From Gene to Protein. How Genes Work. AP Biology
|
|
- Byron Lindsey
- 7 years ago
- Views:
Transcription
1 From Gene to Protein How Genes Work
2 What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA proteins cells bodies
3 The Central Dogma Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein trait replication DNA gets all the glory, but proteins do all the work!
4 Transcription from DNA nucleic acid language to RNA nucleic acid language
5 RNA ribose sugar N-bases uracil instead of thymine U : A C : G single stranded lots of RNAs mrna, trna, rrna, sirna DNA transcription RNA
6 Transcription = Making mrna transcribed DNA strand = template strand untranscribed DNA strand = coding strand same sequence as RNA synthesis of complementary RNA strand transcription bubble Enzyme is RNA polymerase coding strand 5 DNA C G 3 A G A T T C T A rewinding G C T A G G C C C G A A T T U A C C G G G C T U A A 3 T T A C G A C T A G T A T unwinding 3 5 build RNA 5 3 mrna 5 RNA polymerase template strand
7 RNA polymerases 3 RNA polymerase enzymes RNA polymerase 1 only transcribes rrna genes makes ribosomes RNA polymerase 2 transcribes genes into mrna RNA polymerase 3 only transcribes trna genes each has a specific promoter sequence it recognizes
8 Which gene is read? Promoter region binding site before beginning of gene TATA box binding site binding site for RNA polymerase & transcription factors Enhancer region binding site far upstream of gene turns transcription on HIGH
9 TRANSCRIPTION = DNA RNA Occurs in - the NUCLEUS in EUKARYOTES; - in cytoplasm in PROKARYOTES
10 1. INITIATION RNA POLYMERASE binds to DNA at region called PROMOTER LIKE DNA POLYMERASE: can only attach nucleotides in 5 3 direction; UNLIKE DNA POLYMERASE: can start a chain from scratch; no primer needed In eukaryotes: TRANSCRIPTION FACTORS & TATA BOXES help position/bind to correct spot RNA POLYMERASE separates the DNA strands to begin transcription
11 2. ELONGATION RNA chain grows in the 5' 3' direction nucleotides base pair with template strand; nucleotides added to the 3' end of preceding nucleotide (60 nucleotides/sec) the non-coding strand of DNA reforms a DNA double helix by pairing with the coding strand
12 3. TERMINATION transcription proceeds until RNA polymerases reaches a TERMINATOR site on the DNA; RNA molecule is then released Segment of DNA transcribed into one RNA = TRANSCRIPTION UNIT
13 Eukaryotic genes have junk! Eukaryotic genes are not continuous exons = the real gene expressed / coding DNA Exit the nucleus introns stay in the nucleus! introns = the junk inbetween sequence Stay in the nucleus eukaryotic DNA intron = noncoding (inbetween) sequence exon = coding (expressed) sequence
14 mrna splicing Post-transcriptional processing eukaryotic DNA eukaryotic mrna needs work after transcription primary transcript = pre-mrna mrna splicing edit out introns make mature mrna transcript intron = noncoding (inbetween) sequence ~10,000 bases primary mrna transcript mature mrna transcript exon = coding (expressed) sequence pre-mrna ~1,000 bases spliced mrna
15 RNA splicing enzymes snrnps small nuclear RNA proteins Spliceosome several snrnps recognize splice site sequence cut & paste gene exon No, 5' not smurfs! snurps exon mature mrna 5' snrna intron snrnps exon 5' 3' 5' exon 3' spliceosome 3' lariat 3' excised intron
16 More post-transcriptional processing Need to protect mrna on its trip from nucleus to cytoplasm enzymes in cytoplasm attack mrna protect the ends of the molecule add 5 GTP cap - METHYLATED GUANINE added to 5 end; for stability; prevents degradation used to bind mrna to ribosome add poly-a tail - stability; helps passage through nuclear membrane longer tail, mrna lasts longer: produces more protein 3' mrna A 5' G P P P
17 From gene to protein DNA transcription nucleus cytoplasm mrna translation ribosome a a a a a a a a a a a a a a a a a a a a a a protein trait
18 Translation from nucleic acid language to amino acid language Occurs on RIBOSOMES in CYTOPLASM in both PROKARYOTES & EUKARYOTES
19 How does mrna code for proteins? 4 DNA ATCG TACGCACATTTACGTACGCGG mrna 4 protein 20 AUCG AUGCGUGUAAAUGCAUGCGCC? Met Arg Val Asn Ala Cys Ala How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?
