DNA & RNA. Chapter 10

Size: px
Start display at page:

Download "DNA & RNA. Chapter 10"

Transcription

1 DNA & RNA Chapter 10

2 DNA Deoxyribonucleic Acid RNA Ribonucleic Acid

3 Where does DNA live? The NUCLEUS!

4 Why is DNA so Important? * DNA is a nucleic acid that contains the genetic information used in the development and functioning of all living things and some viruses. * DNA is like blueprints, instructions, or a code for making proteins * DNA s codes are converted/changed into messages (mrna) for ribosomes to read and then make proteins. * Proteins do most of the hard work of keeping us alive

5 DNA Sequence for Hemoglobin TACCACGACAGAGGACGGCTGTTCTGGTTGCAGTTCCGGCGGACCCCGTTCCAACCGCGCGTGCGAC CGCTCATACCACGCCTCCGGGACCTCTCCTACAAGGACAGGAAGGGGTGGTGGTTCTGGATGAAGGG CGTGAAGCTGGACTCGGTGCCGAGACGGGTCCAATTCCCGGTGCCGTTCTTCCACCGGCTGCGCGAC TGGTTGCGGCACCGCGTGCACCTGCTGTACGGGTTGCGCGACAGGCGGGACTCGCTGGACGTGCGC GTGTTCGAAGCCCACCTGGGCCAGTTGAAGTTCGAGGATTCGGTGACGGACGACCACTGGGACCGGC GGGTGGAGGGGCGGCTCAAGTGGGGACGCCACGTGCGGAGGGACCTGTTCAAGGACCGAAGACACT CGTGGCACGACTGGAGGTTTATGGCAATTCGACCTCGGAGCCATCGTCAAGGAGGACGGTCTACCCGG AGGGTTGCCCGGGAGGAGGGGAGGAACGTGGCCGGGAAGGACCAGAAACTTATTTCAGACTCACCCG CCTACCCACGTGGACTGAGGACTCCTCTTCAGACGCCAATGACGGGACACCCCGTTCCACTTGCACCT ACTTCAACCACCACTCCGGGACCCGTCCGACGACCACCAGATGGGAACCTGGGTCTCCAAGAAACTCA GGAAACCCCTAGACAGGTGAGGACTACGTCAATACCCGTTGGGATTCCACTTCCGAGTACCGTTCTTTC ACGAGCCACGGAAATCACTACCGGACCGAGTGGACCTGTTGGAGTTCCCGTGGAAACGGTGTGACTC ATCGACGTGACACTGTTCGACGTGCACCTAGGACTCTTGAAGTCCGAGGACCCGTTGCACGACCAGAC ACACGACCGGGTAGTGAAACCGTTTCTTAAGTGGGGTGGTCACGTCCGACGGATAGTCTTTCACCACC GACCACACCGATTACGGGACCGGGTGTTCATAGTGATT

6

7

8 What are the parts of DNA? * The Backbone Has 2 Parts 2 Strands called: Double Helix D = Deoxyribose (SUGAR) P = Phosphate

9 What are the parts of DNA? The * Rungs The Nitrogen Bases A = Adenine T = Thymine C = Cytosine G = Guanine

10 What are the parts of DNA? * Nucleotides: 1 Sugar 1 Phosphate 1 Nitrogen Base

11

12

13 How to remember Complementary Bonding Rules: A bonds with T Think: A T & T phone company

14 How to remember Complementary Bonding Rules: C bonds with G Think: Half circles

15 Lets Practice: What are the complementary nitrogen bases in this sequence of DNA? ATT CGT TAT CGT CTG AAA ACG TAA GCA ATA GCA GAC TTT TGC Yes! We made DNA! What did we just do?

