell
More informationRegents Biology REGENTS REVIEW: PROTEIN SYNTHESIS
Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is
More informationThe Molecules of Cells
The Molecules of Cells I. Introduction A. Most of the world s population cannot digest milk-based foods. 1. These people are lactose intolerant because they lack the enzyme lactase. 2. This illustrates
More informationChapter 5: The Structure and Function of Large Biological Molecules
Name Period Concept 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things fall into just four main classes. Name them. 2. Circle the three classes that are called
More informationToday you will extract DNA from some of your cells and learn more about DNA. Extracting DNA from Your Cells
DNA Based on and adapted from the Genetic Science Learning Center s How to Extract DNA from Any Living Thing (http://learn.genetics.utah.edu/units/activities/extraction/) and BioRad s Genes in a bottle
More informationBiochemistry of Cells
Biochemistry of Cells 1 Carbon-based Molecules Although a cell is mostly water, the rest of the cell consists mostly of carbon-based molecules Organic chemistry is the study of carbon compounds Carbon
More informationDNA Paper Model Activity Level: Grade 6-8
Karen Mayes DNA Paper Model Activity Level: Grade 6-8 Students will be able to: 1. Identify the component molecules of DNA. 2. Construct a model of the DNA double-helix. 3. Identify which bases are found
More informationChapter 17: From Gene to Protein
AP Biology Reading Guide Fred and Theresa Holtzclaw Julia Keller 12d Chapter 17: From Gene to Protein 1. What is gene expression? Gene expression is the process by which DNA directs the synthesis of proteins
More informationPreliminary MFM Quiz
Preliminary MFM Quiz 1. The major carrier of chemical energy in all cells is: A) adenosine monophosphate B) adenosine diphosphate C) adenosine trisphosphate D) guanosine trisphosphate E) carbamoyl phosphate
More information2007 7.013 Problem Set 1 KEY
2007 7.013 Problem Set 1 KEY Due before 5 PM on FRIDAY, February 16, 2007. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Where in a eukaryotic cell do you
More informationBio 102 Practice Problems Genetic Code and Mutation
Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine
More informationChapter 11: Molecular Structure of DNA and RNA
Chapter 11: Molecular Structure of DNA and RNA Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the major experiments that led to the discovery of DNA as
More informationTRANSCRIPTION TRANSLATION - GENETIC CODE AND OUTLINE OF PROTEIN SYNTHESIS
TRANSCRIPTION TRANSLATION - GENETIC CODE AND OUTLINE OF PROTEIN SYNTHESIS Central Dogma of Protein Synthesis Proteins constitute the major part by dry weight of an actively growing cell. They are widely
More informationv vi vii viii ix 1 2 for high school students. For this, research needed to be done to to find a popular and engaging style of animation for this age group. The third step was to design the animation so
More informationMultiple Choice Identify the choice that best completes the statement or answers the question.
AP bio fall 2014 final exam prep Multiple Choice Identify the choice that best completes the statement or answers the question. 1. According to the first law of thermodynamics, a. the energy of a system
More informationHiding Data in DNA. 1 Introduction
Hiding Data in DNA Boris Shimanovsky *, Jessica Feng +, and Miodrag Potkonjak + * XAP Corporation + Dept. Computer Science, Univ. of California, Los Angeles Abstract. Just like disk or RAM, DNA and RNA
More information4. Which carbohydrate would you find as part of a molecule of RNA? a. Galactose b. Deoxyribose c. Ribose d. Glucose
1. How is a polymer formed from multiple monomers? a. From the growth of the chain of carbon atoms b. By the removal of an OH group and a hydrogen atom c. By the addition of an OH group and a hydrogen
More informationT C T G G C C G A C C T;
1. (a) Gene is a (length) of DNA; Gene is a sequence of bases/chain of nucleotides; Triplet (base) code/read in three s; On sense/coding strand; Triplet coding for amino acid; Degenerate code; non-overlapping;
More informationSTRUCTURES OF NUCLEIC ACIDS
CHAPTER 2 STRUCTURES OF NUCLEIC ACIDS What is the chemical structure of a deoxyribonucleic acid (DNA) molecule? DNA is a polymer of deoxyribonucleotides. All nucleic acids consist of nucleotides as building
More informationCHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the
More informationI. Chapter 5 Summary. II. Nucleotides & Nucleic Acids. III. Lipids
I. Chapter 5 Summary A. Simple Sugars (CH 2 O) n : 1. One C contains a carbonyl (C=O) rest contain - 2. Classification by functional group: aldoses & ketoses 3. Classification by number of C's: trioses,
More informationBCH401G Lecture 39 Andres
BCH401G Lecture 39 Andres Lecture Summary: Ribosome: Understand its role in translation and differences between translation in prokaryotes and eukaryotes. Translation: Understand the chemistry of this
More informationBiological molecules:
Biological molecules: All are organic (based on carbon). Monomers vs. polymers: Monomers refer to the subunits that, when polymerized, make up a larger polymer. Monomers may function on their own in some
More informationChapter 5. The Structure and Function of Macromolecule s
Chapter 5 The Structure and Function of Macromolecule s Most Macromolecules are polymers: Polymer: (poly: many; mer: part) Large molecules consisting of many identical or similar subunits connected together.
More informationProtein Synthesis Simulation
Protein Synthesis Simulation Name(s) Date Period Benchmark: SC.912.L.16.5 as AA: Explain the basic processes of transcription and translation, and how they result in the expression of genes. (Assessed
More informationChapter 14 Lecture Notes: Nucleic Acids
Educational Goals Chapter 14 Lecture Notes: Nucleic Acids 1. Know the three chemical components of a nucleotide: a monosaccharide residue (either ribose or deoxyribose), at least one phosphate group, and
More information13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
More informationChapter 3 Molecules of Cells
Bio 100 Molecules of cells 1 Chapter 3 Molecules of Cells Compounds containing carbon are called organic compounds Molecules such as methane that are only composed of carbon and hydrogen are called hydrocarbons
More informationElements in Biological Molecules
Chapter 3: Biological Molecules 1. Carbohydrates 2. Lipids 3. Proteins 4. Nucleic Acids Elements in Biological Molecules Biological macromolecules are made almost entirely of just 6 elements: Carbon (C)
More informationCCR Biology - Chapter 8 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know
More informationSpecific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons
Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA
More informationBioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
More informationBIOLOGICAL MOLECULES OF LIFE
BIOLOGICAL MOLECULES OF LIFE C A R B O H Y D R A T E S, L I P I D S, P R O T E I N S, A N D N U C L E I C A C I D S The Academic Support Center @ Daytona State College (Science 115, Page 1 of 29) Carbon
More informationDNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)
DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure
More information