20 mrna codes for proteins in triplets DNA mrna TACGCACATTTACGTACGCGG codon AUGCGUGUAAAUGCAUGCGCC GUA AAU GCA GCC protein? Met Arg Val Asn Ala Cys Ala
21 Cracking the code Crick - determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT MESSENGER RNA carries DNA message from nucleus to cytoplasm; message is read in triplets called CODONS 64 different codons code for 20 different amino acids; 3 bases = 1 codon = 1 amino acid
22 The code Code for ALL life! strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base wobble - codons for same amino acid can differ in 3 rd base Why is the wobble good? Start codon AUG methionine Stop codons UGA, UAA, UAG
23 How are the codons matched to amino acids? DNA 3 TACGCACATTTACGTACGCGG 5 mrna trna amino acid 5 3 AUGCGUGUAAAUGCAUGCGCC UAC Met 5 GCA Arg CAU Val codon anti-codon 3
24 Transfer RNA structure Clover leaf structure anticodon on clover leaf end amino acid attached on 3 end
25 Loading trna Aminoacyl trna synthetase enzyme which bonds amino acid to trna bond requires energy ATP AMP bond is unstable so it can release amino acid at ribosome easily activating enzyme Trp C=O Trp C=O Trp OH H 2 O OH O O trna Trp anticodon tryptophan attached to trna Trp A C C U G G mrna trna Trp binds to UGG condon of mrna
26 Ribosomes Ribosomes not making proteins exist as separate subunits Ribosomes making proteins for mebranes/ export: proteins are tagged so can be attached to rough ER; Cytoplasmic proteins made on free ribosomes
27 Ribosomes Facilitate coupling of trna anticodon to mrna codon Structure ribosomal RNA (rrna) & proteins 2 subunits: large + small Prokaryotic and eukaryotic subunits are different sizes = evidence for Endosymbiotic theory PROKARYOTIC RIBOSOMES: 30S + 50S = 70S; EUKARYOTIC RIBOSOMES: 40S + 60S = 80S E P A
28 Ribosomes A site (aminoacyl-trna site) holds trna carrying next amino acid to be added to chain P site (peptidyl-trna site) holds trna carrying growing polypeptide chain E site (exit site) empty trna leaves ribosome from exit site 5' E U A C A U G P Met A 3'
29 Building a Protein 1. Initiation Small ribosomal subunit attaches to the 5' end of the mrna ('start' codon - AUG) energy comes from GTP (guanosine triphosphate) trna carries 1 st amino acid (METHIONINE) to the mrna large ribosomal subunit attaches to the mrna
30 2. Elongation Ribosome moves along mrna matching trna ANTICODONS with mrna CODONS trna with new amino acid attaches at A site trna at A site moves to P site and receives growing chain trna a P site moves to E site and exits Released trna can recycle and bring in a new amino acid a new trna enters the A site and repeats the process increasing the polypeptide chain Leu length Met Met trna Met Met Leu Leu Leu Val Ser Ala Trp release factor UAC GAC 5' UAC 5' UACGAC AA C AAU 5' AUG C UGAAU 5' mrna A UG C UG U AUG UG 3' 3' 3' E P A UAC GAC C AA U AUG UG 3' A CC U GG UA A 3'
31 3. TERMINATION occurs when the ribosome encounters a 'stop' codon ribosome subunits detach; polypeptide is released mrna can be reread multiple time POLYSOMES- = strings of ribosomes can work on same mrna at same time
32 Protein targeting Signal peptide address label start of a secretory pathway Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc
33 SIGNAL-RECOGNITION PARTICLE (SRP) Protein synthesis begins on free ribosomes Polypeptides that will become MEMBRANE PROTEINS or be SECRETED are marked SRP (SIGNAL RECOGNITION PARTICLE) attaches to protein signal sequence and receptor on ER Growing protein chain is inserted into ER lumen, Complex disconnects
34 SRP
35 POST TRANSLATIONAL MODIFICATION Changes to polypeptide chain to make it a protein CHAPARONINS-help wrap into 3D shape Some have groups added (sugars, lipids, phosphates, etc) EX: glycoproteins (protein + sugar) Some have segments removed ZYMOGEN (OR proenzyme) = inactive enzyme precursor Requires a biochemical change to become an active enzyme Usually occurs in LYSOSOMES where specific part is cleaved EX: insulin made as one chain middle removed to become active
36 Prokaryote vs. Eukaryote genes Prokaryotes eukaryotic DNA DNA in cytoplasm circular chromosome naked DNA (Eubacteria only) no introns exon = coding (expressed) sequence Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns and exons intron = noncoding (inbetween) sequence
37 Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mrna editing ribosomes read mrna as it is being transcribed
38 DNA RNA polymerase Can you tell the story? pre-mrna exon intron 5' GTP cap amino acids trna large ribosomal subunit mature mrna poly-a tail polypeptide aminoacyl trna synthetase 3' 5' small ribosomal subunit E P A trna ribosome
39 The Transcriptional unit (gene?) enhancer b 20-30b translation start exons translation stop 3' RNA polymerase TATA TAC transcriptional unit (gene) ACT 5' DNA DNA UTR introns UTR promoter transcription start transcription stop 5' 3' pre-mrna 5' 3' GTP mature mrna AAAAAAAA