16 How does DNA tell the cell to make a specific kind of protein? * There are 2 major steps in this process * First: Transcription * Second: Translation

17 Why is mrna Important? * DNA is too big and CAN T leave the nucleus it must send messages * mrna is created by DNA in the nucleus * mrna contains the messages from the DNA and are sent to ribosomes for them to read the instructions for making proteins

18 What are the parts of RNA? * Just Like DNA, RNA has: Sugar Phosphate Nitrogen Base Nitrogen Bases (A,U, C, G) U stands for Uracil. a different nitrogen base

19 RNA Nitrogen Bases: A bonds with U THYMINE in RNA!! C bonds with G

20 How does DNA tell the cell to make a specific kind of protein? Transcription : Process in which mrna is synthesized from the DNA template. HINT: *** Transcription is when mrna is made from DNA.*** * mrna: (messenger RNA) holds the recipe for making proteins

21 How does Transcription work? * QUESTION have you been to court? * There is a person typing what is said and is creating a court transcript which is really a code shortened version and later the transcript is translated into all the words that were said for a record. SHORTENED CODE = mrna

22 Lets Practice: Create a RNA strand using this sequence of DNA? ATT CGT TAT CGT CTG AAA ACG UAA GCA AUA GCA GAC UUU UGC This is mrna! We just transcribed DNA into mrna!

23 Lets Practice This Again: Create a RNA strand using this sequence of DNA? ACA CGA TTA CGG ATA CGC ATC UGU GCU AAU GCC UAU GCG UAG Now What did we what? just do? YES! We transcribed/made mrna from DNA

24 synthesize/make proteins Now What?...Translation! Translation: Process in which mrna attaches to the ribosome and a protein is assembled/made. Words to know: * Codon: 3 base code in DNA or RNA * Amino Acid: Compounds joined by peptide bonds to build proteins. Different combinations of Amino Acids make different kinds of proteins. There are 20 different Amino Acids. * Ribosome: Reads mrna recipes so it can

25 Now What?...Translation! More Words to know: * trna: (transfer RNA) Type of RNA that transports amino acids to the ribosome * Anticodon: Nitrogen bases that can pair that corresponds with the codons on the mrna

26 What happens during translation?

27

28 Translating mrna codes into amino acids to create polypeptid chains (protein chains) #1. AUG GCA UCC UGA Methionine, Alanine, Serine, Stop #2. AUG CCC GGU UAG Methionine, Proline, Glycine, Stop #3. AUG AAG GUG UGA Methionine, Lysine, Valine, Stop

29 How can knowing amino acid sequences in organisms help biologists? We can use the sequences to see how organisms are related! Which of the following two organisms are MOST closely related? Fish Sequence: Methionine, Isoleucine, Arginine, Isoleucine, Glycine, Serine Lizard Sequence: Methionine, Isoleucine, Serine, Glycine, Alanine, Tyrosine Frog Sequence: Methionine, Isoleucine, Serine, Leuicine, Lysine, Lysine Bird Sequence: Methionine, Isoleucine, Serine, Glycine, Alanine, Valine

30 The end For now

31 DNA Mutations & Technology

32 What are genetic mutations? Mutation: Permanent change in a cell s DNA, ranging from changes in a single base pair to deletions of large sections of chromosomes. Causes of mutations include: * Viruses * Radiation * Chemicals * Errors during mitosis and meiosis

33 Are mutations harmful? Some mutations are harmful, some are beneficial, and some do nothing. Harmful example: - Some mutations cause cancer & genetic disorders

34 Are mutations harmful? Helpful example: - Sickle cell anemia prevents malaria

35 Are mutations harmful? Not harmful or helpful: - Peppered moths come in dark or light colors

36 What are some types of mutations? There are many different types: Chromosomal mutations 1. Insertion

37 What are some types of mutations? 2. Deletion

38 What are some types of mutations? 3. Translocation

39

40 What are some types of mutations? 4. Duplication

41 What are some types of mutations? Gene mutations Point mutations involve changes in one or a few nucleotides 1. Substitutions: one base is changed to a different base. Only affects one amino acid or has no effect at all.

42 What are some types of mutations? Gene mutations Point mutations involve changes in one or a few nucleotides 2. Insertions and deletions: one base is inserted or removed from the DNA sequence. These are called frameshift mutations because they shift the reading frame of the genetic message.

43 How has technology changed DNA? Genetic Engineering: Technology used to manipulate an organism s DNA by inserting the DNA of another organism. Transgenic Organism: Organism that is genetically engineered by inserting a gene from another organism.