40 Bacterial chromosome Protein Synthesis in Prokaryotes Transcription mrna Psssst no nucleus! Cell membrane Cell wall
41 Any Questions?? What color would a smurf turn if he held his breath?
42 Substitute Slides for Student Print version
43
44 The Transcriptional unit enhancer b 20-30b exons 3' RNA polymerase TATA TAC transcriptional unit ACT 5' DNA introns 5' 3' 5' 3'
Protein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
More informationTranscription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
More informationDNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
More informationLecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
More informationMolecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
More informationFrom DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
More informationGenetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
More informationTranslation. Translation: Assembly of polypeptides on a ribosome
Translation Translation: Assembly of polypeptides on a ribosome Living cells devote more energy to the synthesis of proteins than to any other aspect of metabolism. About a third of the dry mass of a cell
More informationChapter 17: From Gene to Protein
AP Biology Reading Guide Fred and Theresa Holtzclaw Julia Keller 12d Chapter 17: From Gene to Protein 1. What is gene expression? Gene expression is the process by which DNA directs the synthesis of proteins
More informationStructure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
More informationCoding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein
Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of
More informationBasic Principles of Transcription and Translation
The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific traits by dictating the synthesis of
More informationa. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled
Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino
More informationName Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More informationRNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
More informationPRACTICE TEST QUESTIONS
PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.
More informationTranslation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
More informationTranscription: RNA Synthesis, Processing & Modification
Transcription: RNA Synthesis, Processing & Modification 1 Central dogma DNA RNA Protein Reverse transcription 2 Transcription The process of making RNA from DNA Produces all type of RNA mrna, trna, rrna,
More informationSample Questions for Exam 3
Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.
More information13.2 Ribosomes & Protein Synthesis
13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).
More informationSpecific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons
Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA
More information2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
More informationThe Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
More informationDNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
More informationThymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown
1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains
More informationAnnouncements. Chapter 15. Proteins: Function. Proteins: Function. Proteins: Structure. Peptide Bonds. Lab Next Week. Help Session: Monday 6pm LSS 277
Lab Next Week Announcements Help Session: Monday 6pm LSS 277 Office Hours Chapter 15 and Translation Proteins: Function Proteins: Function Enzymes Transport Structural Components Regulation Communication
More informationISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination
More informationProtein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary
Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page
More informationLecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression
More informationCHAPTER 40 The Mechanism of Protein Synthesis
CHAPTER 40 The Mechanism of Protein Synthesis Problems: 2,3,6,7,9,13,14,15,18,19,20 Initiation: Locating the start codon. Elongation: Reading the codons (5 3 ) and synthesizing protein amino carboxyl.
More informationModule 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
More informationBCH401G Lecture 39 Andres
BCH401G Lecture 39 Andres Lecture Summary: Ribosome: Understand its role in translation and differences between translation in prokaryotes and eukaryotes. Translation: Understand the chemistry of this
More informationTo be able to describe polypeptide synthesis including transcription and splicing
Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain
More informationTRANSCRIPTION TRANSLATION - GENETIC CODE AND OUTLINE OF PROTEIN SYNTHESIS
TRANSCRIPTION TRANSLATION - GENETIC CODE AND OUTLINE OF PROTEIN SYNTHESIS Central Dogma of Protein Synthesis Proteins constitute the major part by dry weight of an actively growing cell. They are widely
More informationProvincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.
Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.
More informationThe sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
More informationLecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm.