44 How has technology changed DNA? Gel Electrophoresis: Process that involves using electric current to separate certain biological molecules by size. We use this to see DNA fragments to create a DNA fingerprint - DNA fingerprints have 2 major uses: 1.Solve crimes 2.Figuring out who s the baby s daddy

45 DNA Fingerprinting Who did it? Which of the following are his/her parents?

46 What is the human genome? Genome: Total DNA in each cell nucleus of an organism The Human Genome Project: * Began in 1990 and completed in 2003 * Found that we have 3 BILLION chemical base pairs * Used to understand genetic disorders

47 What is cloning? Cloning: Process in which large numbers of identical recombinant DNA molecules are produced. Dolly the sheep was the first cloned animal

48 Clicker Question #1 These are 2 examples of nucleic acids: A. Chloroplasts & Mitochondria B. Carbohydrates & Lipids C. DNA & RNA D. Nucleus & Ribosomes

49 Clicker Question #2 DNA holds the instructions for making: A. Energy B. Proteins C. Carbon dioxide D. Deoxyribose

50 Clicker Question #3 If 20% of a DNA s strand contains Thymine, then: A. it also has 80% Guanine B. it also has 50% Cytosine C. it also has 80% Adenine D. it also has 20% Adenine

51 Clicker Question #4 What type of sugar is found in DNA? A. Phosphorous B. Thymine C. Ribose D. Deoxyribose

52 Clicker Question #6 What 3 things make up a nucleotide? A. Nucleus, DNA, & RNA B. Adenine, Thymine, & Cytosine C. Sugar, Phosphate, & a Nitrogen base D. Chromosomes, Genes, & DNA

53 Clicker Question #5 The DNA s code is converted into so it can be sent to ribosomes to make the proteins. A. DNA B. mrna C. trna D. ATP

54 Clicker Question #7 Where is mrna made? A. In the nucleus B. In the cytoplasm C. In the mitochondria D. In the ribosomes

55 Clicker Question #8 What type of sugar does RNA have? A. Deoxyribose B. Carbohydrate C. Ribonucleic acid D. Ribose

56 Clicker Question #9 Which of the following nitrogen bases does RNA not have? A. Uracil B. Thymine C. Adenine D. Cytosine

57 What does mrna do? A. It carries the instructions from DNA to ribosomes to make proteins B. It carries instructions from the ribosomes to the nucleus to make DNA C. It carries the instructions from the nucleus to the mitochondria to make energy D. It carries instructions from the nucleus to the cytoplasm to make energy

58 Clicker Question #10 If a strand of DNA contains 40% of Cytosine, then A. it also contains 40% Guanine B. it also contains 60% Thymine C. it also contains 40% Cytosine D. it also contains 60% Guanine

59 Clicker Question #12 What is transcription? A. The process of making energy B. The process of making proteins C. The process of making DNA D. The process of making mrna

60 Clicker Question #13 Where does translation occur? A. In the nucleus B. In the mitochondria C. In the DNA D. In the ribosome

61 Clicker Question #14 What is made during translation? A. DNA B. mrna C. Protein D. Energy

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3 DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown 1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

3120-1 - Page 1. Name:

3120-1 - Page 1. Name: Name: 1) Which series is arranged in correct order according to decreasing size of structures? A) DNA, nucleus, chromosome, nucleotide, nitrogenous base B) chromosome, nucleus, nitrogenous base, nucleotide,

More information

Academic Nucleic Acids and Protein Synthesis Test

Academic Nucleic Acids and Protein Synthesis Test Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

RNA and Protein Synthesis

RNA and Protein Synthesis Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page

More information

Molecular Facts and Figures

Molecular Facts and Figures Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are

More information

12.1 The Role of DNA in Heredity

12.1 The Role of DNA in Heredity 12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin

More information

Ms. Campbell Protein Synthesis Practice Questions Regents L.E.

Ms. Campbell Protein Synthesis Practice Questions Regents L.E. Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide

More information

Multiple Choice Write the letter that best answers the question or completes the statement on the line provided.

Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. Name lass Date hapter 12 DN and RN hapter Test Multiple hoice Write the letter that best answers the question or completes the statement on the line provided. Pearson Education, Inc. ll rights reserved.

More information

Cellular Respiration Worksheet 1. 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain.

Cellular Respiration Worksheet 1. 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain. Cellular Respiration Worksheet 1 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain. 2. Where in the cell does the glycolysis part of cellular

More information

Nucleotides and Nucleic Acids

Nucleotides and Nucleic Acids Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated

More information

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

Answer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA.

Answer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA. Answer: 2. Uracil Adenine, Cytosine and Guanine are found in both RNA and DNA. Thymine is found only in DNA; Uracil takes its (Thymine) place in RNA molecules. Answer: 2. hydrogen bonds The complementary

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

Genetics Test Biology I

Genetics Test Biology I Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.

More information

Concluding lesson. Student manual. What kind of protein are you? (Basic)

Concluding lesson. Student manual. What kind of protein are you? (Basic) Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

2006 7.012 Problem Set 3 KEY

2006 7.012 Problem Set 3 KEY 2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each

More information

Basic Concepts of DNA, Proteins, Genes and Genomes

Basic Concepts of DNA, Proteins, Genes and Genomes Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate

More information

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Mutations and Genetic Variability. 1. What is occurring in the diagram below?

Mutations and Genetic Variability. 1. What is occurring in the diagram below? Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are

More information

Proteins and Nucleic Acids

Proteins and Nucleic Acids Proteins and Nucleic Acids Chapter 5 Macromolecules: Proteins Proteins Most structurally & functionally diverse group of biomolecules. : o Involved in almost everything o Enzymes o Structure (keratin,

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

DNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms!

DNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms! Biological Sciences Initiative HHMI DNA omponents and Structure Introduction Nucleic acids are molecules that are essential to, and characteristic of, life on Earth. There are two basic types of nucleic

More information

Modeling DNA Replication and Protein Synthesis

Modeling DNA Replication and Protein Synthesis Skills Practice Lab Modeling DNA Replication and Protein Synthesis OBJECTIVES Construct and analyze a model of DNA. Use a model to simulate the process of replication. Use a model to simulate the process

More information

From DNA to Protein

From DNA to Protein Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

Lab # 12: DNA and RNA

Lab # 12: DNA and RNA 115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long

More information

A disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage.

A disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage. CH 5 Structure & Function of Large Molecules: Macromolecules Molecules of Life All living things are made up of four classes of large biological molecules: carbohydrates, lipids, proteins, and nucleic

More information

PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY

PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY Name PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY Cell Structure Identify animal, plant, fungal and bacterial cell ultrastructure and know the structures functions. Plant cell Animal cell

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

Review Packet- Modern Genetics

Review Packet- Modern Genetics Review Packet- Modern Genetics Name 1. Base your answer to the following question on The type of molecule represented below is found in organisms. 3. The diagram below represents a structure found in most

More information

DNA. Discovery of the DNA double helix

DNA. Discovery of the DNA double helix DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:

More information

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook) Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A

More information

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized: Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)

More information

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS UIT (12) MLECULE F LIFE: UCLEIC ACID ucleic acids are extremely large molecules that were first isolated from the nuclei of cells. Two kinds of nucleic acids are found in cells: RA (ribonucleic acid) is

More information

How To Understand The Chemistry Of Organic Molecules

How To Understand The Chemistry Of Organic Molecules CHAPTER 3 THE CHEMISTRY OF ORGANIC MOLECULES 3.1 Organic Molecules The chemistry of carbon accounts for the diversity of organic molecules found in living things. Carbon has six electrons, four of which

More information

LESSON 4. Using Bioinformatics to Analyze Protein Sequences. Introduction. Learning Objectives. Key Concepts

LESSON 4. Using Bioinformatics to Analyze Protein Sequences. Introduction. Learning Objectives. Key Concepts 4 Using Bioinformatics to Analyze Protein Sequences Introduction In this lesson, students perform a paper exercise designed to reinforce the student understanding of the complementary nature of DNA and

More information

Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure

Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure Nucleic acids play an important role in the storage and expression of genetic information. They are divided into

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

Lecture Overview. Hydrogen Bonds. Special Properties of Water Molecules. Universal Solvent. ph Scale Illustrated. special properties of water

Lecture Overview. Hydrogen Bonds. Special Properties of Water Molecules. Universal Solvent. ph Scale Illustrated. special properties of water Lecture Overview special properties of water > water as a solvent > ph molecules of the cell > properties of carbon > carbohydrates > lipids > proteins > nucleic acids Hydrogen Bonds polarity of water