Protein Trafficking/Targeting (8.1) Lecture 8 Protein Trafficking/Targeting Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein targeting is more complex
More informationFrom DNA to Protein
Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins
More informationGenetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
More informationCentral Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription
Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional
More informationAP BIOLOGY 2009 SCORING GUIDELINES
AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following
More informationAcademic Nucleic Acids and Protein Synthesis Test
Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination
More information2006 7.012 Problem Set 3 KEY
2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each
More informationChem 465 Biochemistry II
Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Formation of the ribosomal initiation complex for bacterial protein synthesis does not require: A) EF-Tu. B) formylmethionyl
More informationLecture 4. Polypeptide Synthesis Overview
Initiation of Protein Synthesis (4.1) Lecture 4 Polypeptide Synthesis Overview Polypeptide synthesis proceeds sequentially from N Terminus to C terminus. Amino acids are not pre-positioned on a template.
More informationControl of Gene Expression
Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
More informationCHAPTER 30: PROTEIN SYNTHESIS
CHAPTER 30: PROTEIN SYNTHESIS (Translation) Translation: mrna protein LECTURE TOPICS Complexity, stages, rate, accuracy Amino acid activation [trna charging] trnas and translating the Genetic Code - Amino
More informationCells & Cell Organelles
Cells & Cell Organelles The Building Blocks of Life H Biology Types of cells bacteria cells Prokaryote - no organelles Eukaryotes - organelles animal cells plant cells Cell size comparison Animal cell
More informationEukaryotes. www.njctl.org PSI Biology Eukaryotes & Gene Expression
Eukaryotes The Eukaryotic Cell Classwork 1. Identify two characteristics that are shared by all cells. 2. Suppose you are investigating a cell that contains a nucleus. Would you categorize this cell as
More informationNucleotides and Nucleic Acids
Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated
More informationComplex multicellular organisms are produced by cells that switch genes on and off during development.
Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
More informationRNA and Protein Synthesis
Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic
More informationGENE REGULATION. Teacher Packet
AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures
More informationDNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)
DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure
More informationCCR Biology - Chapter 8 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know
More informationMs. Campbell Protein Synthesis Practice Questions Regents L.E.
Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide
More informationCellular Respiration Worksheet 1. 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain.
Cellular Respiration Worksheet 1 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain. 2. Where in the cell does the glycolysis part of cellular
More informationLecture 5. 1. Transfer of proper aminoacyl-trna from cytoplasm to A-site of ribosome.
Elongation & Termination of Protein Synthesis (5.1) Lecture 5 1. INITIATION Assembly of active ribosome by placing the first mrna codon (AUG or START codon) near the P site and pairing it with initiation
More informationLecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure
Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure Nucleic acids play an important role in the storage and expression of genetic information. They are divided into
More informationBasic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
More information1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
More informationLecture 6. Regulation of Protein Synthesis at the Translational Level
Regulation of Protein Synthesis (6.1) Lecture 6 Regulation of Protein Synthesis at the Translational Level Comparison of EF-Tu-GDP and EF-Tu-GTP conformations EF-Tu-GDP EF-Tu-GTP Next: Comparison of GDP
More informationChapter 18 Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection
More information2007 7.013 Problem Set 1 KEY
2007 7.013 Problem Set 1 KEY Due before 5 PM on FRIDAY, February 16, 2007. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Where in a eukaryotic cell do you
More informationAP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET
NAME: AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET 1. Griffith's experiments showing the transformation of R strain pneumococcus bacteria to S strain pneumococcus bacteria in the presence of
More information3120-1 - Page 1. Name:
Name: 1) Which series is arranged in correct order according to decreasing size of structures? A) DNA, nucleus, chromosome, nucleotide, nitrogenous base B) chromosome, nucleus, nitrogenous base, nucleotide,
More informationModeling DNA Replication and Protein Synthesis
Skills Practice Lab Modeling DNA Replication and Protein Synthesis OBJECTIVES Construct and analyze a model of DNA. Use a model to simulate the process of replication. Use a model to simulate the process
More informationAnswer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA.
Answer: 2. Uracil Adenine, Cytosine and Guanine are found in both RNA and DNA. Thymine is found only in DNA; Uracil takes its (Thymine) place in RNA molecules. Answer: 2. hydrogen bonds The complementary
More informationThe Nucleus: DNA, Chromatin And Chromosomes
The Nucleus: DNA, Chromatin And Chromosomes Professor Alfred Cuschieri Department of Anatomy, University of Malta. Objectives By the end of this unit the student should be able to: 1. List the major structural
More informationLab # 12: DNA and RNA
115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long
More informationChapter 4: A Tour of the Cell. 1. Cell Basics. Limits to Cell Size. 1. Cell Basics. 2. Prokaryotic Cells. 3. Eukaryotic Cells
Chapter 4: A Tour of the Cell 1. Cell Basics 2. Prokaryotic Cells 3. Eukaryotic Cells 1. Cell Basics Limits to Cell Size There are 2 main reasons why cells are so small: If cells get too large: 1) there
More informationInsulin mrna to Protein Kit
Insulin mrna to Protein Kit A 3DMD Paper BioInformatics and Mini-Toober Folding Activity Teacher Key and Teacher Notes www. Insulin mrna to Protein Kit Contents Becoming Familiar with the Data... 3 Identifying
More informationMultiple Choice Write the letter that best answers the question or completes the statement on the line provided.
Name lass Date hapter 12 DN and RN hapter Test Multiple hoice Write the letter that best answers the question or completes the statement on the line provided. Pearson Education, Inc. ll rights reserved.
More informationGiven these characteristics of life, which of the following objects is considered a living organism? W. X. Y. Z.
Cell Structure and Organization 1. All living things must possess certain characteristics. They are all composed of one or more cells. They can grow, reproduce, and pass their genes on to their offspring.
More information2013 W. H. Freeman and Company. 26 RNA Metabolism
2013 W. H. Freeman and Company 26 RNA Metabolism CHAPTER 26 RNA Metabolism Key topics: Transcription: DNA-dependent synthesis of RNA Capping and splicing: RNA processing Overview of RNA Function Ribonucleic
More informationControl of Gene Expression
Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems
More informationMicrobial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College. Eastern Campus
Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology An Introduction
More information13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
More informationProteins and Nucleic Acids
Proteins and Nucleic Acids Chapter 5 Macromolecules: Proteins Proteins Most structurally & functionally diverse group of biomolecules. : o Involved in almost everything o Enzymes o Structure (keratin,
More informationName: Date: Period: DNA Unit: DNA Webquest
Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.
More informationProtein Synthesis CHAPTER OUTLINE
40632_H08_151_188.qxp 12/14/06 12:12 PM Page 151 8 Protein Synthesis HAPTER UTLINE 8.1 8.2 8.3 8.4 8.5 8.6 8.7 Introduction Protein Synthesis ccurs by Initiation, Elongation, and Termination The ribosome
More informationBioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
More informationGene Finding CMSC 423
Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher
More informationDNA. Discovery of the DNA double helix
DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:
More informationT C T G G C C G A C C T;
1. (a) Gene is a (length) of DNA; Gene is a sequence of bases/chain of nucleotides; Triplet (base) code/read in three s; On sense/coding strand; Triplet coding for amino acid; Degenerate code; non-overlapping;
More informationThe world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
More informationAP BIOLOGY 2006 SCORING GUIDELINES. Question 1
AP BIOLOGY 2006 SCORING GUIDELINES Question 1 A major distinction between prokaryotes and eukaryotes is the presence of membrane-bound organelles in eukaryotes. (a) Describe the structure and function
More information12.1 The Role of DNA in Heredity
12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin
More informationBio 102 Practice Problems Recombinant DNA and Biotechnology
Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site
More informationReplication Study Guide
Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have
More informationReview Packet- Modern Genetics
Review Packet- Modern Genetics Name 1. Base your answer to the following question on The type of molecule represented below is found in organisms. 3. The diagram below represents a structure found in most
More informationControl of Gene Expression
Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationBiological cell membranes
Unit 14: Cell biology. 14 2 Biological cell membranes The cell surface membrane surrounds the cell and acts as a barrier between the cell s contents and the environment. The cell membrane has multiple
More informationOverview of Eukaryotic Gene Prediction
Overview of Eukaryotic Gene Prediction CBB 231 / COMPSCI 261 W.H. Majoros What is DNA? Nucleus Chromosome Telomere Centromere Cell Telomere base pairs histones DNA (double helix) DNA is a Double Helix
More informationGenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
More informationHiding Data in DNA. 1 Introduction
Hiding Data in DNA Boris Shimanovsky *, Jessica Feng +, and Miodrag Potkonjak + * XAP Corporation + Dept. Computer Science, Univ. of California, Los Angeles Abstract. Just like disk or RAM, DNA and RNA
More informationGene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
More information