More information

Bob Jesberg. Boston, MA April 3, 2014

Bob Jesberg. Boston, MA April 3, 2014 DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double

More information

Translation. Translation: Assembly of polypeptides on a ribosome

Translation. Translation: Assembly of polypeptides on a ribosome Translation Translation: Assembly of polypeptides on a ribosome Living cells devote more energy to the synthesis of proteins than to any other aspect of metabolism. About a third of the dry mass of a cell

More information

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is

More information

The Molecules of Cells

The Molecules of Cells The Molecules of Cells I. Introduction A. Most of the world s population cannot digest milk-based foods. 1. These people are lactose intolerant because they lack the enzyme lactase. 2. This illustrates

More information

Chapter 5: The Structure and Function of Large Biological Molecules

Chapter 5: The Structure and Function of Large Biological Molecules Name Period Concept 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things fall into just four main classes. Name them. 2. Circle the three classes that are called

More information

Today you will extract DNA from some of your cells and learn more about DNA. Extracting DNA from Your Cells

Today you will extract DNA from some of your cells and learn more about DNA. Extracting DNA from Your Cells DNA Based on and adapted from the Genetic Science Learning Center s How to Extract DNA from Any Living Thing (http://learn.genetics.utah.edu/units/activities/extraction/) and BioRad s Genes in a bottle

More information

Biochemistry of Cells

Biochemistry of Cells Biochemistry of Cells 1 Carbon-based Molecules Although a cell is mostly water, the rest of the cell consists mostly of carbon-based molecules Organic chemistry is the study of carbon compounds Carbon

More information

DNA Paper Model Activity Level: Grade 6-8

DNA Paper Model Activity Level: Grade 6-8 Karen Mayes DNA Paper Model Activity Level: Grade 6-8 Students will be able to: 1. Identify the component molecules of DNA. 2. Construct a model of the DNA double-helix. 3. Identify which bases are found

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein AP Biology Reading Guide Fred and Theresa Holtzclaw Julia Keller 12d Chapter 17: From Gene to Protein 1. What is gene expression? Gene expression is the process by which DNA directs the synthesis of proteins

More information

Preliminary MFM Quiz

Preliminary MFM Quiz Preliminary MFM Quiz 1. The major carrier of chemical energy in all cells is: A) adenosine monophosphate B) adenosine diphosphate C) adenosine trisphosphate D) guanosine trisphosphate E) carbamoyl phosphate

More information

2007 7.013 Problem Set 1 KEY

2007 7.013 Problem Set 1 KEY 2007 7.013 Problem Set 1 KEY Due before 5 PM on FRIDAY, February 16, 2007. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Where in a eukaryotic cell do you

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine

More information

Chapter 11: Molecular Structure of DNA and RNA

Chapter 11: Molecular Structure of DNA and RNA Chapter 11: Molecular Structure of DNA and RNA Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the major experiments that led to the discovery of DNA as

More information

TRANSCRIPTION TRANSLATION - GENETIC CODE AND OUTLINE OF PROTEIN SYNTHESIS

TRANSCRIPTION TRANSLATION - GENETIC CODE AND OUTLINE OF PROTEIN SYNTHESIS TRANSCRIPTION TRANSLATION - GENETIC CODE AND OUTLINE OF PROTEIN SYNTHESIS Central Dogma of Protein Synthesis Proteins constitute the major part by dry weight of an actively growing cell. They are widely

More information

v vi vii viii ix 1 2 for high school students. For this, research needed to be done to to find a popular and engaging style of animation for this age group. The third step was to design the animation so

More information

Multiple Choice Identify the choice that best completes the statement or answers the question.

Multiple Choice Identify the choice that best completes the statement or answers the question. AP bio fall 2014 final exam prep Multiple Choice Identify the choice that best completes the statement or answers the question. 1. According to the first law of thermodynamics, a. the energy of a system

More information

Hiding Data in DNA. 1 Introduction

Hiding Data in DNA. 1 Introduction Hiding Data in DNA Boris Shimanovsky *, Jessica Feng +, and Miodrag Potkonjak + * XAP Corporation + Dept. Computer Science, Univ. of California, Los Angeles Abstract. Just like disk or RAM, DNA and RNA

More information

4. Which carbohydrate would you find as part of a molecule of RNA? a. Galactose b. Deoxyribose c. Ribose d. Glucose

4. Which carbohydrate would you find as part of a molecule of RNA? a. Galactose b. Deoxyribose c. Ribose d. Glucose 1. How is a polymer formed from multiple monomers? a. From the growth of the chain of carbon atoms b. By the removal of an OH group and a hydrogen atom c. By the addition of an OH group and a hydrogen

More information

T C T G G C C G A C C T;

T C T G G C C G A C C T; 1. (a) Gene is a (length) of DNA; Gene is a sequence of bases/chain of nucleotides; Triplet (base) code/read in three s; On sense/coding strand; Triplet coding for amino acid; Degenerate code; non-overlapping;

More information

STRUCTURES OF NUCLEIC ACIDS

STRUCTURES OF NUCLEIC ACIDS CHAPTER 2 STRUCTURES OF NUCLEIC ACIDS What is the chemical structure of a deoxyribonucleic acid (DNA) molecule? DNA is a polymer of deoxyribonucleotides. All nucleic acids consist of nucleotides as building

More information

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the

More information

I. Chapter 5 Summary. II. Nucleotides & Nucleic Acids. III. Lipids

I. Chapter 5 Summary. II. Nucleotides & Nucleic Acids. III. Lipids I. Chapter 5 Summary A. Simple Sugars (CH 2 O) n : 1. One C contains a carbonyl (C=O) rest contain - 2. Classification by functional group: aldoses & ketoses 3. Classification by number of C's: trioses,

More information

BCH401G Lecture 39 Andres

BCH401G Lecture 39 Andres BCH401G Lecture 39 Andres Lecture Summary: Ribosome: Understand its role in translation and differences between translation in prokaryotes and eukaryotes. Translation: Understand the chemistry of this

More information

Biological molecules:

Biological molecules: Biological molecules: All are organic (based on carbon). Monomers vs. polymers: Monomers refer to the subunits that, when polymerized, make up a larger polymer. Monomers may function on their own in some

More information

Chapter 5. The Structure and Function of Macromolecule s

Chapter 5. The Structure and Function of Macromolecule s Chapter 5 The Structure and Function of Macromolecule s Most Macromolecules are polymers: Polymer: (poly: many; mer: part) Large molecules consisting of many identical or similar subunits connected together.

More information

Protein Synthesis Simulation

Protein Synthesis Simulation Protein Synthesis Simulation Name(s) Date Period Benchmark: SC.912.L.16.5 as AA: Explain the basic processes of transcription and translation, and how they result in the expression of genes. (Assessed

More information

Chapter 14 Lecture Notes: Nucleic Acids

Chapter 14 Lecture Notes: Nucleic Acids Educational Goals Chapter 14 Lecture Notes: Nucleic Acids 1. Know the three chemical components of a nucleotide: a monosaccharide residue (either ribose or deoxyribose), at least one phosphate group, and

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

Chapter 3 Molecules of Cells

Chapter 3 Molecules of Cells Bio 100 Molecules of cells 1 Chapter 3 Molecules of Cells Compounds containing carbon are called organic compounds Molecules such as methane that are only composed of carbon and hydrogen are called hydrocarbons

More information

Elements in Biological Molecules

Elements in Biological Molecules Chapter 3: Biological Molecules 1. Carbohydrates 2. Lipids 3. Proteins 4. Nucleic Acids Elements in Biological Molecules Biological macromolecules are made almost entirely of just 6 elements: Carbon (C)

More information

CCR Biology - Chapter 8 Practice Test - Summer 2012

CCR Biology - Chapter 8 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know

More information

Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons

Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA

More information

BioBoot Camp Genetics

BioBoot Camp Genetics BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before

More information

BIOLOGICAL MOLECULES OF LIFE

BIOLOGICAL MOLECULES OF LIFE BIOLOGICAL MOLECULES OF LIFE C A R B O H Y D R A T E S, L I P I D S, P R O T E I N S, A N D N U C L E I C A C I D S The Academic Support Center @ Daytona State College (Science 115, Page 1 of 29) Carbon

More information

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH) DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure

More information